miRTarBase - #MIRT023314 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DMXL1   
Synonyms -
Description Dmx like 1
Transcript NM_005509   
Expression
Putative miRNA Targets on DMXL1
3'UTR of DMXL1
(miRNA target sites are highlighted)
>DMXL1|NM_005509|3'UTR
   1 CATTTTTACAATAAGATGTACAATTTATTACCTATATGGAAGTGGCCAACAGATATAATATACAGTGATCATTCTCTATG
  81 CCACAAATTAGCTAATGCTTTCTTGTTTTTATATTTATTTTATGGAGCTTTGCCCTTGATGCACTGATGCCTTAAAAATT
 161 AACAAGGTCATTCAGAAGTAGATTACATTGCCTAAAGTAGAATGTGTAAGTAATGCTGTAATAATACATATCATAGTATA
 241 TTATAATCAGTATGTCATAGTGTTAAAGGTGTTTTGTTTTCTTATTGATACTTTTCCACAGGCATCTCTGCATGAATTTC
 321 TTCCACAGTAAAAATACGTTTTTTGTAAAGGCAATTGTACATAATACTCATCACTTAATTCACCACACTCTCACTTCCTT
 401 TATTAGCCTTATACATCTCAAACTCTTCTCTTAATTAATGATAGGTATTTGAGTAAGAATGAAAAAAATAATGAACATCT
 481 TCATTAAAATTGTCATTGAGACGTCAGTGATAAATGAGCTAGATGGCTCAATATGTAAGGTTTTCAGTAGTTTACCCTCC
 561 GGAACCCAAGTTGTATGTATGTATACGTGTGTGTGTGTGTGTGTGTGTGTATCTTACACATCTTATTTGAACTTAGTTGT
 641 ATATATTAGCGAAAACTGGTTTTTCATGTGTTTTTGTGCCATAACAACTATTGCCACCAGAATAACTTTTTTTTTGCAAC
 721 TGTGCTTTTCATTTTTAAAAAATTTTTGAATTCCCATCCTAATTTTCAAATAAGTTTCAAGGAGACTATCAGGATTATTA
 801 TTTTAAAGATTAGATTTAGTCAAATAAGTCTTAGCAGGCAATAAAGTTTCTGTGGTGGCATATATCATGTAAGACACTTA
 881 AAGTAAGTTTGTGAATTTGTCAACTTTCGAGCATCAAACAAATATTTTACTTAAATTTTATTTTATCTTATTTTTAGGTG
 961 CTTTTAATCTCAAAATTCTGAAAAGCGAATAGCAGTGTTTTCAGAAACAAATGTGAAAGCAGTCAAATTAAGTAGATACT
1041 ATTTAGAAATGTAAAATACTCTCCAGATCTACCATTAATAGAAAATAAACTAAACCTTATATTTTATTTTTGCCAAAATA
1121 TTTTATTATAAAATATGACCAAAATATTTAAAATGCACAATGCTTTTAACTTAAATGTGCTAACCCTGTTTCTGTCTGTT
1201 TTGTGCTGTACCTTTTCTGATTCAGAATTATAGAAAACTTGATAAATACTTGATTTTAACCAATGAGACTACAGGCAGAT
1281 GGGACTAAGTGTTTATGGGACAATTATGTACTATTTAACTTAAATATATTTTGTTTAATAGGAAATATATAATAATAGCA
1361 TTTTATGTAATAAAATATGGGCAACGATTATCTTGGAAATTAAAGAGTCAAAGCAAAGAAATGAAGGGCTGGTAAAATGA
1441 ATTTTGTAATATCCTCAGGATACTTTTATCTTAAAAGTATGTTGTTAAAGATTTTGTAAATTGTATTTCAACAATTTTAA
1521 ATGTGTTGAGCAAGTTGCAGTGCAAACACTGTCATTATGTAGAGAGTTTATATGCACATAATAACCTGTACCTATAAATC
1601 GTGCAATAACCATATGCGACTATTTTGCCATGGAGAAATCTGACAGCATTGCAAACAATAGTATTGTTTGATGTAGTTAA
1681 CCTTAAGTTATTTTTCAGTAATTTCTTCACAAATCAAGATTCAAACAGCTTTAAACACTTCCAATGAGATAAAATATTTA
1761 CTATTATGCTTATTAGAACAAAAGGTGTTTAAGGATGAACTAAATATTTTAATTGAGCATTTATATGGATAATCATACAT
1841 TATGTAAGCCCATATGTATTTACATCCAGAGTCATAATATTTTAAATAAACAATCATGCAGAAACTTTTTAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |||| | ||   |||||:| 
Target 5' caAACAGC-TTTAAACACTTCc 3'
1722 - 1742 139.00 -14.30
2
miRNA  3' guUUGUGG--UAA-CAGUGUGAGGu 5'
            | |||:  |||   |||||||: 
Target 5' tcATCACTTAATTCACCACACTCTc 3'
368 - 392 138.00 -12.12
3
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              || :| | |:|| |||| 
Target 5' ttttCAGTAGT-TTACCCTCCg 3'
541 - 561 121.00 -10.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31516444 7 COSMIC
COSN31497097 12 COSMIC
COSN30160518 13 COSMIC
COSN507942 15 COSMIC
COSN30493693 26 COSMIC
COSN31523480 252 COSMIC
COSN31579590 269 COSMIC
COSN1305795 306 COSMIC
COSN31539033 338 COSMIC
COSN22384977 517 COSMIC
COSN24837752 610 COSMIC
COSN20101720 611 COSMIC
COSN18723818 612 COSMIC
COSN20101721 716 COSMIC
COSN17075831 909 COSMIC
COSN7859492 936 COSMIC
COSN30539646 948 COSMIC
COSN31548633 1114 COSMIC
COSN31520965 1124 COSMIC
COSN16129625 1226 COSMIC
COSN5067711 1426 COSMIC
COSN31587969 1464 COSMIC
COSN26581326 1524 COSMIC
COSN29024893 1535 COSMIC
COSN30541084 1618 COSMIC
COSN31522626 1706 COSMIC
COSN31959957 1817 COSMIC
COSN15293383 1820 COSMIC
COSN31569700 1842 COSMIC
COSN6858800 1887 COSMIC
COSN32063522 1894 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs771868790 1 dbSNP
rs1284154371 4 dbSNP
rs1158219111 12 dbSNP
rs370042682 14 dbSNP
rs760628920 16 dbSNP
rs1222645901 18 dbSNP
rs1276459774 19 dbSNP
rs527599716 24 dbSNP
rs753612213 26 dbSNP
rs773247501 26 dbSNP
rs1407200090 33 dbSNP
rs1215901129 35 dbSNP
rs754776576 36 dbSNP
rs1487020745 37 dbSNP
rs764277951 42 dbSNP
rs1016353230 47 dbSNP
rs1269125685 49 dbSNP
rs1340451946 50 dbSNP
rs1480336589 51 dbSNP
rs751799414 51 dbSNP
rs757500155 52 dbSNP
rs1272091600 53 dbSNP
rs980024123 57 dbSNP
rs1307594539 62 dbSNP
rs1423107460 69 dbSNP
rs536040482 79 dbSNP
rs898254070 86 dbSNP
rs1425760868 98 dbSNP
rs1416438989 105 dbSNP
rs1467228117 110 dbSNP
rs1297847885 120 dbSNP
rs962765674 124 dbSNP
rs995661568 133 dbSNP
rs1162857458 137 dbSNP
rs1474915437 145 dbSNP
rs1354116029 148 dbSNP
rs1460676122 149 dbSNP
rs1190659528 151 dbSNP
rs1482296693 153 dbSNP
rs1250197923 159 dbSNP
rs1025337557 165 dbSNP
rs536820929 166 dbSNP
rs547388185 168 dbSNP
rs188774376 171 dbSNP
rs796808072 178 dbSNP
rs1291957331 181 dbSNP
rs1342982453 183 dbSNP
rs1293870935 187 dbSNP
rs765612845 195 dbSNP
rs1328543736 198 dbSNP
rs1218670760 201 dbSNP
rs555238633 205 dbSNP
rs942835950 211 dbSNP
rs1044040268 222 dbSNP
rs1398986150 224 dbSNP
rs1291983128 226 dbSNP
rs549846586 234 dbSNP
rs1461025087 237 dbSNP
rs573023462 237 dbSNP
rs1256292665 239 dbSNP
rs925506368 240 dbSNP
rs935706967 241 dbSNP
rs1053219030 243 dbSNP
rs1482797407 244 dbSNP
rs762138883 250 dbSNP
rs891424490 258 dbSNP
rs1013968315 259 dbSNP
rs1045450253 272 dbSNP
rs1136729 277 dbSNP
rs1136730 282 dbSNP
rs949434228 282 dbSNP
rs1273211767 283 dbSNP
rs1136732 285 dbSNP
rs905744827 286 dbSNP
rs1327077403 294 dbSNP
rs1278873821 295 dbSNP
rs1239569129 299 dbSNP
rs1001306122 300 dbSNP
rs1299506536 301 dbSNP
rs1440385910 323 dbSNP
rs1016880817 327 dbSNP
rs1371836669 328 dbSNP
rs540749486 328 dbSNP
rs962963512 338 dbSNP
rs1159629438 339 dbSNP
rs994075020 339 dbSNP
rs1455708491 346 dbSNP
rs926886141 355 dbSNP
rs1194411991 357 dbSNP
rs1418908348 360 dbSNP
rs1026067827 363 dbSNP
rs938227309 375 dbSNP
rs1253237620 382 dbSNP
rs1195021777 390 dbSNP
rs758304197 393 dbSNP
rs1283529299 399 dbSNP
rs1426890276 399 dbSNP
rs986916252 401 dbSNP
rs147009038 404 dbSNP
rs964228688 405 dbSNP
rs1348952091 406 dbSNP
rs1305880434 412 dbSNP
rs1433051300 413 dbSNP
rs1325898887 415 dbSNP
rs138231694 416 dbSNP
rs1384366595 421 dbSNP
rs1400530686 425 dbSNP
rs367893188 431 dbSNP
rs1362955539 433 dbSNP
rs1435715871 434 dbSNP
rs1175099252 439 dbSNP
rs1395359130 439 dbSNP
rs561919426 444 dbSNP
rs886831861 445 dbSNP
rs1193827541 452 dbSNP
rs1007904560 454 dbSNP
rs1255311183 455 dbSNP
rs1209963440 456 dbSNP
rs1019250467 459 dbSNP
rs76045084 463 dbSNP
rs935586767 472 dbSNP
rs1052669313 473 dbSNP
rs912935794 474 dbSNP
rs751535235 495 dbSNP
rs1230262992 503 dbSNP
rs1045481325 504 dbSNP
rs1346753331 517 dbSNP
rs1312785799 525 dbSNP
rs17145034 532 dbSNP
rs1287922137 536 dbSNP
rs780770544 540 dbSNP
rs1314355073 541 dbSNP
rs1488542006 547 dbSNP
rs1418174488 561 dbSNP
rs553023002 562 dbSNP
rs35886280 565 dbSNP
rs1240348151 566 dbSNP
rs143372323 567 dbSNP
rs2896840 574 dbSNP
rs1426089757 575 dbSNP
rs1485894110 576 dbSNP
rs926624354 581 dbSNP
rs1037904377 587 dbSNP
rs1234388887 587 dbSNP
rs1247458994 587 dbSNP
rs141470513 587 dbSNP
rs527412585 587 dbSNP
rs754808189 587 dbSNP
rs920832793 587 dbSNP
rs938300753 587 dbSNP
rs71585207 588 dbSNP
rs1172101128 589 dbSNP
rs1047856945 590 dbSNP
rs1382559935 592 dbSNP
rs763479045 603 dbSNP
rs1475459425 610 dbSNP
rs1420763723 612 dbSNP
rs1175329473 616 dbSNP
rs1469420137 618 dbSNP
rs1318232231 620 dbSNP
rs1233709502 627 dbSNP
rs1343999238 630 dbSNP
rs777447489 632 dbSNP
rs573690092 633 dbSNP
rs1293637667 636 dbSNP
rs73247077 637 dbSNP
rs1223626644 639 dbSNP
rs1374469905 640 dbSNP
rs1279802903 643 dbSNP
rs1025551818 646 dbSNP
rs1448469465 647 dbSNP
rs1231637933 651 dbSNP
rs145791993 652 dbSNP
rs1461501245 653 dbSNP
rs1351602415 657 dbSNP
rs1156804828 661 dbSNP
rs1399929142 667 dbSNP
rs955395873 669 dbSNP
rs772449986 674 dbSNP
rs1179188670 677 dbSNP
rs1452740413 683 dbSNP
rs1223057150 684 dbSNP
rs1018398017 691 dbSNP
rs1032694022 692 dbSNP
rs1240906245 695 dbSNP
rs1215651114 698 dbSNP
rs1317921643 699 dbSNP
rs964135106 702 dbSNP
rs1241872298 706 dbSNP
rs5870844 707 dbSNP
rs796296264 707 dbSNP
rs377629915 708 dbSNP
rs1253723084 716 dbSNP
rs75938587 716 dbSNP
rs1302217574 718 dbSNP
rs576492702 719 dbSNP
rs1369052208 720 dbSNP
rs1191984383 721 dbSNP
rs1032934415 723 dbSNP
rs1440678905 725 dbSNP
rs1429874843 729 dbSNP
rs971260155 731 dbSNP
rs1160308728 734 dbSNP
rs982152804 737 dbSNP
rs1394760999 740 dbSNP
rs181731216 741 dbSNP
rs988840483 744 dbSNP
rs1406372852 750 dbSNP
rs138425227 755 dbSNP
rs527535626 759 dbSNP
rs1186460457 764 dbSNP
rs1486439120 767 dbSNP
rs1244328150 768 dbSNP
rs1209248160 772 dbSNP
rs1485535807 782 dbSNP
rs949750915 783 dbSNP
rs981086980 787 dbSNP
rs973347940 789 dbSNP
rs920851662 796 dbSNP
rs1292741458 801 dbSNP
rs547723308 824 dbSNP
rs926938490 825 dbSNP
rs912055244 829 dbSNP
rs937088990 831 dbSNP
rs1412747414 839 dbSNP
rs1038088465 841 dbSNP
rs1263467008 842 dbSNP
rs898356346 853 dbSNP
rs1467722391 855 dbSNP
rs1371407201 859 dbSNP
rs1040796152 860 dbSNP
rs76524404 861 dbSNP
rs1426470302 863 dbSNP
rs932321226 869 dbSNP
rs1047443363 883 dbSNP
rs891032407 886 dbSNP
rs1272545135 895 dbSNP
rs1009484579 903 dbSNP
rs3797338 908 dbSNP
rs1018303822 909 dbSNP
rs899801414 910 dbSNP
rs1440446546 912 dbSNP
rs1001392942 924 dbSNP
rs1032426995 931 dbSNP
rs1354594944 935 dbSNP
rs186398723 935 dbSNP
rs1293609548 943 dbSNP
rs1033738385 957 dbSNP
rs988314534 987 dbSNP
rs529693066 988 dbSNP
rs549547223 991 dbSNP
rs1462595766 993 dbSNP
rs973813839 996 dbSNP
rs6887690 1008 dbSNP
rs1461321667 1009 dbSNP
rs1419210032 1013 dbSNP
rs1190122105 1016 dbSNP
rs1231541188 1023 dbSNP
rs980949715 1039 dbSNP
rs1248032340 1040 dbSNP
rs532129540 1042 dbSNP
rs1457837752 1047 dbSNP
rs116007681 1062 dbSNP
rs1417842550 1065 dbSNP
rs1446381167 1068 dbSNP
rs1459390169 1071 dbSNP
rs1172236603 1081 dbSNP
rs1136734 1085 dbSNP
rs373178797 1086 dbSNP
rs1136735 1094 dbSNP
rs1409027594 1096 dbSNP
rs1156851232 1100 dbSNP
rs1273722829 1100 dbSNP
rs1333734161 1101 dbSNP
rs191248929 1110 dbSNP
rs1342039971 1126 dbSNP
rs1448559066 1134 dbSNP
rs974268403 1136 dbSNP
rs534165129 1137 dbSNP
rs919666344 1138 dbSNP
rs568343425 1141 dbSNP
rs974881111 1147 dbSNP
rs1165479177 1150 dbSNP
rs1292574218 1156 dbSNP
rs554038952 1161 dbSNP
rs929825521 1163 dbSNP
rs1046943477 1181 dbSNP
rs890937953 1185 dbSNP
rs943946163 1186 dbSNP
rs1439851738 1187 dbSNP
rs567645153 1190 dbSNP
rs1239608296 1191 dbSNP
rs1191269670 1204 dbSNP
rs536631715 1215 dbSNP
rs1467620351 1228 dbSNP
rs932352324 1231 dbSNP
rs1039635701 1232 dbSNP
rs1053904148 1237 dbSNP
rs1340249099 1238 dbSNP
rs899873217 1243 dbSNP
rs1195446732 1244 dbSNP
rs1259862908 1250 dbSNP
rs1271224883 1262 dbSNP
rs371578784 1265 dbSNP
rs1356193422 1287 dbSNP
rs1000857092 1288 dbSNP
rs556295160 1300 dbSNP
rs1440319409 1301 dbSNP
rs1371772349 1304 dbSNP
rs1326139919 1315 dbSNP
rs1380966663 1319 dbSNP
rs1384701796 1320 dbSNP
rs1212102639 1323 dbSNP
rs770109656 1335 dbSNP
rs1289883508 1336 dbSNP
rs559597484 1345 dbSNP
rs1474527859 1349 dbSNP
rs1171326757 1369 dbSNP
rs1453299787 1381 dbSNP
rs892564890 1386 dbSNP
rs1445280360 1387 dbSNP
rs1260943671 1388 dbSNP
rs576454294 1396 dbSNP
rs1042289862 1408 dbSNP
rs1003339499 1410 dbSNP
rs906430366 1410 dbSNP
rs1278499720 1417 dbSNP
rs1233784593 1421 dbSNP
rs1054845202 1439 dbSNP
rs1474834211 1440 dbSNP
rs895273613 1441 dbSNP
rs1225323732 1443 dbSNP
rs1326412672 1452 dbSNP
rs1319530153 1456 dbSNP
rs545174147 1457 dbSNP
rs1402287546 1462 dbSNP
rs1373983028 1465 dbSNP
rs1435070224 1466 dbSNP
rs994922008 1472 dbSNP
rs1433645976 1474 dbSNP
rs530681582 1480 dbSNP
rs950728116 1481 dbSNP
rs1373497317 1487 dbSNP
rs1010044605 1510 dbSNP
rs1019222759 1539 dbSNP
rs1194249754 1550 dbSNP
rs1478695101 1561 dbSNP
rs1255069509 1578 dbSNP
rs558742917 1585 dbSNP
rs1210440350 1590 dbSNP
rs1443276845 1593 dbSNP
rs773612791 1595 dbSNP
rs974912189 1601 dbSNP
rs970834804 1602 dbSNP
rs1002444143 1607 dbSNP
rs1033890591 1611 dbSNP
rs958639011 1612 dbSNP
rs747596948 1618 dbSNP
rs762784452 1619 dbSNP
rs149267230 1623 dbSNP
rs1340750400 1625 dbSNP
rs1226860385 1631 dbSNP
rs1407748707 1632 dbSNP
rs951179152 1650 dbSNP
rs1171318392 1660 dbSNP
rs1268611783 1660 dbSNP
rs1347444364 1663 dbSNP
rs1235423396 1664 dbSNP
rs1415572196 1664 dbSNP
rs1042410704 1667 dbSNP
rs766305420 1670 dbSNP
rs982486931 1673 dbSNP
rs755759162 1682 dbSNP
rs1437337954 1690 dbSNP
rs541257618 1695 dbSNP
rs180830352 1699 dbSNP
rs1258726734 1703 dbSNP
rs939269593 1716 dbSNP
rs1219431019 1718 dbSNP
rs912435701 1728 dbSNP
rs943851425 1732 dbSNP
rs1229291826 1741 dbSNP
rs1039668263 1745 dbSNP
rs144511410 1755 dbSNP
rs1439500600 1764 dbSNP
rs921179854 1769 dbSNP
rs1331515904 1779 dbSNP
rs751384512 1786 dbSNP
rs1392257026 1788 dbSNP
rs886495846 1788 dbSNP
rs1405770554 1794 dbSNP
rs1415629945 1801 dbSNP
rs759507823 1806 dbSNP
rs3733854 1807 dbSNP
rs1469880208 1815 dbSNP
rs767424382 1816 dbSNP
rs1180643828 1817 dbSNP
rs1467170132 1818 dbSNP
rs1454463078 1820 dbSNP
rs892423646 1823 dbSNP
rs1009616070 1829 dbSNP
rs1222894873 1836 dbSNP
rs1282517393 1839 dbSNP
rs752224241 1842 dbSNP
rs563143389 1851 dbSNP
rs1352600045 1856 dbSNP
rs966325073 1860 dbSNP
rs906749853 1865 dbSNP
rs1368096895 1867 dbSNP
rs1194503700 1875 dbSNP
rs996424111 1887 dbSNP
rs1029194873 1888 dbSNP
rs755674870 1889 dbSNP
rs1289359766 1890 dbSNP
rs957544237 1892 dbSNP
rs777356295 1893 dbSNP
rs1034373091 1894 dbSNP
rs1381196368 1896 dbSNP
rs532195589 1903 dbSNP
rs1332996369 1908 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*