miRTarBase - #MIRT023304 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol UBE2K   
Synonyms E2-25K, HIP2, HYPG, LIG, UBC1
Description ubiquitin conjugating enzyme E2 K
Transcript NM_001111112   
Other Transcripts NM_001111113 , NM_005339   
Expression
Putative miRNA Targets on UBE2K
3'UTR of UBE2K
(miRNA target sites are highlighted)
>UBE2K|NM_001111112|3'UTR
   1 GGCATAGAGAGCTGCTGATATAGTCAAGCTTGCCTCTTCTTGAGGAGCACCAACATCTGTTATTTTTAGGATTCTGCATA
  81 GATTTCTTTTAAACTGGCATTCTTGCCTAATGATGTTATCTAGGCACCATTGGAGACTGAAAAAAAAAAATCCCTGCTCT
 161 GTAAATAAAGCTAATTAAACGTCTGTGTAAATTTAAAAAGGGGAAATACTTTAATTTTTTTTCTTAATAGTGTAAAAATT
 241 CCCTGAGCTAAGCTAAAACCATGGAAGAAACATGCTACTTTAGTGTTTAGCAGTGTACCAAGACTAGCAAGAGTTTGCTT
 321 CAGGATTTTGTTGAATAATTAAGATAATATTTTGAGTGTGTCAGGGCCATTCAAATTGTTGGTGTTGCATCACAGCTACC
 401 TTAACTGTTTTTAACATGGATCCTCTGTGCCTGTGAATTTACTTGCATGCTTGTACTTGACTTCTTAGGATGGGTAGCTG
 481 AAAAGACCACCATTTTAAGCATTTGAGAATTCTTAAATATGAAATTTATTCAGAATTGAAGATGGTGACCTATTCAGAGC
 561 CTTTTTGTCCTTGTCAACAGACTGGGACAGTGTCTGATTCCCCCTTCACCCCCCCCACCCCCGCCTTGCCACACACAGCT
 641 AATATTCTAATGGTAAATTTCTCTGTATCAGGTGGGGAAATGTGCTGAAGGACAGTATGTATCCCTTGCTTCATTTTTAG
 721 GTCGTAGGTTTGGAATGTCTTGTCCCAGTTCTTCAAACACTCTTAAATTTTTCTTAAGTAATGTAAAAATGGAACTGCCA
 801 ATTTTATTTCTCTTGCAAAAATAGTAAATACTTGATGTTACATTATTCCCAGGTTTAATGAAAGAACCCAACTTAGTTTT
 881 TCAGTGAATTTGACACCTATTTTTTAGTGATGAAATTTTTCTTTGAGAACTGGCAAGGATGCAGTCAGCTGTTTGCAGTT
 961 TTTAGCCTGATTTTGGGGTCTATAGAGATTGCTTTATTGGATACTTCAAGTCATTCTTGCTTGCACTTCCCCTATTGACA
1041 CATGAAAGCTGTGTTGGTGTTTTATTGTACATACTTCAGATGCACATAGGAATAGAAGTGTGTTATAAATCTAGCTTTCT
1121 TTATGATGTTTCTGATAATACGAGAATTGAAAACTTTACCTTCTCTTGTACATAGTCAGACTATTTGTATTAAATTTACA
1201 TTTCATTCTAAGTTCAAAAGTTTGAAAATTATTAGTTTTGCAAGATCACACACTAATGTAACCATTTTATGAAGGTTGAA
1281 GTGGATTTATGCAGGCAGTTCTATATATAGAAATACAATTCTTTTTAAATTTTTAGGACCAATACAAAATAACAAAAATG
1361 TAATGGAATCAGACTGAATTAAAGTAAGGCTGTATATTGAAAGTCATATTATAAAAGGTTTGCTTTCTTTAAGTGTTATT
1441 TATCTTAAATTATAATCGTTAAATGTTTGGAAGATAATTTTTGAATCATAACGTCAGCATAACTTCATTTGACTTCTCAA
1521 TAATCTTGATACTAGAAGCAATAAAAGAACCATTATTAAATATATTGTAATGTTAAAGATGTGAAGGTTCTTCCAAAAAT
1601 TTGTAAGGCTTTCCTAATTAACAGTAAACTCTTATAGCTGATATTATTACATACTAAACACAAGTTGCTGTTTTTTCCCC
1681 ATATGTTTGCTTACGCATGTCTTTATACAATCACCTCTTTTTATTGCTGTAGTTTATTTTCTAAAGATGCCAAAGGAAAC
1761 AAGATTTTTCTTTATTTATTTTAAATACCTGAAACCTCGTACTTTATATTTTGAAGTAAGGTGGGATTGTGTGAAAATGT
1841 GGATGGTTTTTCTCCAGTGTTGGTTAGAACTACTTTTTTTAAGTGGAGGGCAACTTGGTAGTATTAGTAGAATTTGGGTT
1921 TAAAAATATCAGACACATCTACCCAGTTTATTTTTTGCCTGTATTATCAGGGTATATTTAATTGTCCTGTGGTTAAACAA
2001 AGGTGAGAGAGCTCAGAGGTTTCTAAAGGTCAAGCATTTTACATATATACATACATACATGCTCTTGGAGGCAGCTATAT
2081 CCTGCTTTGATTTTTATGCACATGAGCCCTATAGGGTTATATACTCATCTAACTACACTTCAGCATCCCCAGTGCCCAAG
2161 AAATTGGAAAGTACAATATTTGGTTTGAGACATTCTTCATAAAAGATTCTTTATTATAAAAATTTACCTCATTTACATTT
2241 AATGTGATGATCTTTTTTTTCCTTTCTGGTATATTTCCCACTGTACTGTTTGGTTTTTGTTATTCTCTTGTCTGTGGGTA
2321 GATTTAGTTACCCAAACATAGAAACTAAAGCAATTGCTTTTTTCCTCTGGTCTTAAATATGTTTGGACAAAAAGACACTA
2401 AAAGGTCAGGCCTAGGGGAAAAGTACCCTGGTGGAAATTATTTTTGTAATTCTTAATATTTTTGAGTTGGCTCCGTTTGT
2481 CAGTTTTAAAAGCCTCAAAAATTATGTTAAAAAAAAAATCCAGTGAAATCCCATTTAGGGCAGGCCGATTTGTTAGAAGT
2561 CACTGATGCTCCAGTAGGCTTTTGTTATAATCAGGCCTGTTTCCTGAGTATGTGCCTCTTTTAAAAGAAGAAATAATTAG
2641 CTGTATAGTATTTCAGTACTGATGAATGAATGAATGAATGAATGGCAGTTAGTGGACCCAAATAAGTATTCAGTGGTATA
2721 TAAATATTTGAGGAACTAGGTACTGAATTAGGTGCTCTGAGTTGGCACCCCGAAATGTTTGGAATCACGACTATGATTTA
2801 CTTAAACACGTAACACATTCAAGGATATATAAATGGAGTCTAAGTATTTTGCTTTTGAAGAGAATAATCTATGAAATGGA
2881 AGACTTGATTTTTTTTTTCATTTTTTAGAAGTAATACACATTTATGATTGTTGGCACATAAAACTATGCAAAATAATTCT
2961 TTTTAAGTATCTGTAAGAAAGAATTGGCAGTTTAAACGGATTTTGCTTATTTATGCACTACAGAATGCAGCATACTGTAT
3041 TACTGTTGAGGCTGCTTAATAAGTTTACCAATGTGAAAAGCAGATCTTGGGTATAAGTGTATGCCTGATTTGAGCTTTTA
3121 AAACTGTGCAGTAGGTGTATGGTAATGTTTTACAATCCTATGTAGCAAAATAGGAAATTATGAATTTTTGTTGTTATTGT
3201 TTTAAAGATTTAAGATGGATTGGGGTAGGGAACAGCTGGAGCCAGGTATACCTTCTAGTATGTAGAGGGAAACAATGTTT
3281 AGATAGGAAAAAGGAAGCCGTCTGTTTACAGTTAACTTTATTTCATGGACTTCTACAAAATGTTGTATTAATCACTTTTT
3361 CTAGTTCAAGGAATTTCAATTCCAGGGTACAAACCATTGATTTAAAAATTACGTTTCCATTCTTTTTAGTATCAGTTTAA
3441 AGTAAATGCTTACCATCAGCCAGTTGCTGTCACTGGGAAGAAGGCAACTTGAAGTATTTACTGATAAAATAGCCTTTATT
3521 CCCAAGTGTGACTTTTCTTCAGTGTCTACATATTATGTCACACGTTCTATTTGCACTGCTGCAATATAGATCAAAGATCT
3601 TGTGGCATAGGGGTAGGGGAGTGTTAGTATCTCCCTTGTCCCATTTGTTCTGTTACTGCTTCATTGGACTGATACACCCT
3681 CATGAACTTGCAATCACCTAAATGGAAGTCTTGAATGTGTCACCTTTTGCTTGGTTATTTCAACCATGCTGCTATATATA
3761 ATCAGGTGTGGCACAGTTTGTCAGTTTGATTATAGGTGTGAGTGGATAGAAATCATTACACTGTGCTGTTAACGATCCTT
3841 GTCTGCTTGCTGTTACCTACTTTTTACAGGCATCATAATAAAAGCTAGACTATTTCTTTGGGGGGAAAGAGACTTATTTA
3921 ATGTAATTTAAAAAACTTTTCCAATAGAAAATGAAATATTATTGAAAATAATATCTATTTTTTAGCTTTCAGCAATTGAT
4001 GGTGCTTTGTTGTGGTGTCTGCTGGAAGTCTACTGCCATTATAGGGAACCTTGCTTGTTAGCTTCTCTAGATCTCTATTC
4081 TAAACAATCTGTTAGTGATGATAAATTCTGTAGGAGGGTCTATTCTGAGCCGTTAACTTCCTGTAAGGGGAAAATGGGTG
4161 GGTTACCAGAAATACCATTGAAGCAGGGTGGGCTGTGGGGTGGAAGGTTGGGGTATTTGTCTTGAGAATTAAAAACTACG
4241 AAACACTTTTGTACACAACTGATTTTTTAAAAAATAAACACATTTTTAAAGATGTTGAATTTTTCCCCCCTTATTGGGAA
4321 TTCTTAAAAATAAATGCATGCATGTTTTCCCCTGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUG-GUA-ACAG-UGUGAGGu 5'
             |:|| ||| |  | |||||:| 
Target 5' tatATACTCATCTAACTACACTTCa 3'
2118 - 2142 135.00 -13.50
2
miRNA  3' guuuguGGU-AACAG---UGUGAGGu 5'
                ||| || |:   ||||||: 
Target 5' cttgtcCCAGTTCTTCAAACACTCTt 3'
739 - 764 132.00 -9.34
3
miRNA  3' guuuguGGUAACA-GUGUGAGGu 5'
                ::||||| ||:|||:| 
Target 5' ggtgttTTATTGTACATACTTCa 3'
1056 - 1078 132.00 -15.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30178178 6 COSMIC
COSN30503272 7 COSMIC
COSN28249992 9 COSMIC
COSN30118434 30 COSMIC
COSN30177613 78 COSMIC
COSN31527726 87 COSMIC
COSN24848075 151 COSMIC
COSN26577281 173 COSMIC
COSN31514133 254 COSMIC
COSN27163586 262 COSMIC
COSN30541237 440 COSMIC
COSN31541728 500 COSMIC
COSN28003147 608 COSMIC
COSN29125450 609 COSMIC
COSN20099969 617 COSMIC
COSN1296897 624 COSMIC
COSN27151466 778 COSMIC
COSN22751611 821 COSMIC
COSN20918420 1249 COSMIC
COSN7490198 1466 COSMIC
COSN20240288 1539 COSMIC
COSN29137403 2412 COSMIC
COSN4835740 2449 COSMIC
COSN28937039 2519 COSMIC
COSN4835741 2579 COSMIC
COSN29023020 2828 COSMIC
COSN20099972 2899 COSMIC
COSN26831731 2998 COSMIC
COSN16909237 3182 COSMIC
COSN27317501 3182 COSMIC
COSN14709596 3676 COSMIC
COSN8349496 3756 COSMIC
COSN23353999 3882 COSMIC
COSN20091031 4139 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs773197431 2 dbSNP
rs1024513772 3 dbSNP
rs778574243 4 dbSNP
rs781278062 5 dbSNP
rs1367990180 9 dbSNP
rs746114221 14 dbSNP
rs770040246 16 dbSNP
rs200943921 18 dbSNP
rs1368883822 19 dbSNP
rs971940759 22 dbSNP
rs780224155 23 dbSNP
rs368526773 25 dbSNP
rs1203247814 30 dbSNP
rs1487320271 34 dbSNP
rs1267640666 35 dbSNP
rs371912997 38 dbSNP
rs1209783753 43 dbSNP
rs1265961491 48 dbSNP
rs1451864847 50 dbSNP
rs773026274 51 dbSNP
rs1213824955 54 dbSNP
rs568751368 60 dbSNP
rs1456907937 82 dbSNP
rs1256785781 86 dbSNP
rs918819048 98 dbSNP
rs1308535676 101 dbSNP
rs768970637 107 dbSNP
rs924835015 111 dbSNP
rs934998519 112 dbSNP
rs1159267080 122 dbSNP
rs1370025718 127 dbSNP
rs760521754 131 dbSNP
rs1410669024 136 dbSNP
rs1457162654 138 dbSNP
rs1319192019 139 dbSNP
rs1398190637 140 dbSNP
rs1416071050 140 dbSNP
rs879192679 140 dbSNP
rs1355000696 145 dbSNP
rs989175849 147 dbSNP
rs914892835 152 dbSNP
rs1333692534 167 dbSNP
rs1044097829 171 dbSNP
rs931790018 173 dbSNP
rs1338936562 181 dbSNP
rs531372270 182 dbSNP
rs1438599888 190 dbSNP
rs1235844423 200 dbSNP
rs1196960478 201 dbSNP
rs1289056870 204 dbSNP
rs1050563983 210 dbSNP
rs1481263499 213 dbSNP
rs1255867587 214 dbSNP
rs551041215 215 dbSNP
rs571031145 216 dbSNP
rs1304525155 227 dbSNP
rs533703935 229 dbSNP
rs1000418599 233 dbSNP
rs553558676 247 dbSNP
rs1374866874 248 dbSNP
rs1328644418 249 dbSNP
rs1475812531 253 dbSNP
rs567505401 262 dbSNP
rs1257720990 267 dbSNP
rs1483427484 271 dbSNP
rs1199675934 272 dbSNP
rs956143640 273 dbSNP
rs998153579 274 dbSNP
rs1464416074 276 dbSNP
rs560803713 279 dbSNP
rs1173969098 282 dbSNP
rs944513257 289 dbSNP
rs1182522796 320 dbSNP
rs953997588 322 dbSNP
rs1378054771 325 dbSNP
rs556460087 326 dbSNP
rs1419127822 328 dbSNP
rs1157531149 329 dbSNP
rs772525549 346 dbSNP
rs1486908834 364 dbSNP
rs1281505237 368 dbSNP
rs1216298360 369 dbSNP
rs909950505 370 dbSNP
rs1288401687 374 dbSNP
rs1379900133 375 dbSNP
rs1311994090 387 dbSNP
rs1466817559 389 dbSNP
rs1394232090 398 dbSNP
rs962813211 401 dbSNP
rs1313292852 404 dbSNP
rs879883887 407 dbSNP
rs994694020 411 dbSNP
rs1453925398 413 dbSNP
rs1367361916 428 dbSNP
rs1162014456 430 dbSNP
rs1476492326 446 dbSNP
rs939516664 448 dbSNP
rs1193459134 450 dbSNP
rs1027647899 469 dbSNP
rs1264207828 474 dbSNP
rs773705706 494 dbSNP
rs183773736 508 dbSNP
rs1263763516 515 dbSNP
rs1308912689 523 dbSNP
rs544642733 525 dbSNP
rs1349908966 527 dbSNP
rs1408102477 543 dbSNP
rs1013012606 546 dbSNP
rs1336886944 557 dbSNP
rs766722696 568 dbSNP
rs1303245654 569 dbSNP
rs1217824753 574 dbSNP
rs1312706711 578 dbSNP
rs1338138592 586 dbSNP
rs201754771 589 dbSNP
rs916846257 589 dbSNP
rs1254010995 591 dbSNP
rs1291313515 601 dbSNP
rs1024773772 602 dbSNP
rs1344103652 606 dbSNP
rs1419260228 607 dbSNP
rs1477080495 607 dbSNP
rs1451280893 608 dbSNP
rs558251995 608 dbSNP
rs1012247564 609 dbSNP
rs1337299277 609 dbSNP
rs3839130 609 dbSNP
rs1205388524 610 dbSNP
rs904268028 611 dbSNP
rs1250655689 612 dbSNP
rs370221019 613 dbSNP
rs578153864 614 dbSNP
rs1491107078 616 dbSNP
rs368041259 617 dbSNP
rs374446588 617 dbSNP
rs1491066115 618 dbSNP
rs202148499 618 dbSNP
rs891591539 618 dbSNP
rs1491215417 619 dbSNP
rs1434250678 621 dbSNP
rs1445355736 623 dbSNP
rs1161167861 624 dbSNP
rs1355620057 626 dbSNP
rs1393628885 628 dbSNP
rs1064268 630 dbSNP
rs1432054932 632 dbSNP
rs1169411178 634 dbSNP
rs1370199673 636 dbSNP
rs1427827499 638 dbSNP
rs1031830968 639 dbSNP
rs187932422 646 dbSNP
rs1196203442 650 dbSNP
rs1344030190 655 dbSNP
rs957633279 658 dbSNP
rs1277819943 664 dbSNP
rs1295359619 664 dbSNP
rs1236060986 668 dbSNP
rs140325930 670 dbSNP
rs1386120891 676 dbSNP
rs914945353 678 dbSNP
rs1367042576 679 dbSNP
rs1006880586 681 dbSNP
rs1016979234 703 dbSNP
rs1400495085 704 dbSNP
rs1228889987 705 dbSNP
rs963113377 719 dbSNP
rs1273387432 722 dbSNP
rs1379869724 724 dbSNP
rs529532479 725 dbSNP
rs918676232 736 dbSNP
rs985915169 736 dbSNP
rs776737340 749 dbSNP
rs1441716364 752 dbSNP
rs1255143163 759 dbSNP
rs960878169 760 dbSNP
rs1348179198 761 dbSNP
rs944458711 765 dbSNP
rs192977330 769 dbSNP
rs1352205593 770 dbSNP
rs1280699555 775 dbSNP
rs1447957658 775 dbSNP
rs764854546 777 dbSNP
rs948335453 782 dbSNP
rs1315216399 788 dbSNP
rs879689625 802 dbSNP
rs1360180231 805 dbSNP
rs1157195336 810 dbSNP
rs542937036 816 dbSNP
rs1402583109 817 dbSNP
rs546473202 823 dbSNP
rs1162671787 826 dbSNP
rs894480951 829 dbSNP
rs935668704 831 dbSNP
rs1255257235 835 dbSNP
rs531179770 838 dbSNP
rs1390020093 858 dbSNP
rs550978007 859 dbSNP
rs765367602 868 dbSNP
rs1262106622 869 dbSNP
rs1167231102 872 dbSNP
rs1448310442 882 dbSNP
rs1284348711 899 dbSNP
rs570967934 900 dbSNP
rs1013311935 911 dbSNP
rs1052843991 912 dbSNP
rs891557275 913 dbSNP
rs1234363473 916 dbSNP
rs1340289038 931 dbSNP
rs1287426089 933 dbSNP
rs933821093 937 dbSNP
rs1345971159 940 dbSNP
rs527387229 942 dbSNP
rs1024409164 951 dbSNP
rs1459919767 957 dbSNP
rs1050943286 967 dbSNP
rs74984195 969 dbSNP
rs77569533 971 dbSNP
rs889697586 976 dbSNP
rs1006849526 977 dbSNP
rs1422668568 978 dbSNP
rs547134916 979 dbSNP
rs907309882 983 dbSNP
rs115213470 991 dbSNP
rs1242319399 997 dbSNP
rs1031884898 1001 dbSNP
rs994589982 1009 dbSNP
rs533908997 1014 dbSNP
rs1296588995 1019 dbSNP
rs961098662 1022 dbSNP
rs1317775490 1027 dbSNP
rs1293918788 1033 dbSNP
rs185074607 1035 dbSNP
rs879934612 1036 dbSNP
rs1274453680 1038 dbSNP
rs1438884492 1040 dbSNP
rs1389575597 1043 dbSNP
rs1313031290 1049 dbSNP
rs1320543957 1053 dbSNP
rs1011838103 1057 dbSNP
rs1023794665 1058 dbSNP
rs1353811987 1072 dbSNP
rs1028555214 1086 dbSNP
rs549782889 1087 dbSNP
rs1419875965 1090 dbSNP
rs1228739179 1106 dbSNP
rs1192609066 1115 dbSNP
rs1271748365 1116 dbSNP
rs1452126813 1128 dbSNP
rs1466635729 1132 dbSNP
rs953086348 1142 dbSNP
rs569952764 1143 dbSNP
rs979616764 1145 dbSNP
rs757835609 1164 dbSNP
rs925537793 1166 dbSNP
rs1250101495 1169 dbSNP
rs1485119565 1174 dbSNP
rs1183773549 1180 dbSNP
rs911541876 1181 dbSNP
rs1278256932 1186 dbSNP
rs1232383181 1209 dbSNP
rs1038561073 1249 dbSNP
rs1304291111 1254 dbSNP
rs1446062615 1259 dbSNP
rs538205489 1262 dbSNP
rs1423260289 1268 dbSNP
rs1162883683 1275 dbSNP
rs1414366271 1282 dbSNP
rs1296384118 1292 dbSNP
rs1457690409 1297 dbSNP
rs1354913886 1299 dbSNP
rs1172709695 1304 dbSNP
rs1432513233 1305 dbSNP
rs565224098 1306 dbSNP
rs60727913 1308 dbSNP
rs578106452 1314 dbSNP
rs1449982847 1315 dbSNP
rs1303008201 1331 dbSNP
rs919096866 1341 dbSNP
rs1050912925 1343 dbSNP
rs930441717 1345 dbSNP
rs1378002477 1354 dbSNP
rs534279581 1356 dbSNP
rs1226328740 1359 dbSNP
rs1048987155 1361 dbSNP
rs1237265619 1393 dbSNP
rs1209123248 1395 dbSNP
rs915787506 1397 dbSNP
rs866188997 1398 dbSNP
rs532405686 1404 dbSNP
rs1229515498 1406 dbSNP
rs1239603631 1411 dbSNP
rs1315191306 1412 dbSNP
rs1309167240 1413 dbSNP
rs1393077019 1417 dbSNP
rs190114896 1418 dbSNP
rs1312076370 1423 dbSNP
rs1412679499 1428 dbSNP
rs1376940461 1431 dbSNP
rs1313105369 1436 dbSNP
rs1445587436 1441 dbSNP
rs1452499621 1441 dbSNP
rs866633891 1443 dbSNP
rs1361573876 1445 dbSNP
rs181633173 1455 dbSNP
rs1046171099 1457 dbSNP
rs751465781 1458 dbSNP
rs907198861 1459 dbSNP
rs896563953 1463 dbSNP
rs145375096 1464 dbSNP
rs1258558378 1466 dbSNP
rs1486857240 1466 dbSNP
rs1204792243 1467 dbSNP
rs1023679998 1473 dbSNP
rs1472978200 1474 dbSNP
rs969495691 1475 dbSNP
rs543227814 1481 dbSNP
rs979587272 1489 dbSNP
rs1317499101 1493 dbSNP
rs1292567313 1494 dbSNP
rs1053160077 1498 dbSNP
rs1357116436 1499 dbSNP
rs1032575655 1500 dbSNP
rs1381307239 1507 dbSNP
rs1405720317 1511 dbSNP
rs1290135731 1520 dbSNP
rs1415896827 1521 dbSNP
rs1176522798 1531 dbSNP
rs893325779 1533 dbSNP
rs563005818 1535 dbSNP
rs73145259 1544 dbSNP
rs1028477620 1545 dbSNP
rs1309512705 1548 dbSNP
rs1192877492 1552 dbSNP
rs137928176 1564 dbSNP
rs1008475666 1568 dbSNP
rs1468085531 1572 dbSNP
rs955027566 1577 dbSNP
rs758706892 1578 dbSNP
rs1211753069 1579 dbSNP
rs1336767785 1580 dbSNP
rs1019057659 1582 dbSNP
rs1279422423 1587 dbSNP
rs1284599224 1595 dbSNP
rs1226357308 1600 dbSNP
rs1324372498 1603 dbSNP
rs1297234451 1605 dbSNP
rs965647187 1609 dbSNP
rs142395700 1610 dbSNP
rs1369630912 1622 dbSNP
rs918985308 1630 dbSNP
rs910986328 1633 dbSNP
rs184742325 1636 dbSNP
rs1312026912 1638 dbSNP
rs1460761702 1648 dbSNP
rs984620392 1671 dbSNP
rs919841095 1677 dbSNP
rs1453943819 1682 dbSNP
rs929917239 1695 dbSNP
rs547159621 1696 dbSNP
rs1469784060 1703 dbSNP
rs896441286 1707 dbSNP
rs548731098 1711 dbSNP
rs1337195867 1727 dbSNP
rs1252794273 1730 dbSNP
rs374814749 1743 dbSNP
rs1369736082 1753 dbSNP
rs1300654071 1765 dbSNP
rs757651589 1767 dbSNP
rs1442442030 1775 dbSNP
rs905307813 1784 dbSNP
rs1328769707 1785 dbSNP
rs1478962598 1788 dbSNP
rs1000973795 1789 dbSNP
rs1191751669 1790 dbSNP
rs529819982 1792 dbSNP
rs928635703 1799 dbSNP
rs1032955212 1800 dbSNP
rs112988404 1808 dbSNP
rs1454738886 1830 dbSNP
rs1053205741 1853 dbSNP
rs1181020434 1858 dbSNP
rs1010193748 1875 dbSNP
rs1252445974 1894 dbSNP
rs1205547367 1896 dbSNP
rs781488035 1899 dbSNP
rs145939184 1902 dbSNP
rs1370797405 1904 dbSNP
rs1011648640 1907 dbSNP
rs1278381496 1911 dbSNP
rs1050385888 1919 dbSNP
rs986484664 1930 dbSNP
rs1414528634 1944 dbSNP
rs1314998313 1950 dbSNP
rs889950246 1950 dbSNP
rs1439192837 1955 dbSNP
rs1276000567 1965 dbSNP
rs368157424 1970 dbSNP
rs973925859 1977 dbSNP
rs1365443210 1985 dbSNP
rs1182689451 2005 dbSNP
rs1276955927 2006 dbSNP
rs1008902107 2020 dbSNP
rs1019823018 2022 dbSNP
rs569807224 2030 dbSNP
rs1212599133 2043 dbSNP
rs901537522 2044 dbSNP
rs1442567130 2046 dbSNP
rs1204784849 2047 dbSNP
rs1221522464 2051 dbSNP
rs993096736 2052 dbSNP
rs533692045 2053 dbSNP
rs917847547 2055 dbSNP
rs1295431635 2058 dbSNP
rs538933263 2059 dbSNP
rs1222161185 2060 dbSNP
rs1246072370 2084 dbSNP
rs1452273110 2085 dbSNP
rs1190273916 2086 dbSNP
rs1390835529 2102 dbSNP
rs949368261 2107 dbSNP
rs1448487629 2108 dbSNP
rs1474808224 2121 dbSNP
rs1415395296 2134 dbSNP
rs1189748610 2137 dbSNP
rs1472933242 2139 dbSNP
rs1241131122 2140 dbSNP
rs779275748 2143 dbSNP
rs984554803 2160 dbSNP
rs1269382964 2161 dbSNP
rs372359500 2175 dbSNP
rs1333282672 2181 dbSNP
rs571653678 2184 dbSNP
rs534213800 2185 dbSNP
rs189648908 2190 dbSNP
rs180847218 2200 dbSNP
rs928507275 2209 dbSNP
rs746400091 2212 dbSNP
rs934550354 2214 dbSNP
rs988834481 2220 dbSNP
rs772173903 2222 dbSNP
rs914573861 2223 dbSNP
rs1325231274 2226 dbSNP
rs1394402671 2243 dbSNP
rs947484650 2248 dbSNP
rs1392136102 2250 dbSNP
rs1166712214 2253 dbSNP
rs372943361 2253 dbSNP
rs1405706822 2258 dbSNP
rs1439424833 2262 dbSNP
rs1300257860 2263 dbSNP
rs1030976176 2266 dbSNP
rs1366442019 2267 dbSNP
rs1226932561 2269 dbSNP
rs1268672630 2270 dbSNP
rs1358495150 2272 dbSNP
rs1192410320 2286 dbSNP
rs1467564296 2288 dbSNP
rs1255410454 2292 dbSNP
rs1222860812 2293 dbSNP
rs1307274526 2296 dbSNP
rs1271254478 2304 dbSNP
rs1049798544 2307 dbSNP
rs1228973594 2315 dbSNP
rs889953593 2316 dbSNP
rs1216557325 2324 dbSNP
rs1272395926 2325 dbSNP
rs778187323 2328 dbSNP
rs1302791868 2333 dbSNP
rs1438771671 2339 dbSNP
rs1368747407 2340 dbSNP
rs1041707960 2346 dbSNP
rs1248384996 2365 dbSNP
rs1464304550 2366 dbSNP
rs1190524219 2368 dbSNP
rs1369853444 2370 dbSNP
rs1472803366 2371 dbSNP
rs1162125057 2373 dbSNP
rs1167973973 2378 dbSNP
rs1431277862 2380 dbSNP
rs747587198 2391 dbSNP
rs994363186 2399 dbSNP
rs1452028924 2402 dbSNP
rs1270175005 2406 dbSNP
rs1323190756 2408 dbSNP
rs1182058321 2411 dbSNP
rs1192304265 2420 dbSNP
rs1480555888 2426 dbSNP
rs574095040 2432 dbSNP
rs1025976368 2446 dbSNP
rs771296463 2453 dbSNP
rs887436111 2472 dbSNP
rs1026744800 2475 dbSNP
rs33972462 2476 dbSNP
rs760277836 2476 dbSNP
rs951262225 2476 dbSNP
rs1006392159 2486 dbSNP
rs148181347 2497 dbSNP
rs949336036 2497 dbSNP
rs1296289780 2505 dbSNP
rs970308003 2506 dbSNP
rs558846704 2509 dbSNP
rs980734155 2509 dbSNP
rs1332832132 2510 dbSNP
rs1378868584 2531 dbSNP
rs1176110931 2546 dbSNP
rs981325583 2547 dbSNP
rs759830490 2548 dbSNP
rs955979527 2561 dbSNP
rs1461721153 2566 dbSNP
rs1349612800 2570 dbSNP
rs1184832550 2575 dbSNP
rs756510889 2576 dbSNP
rs1257150452 2578 dbSNP
rs1203168422 2589 dbSNP
rs1258088490 2592 dbSNP
rs1256696023 2596 dbSNP
rs1054250396 2600 dbSNP
rs1215131291 2609 dbSNP
rs571127457 2631 dbSNP
rs1424917348 2639 dbSNP
rs1304779811 2640 dbSNP
rs1230066824 2649 dbSNP
rs1007853821 2662 dbSNP
rs539437315 2662 dbSNP
rs746735371 2662 dbSNP
rs758398425 2662 dbSNP
rs1302968705 2671 dbSNP
rs1452389330 2673 dbSNP
rs1344013084 2675 dbSNP
rs1161981529 2679 dbSNP
rs914582067 2682 dbSNP
rs1417595268 2687 dbSNP
rs1186206177 2688 dbSNP
rs1425831740 2693 dbSNP
rs868566841 2697 dbSNP
rs947368496 2701 dbSNP
rs1186072155 2703 dbSNP
rs985965001 2709 dbSNP
rs911282424 2725 dbSNP
rs1484927176 2739 dbSNP
rs944108800 2750 dbSNP
rs1210523560 2753 dbSNP
rs186222079 2756 dbSNP
rs899467207 2757 dbSNP
rs576274712 2759 dbSNP
rs1231199164 2769 dbSNP
rs1341934114 2772 dbSNP
rs1312976806 2773 dbSNP
rs1041242173 2776 dbSNP
rs995197751 2778 dbSNP
rs1254740323 2788 dbSNP
rs1027128344 2793 dbSNP
rs1458256225 2798 dbSNP
rs376685483 2800 dbSNP
rs1163277682 2804 dbSNP
rs565270077 2810 dbSNP
rs191097862 2811 dbSNP
rs983012651 2815 dbSNP
rs930262062 2817 dbSNP
rs1250016917 2831 dbSNP
rs1189247684 2840 dbSNP
rs1453408083 2841 dbSNP
rs1465330666 2841 dbSNP
rs1157183857 2852 dbSNP
rs556149368 2865 dbSNP
rs1265747497 2871 dbSNP
rs1048593934 2875 dbSNP
rs1226244002 2880 dbSNP
rs980621505 2882 dbSNP
rs112317825 2889 dbSNP
rs34111123 2889 dbSNP
rs397993049 2889 dbSNP
rs771217078 2889 dbSNP
rs1324457397 2899 dbSNP
rs1396804028 2900 dbSNP
rs1391912440 2907 dbSNP
rs1312540513 2908 dbSNP
rs887447573 2916 dbSNP
rs778551574 2928 dbSNP
rs1392236551 2939 dbSNP
rs1169347050 2945 dbSNP
rs936644625 2947 dbSNP
rs1394462305 2950 dbSNP
rs989518783 2963 dbSNP
rs541039853 2974 dbSNP
rs913962599 2975 dbSNP
rs560783998 2979 dbSNP
rs1051932016 2983 dbSNP
rs1335095177 2992 dbSNP
rs762499750 2994 dbSNP
rs181181576 2998 dbSNP
rs763629075 2999 dbSNP
rs1345506344 3012 dbSNP
rs1003032168 3017 dbSNP
rs58339883 3023 dbSNP
rs1277779927 3024 dbSNP
rs141581839 3026 dbSNP
rs1048092222 3029 dbSNP
rs761624717 3033 dbSNP
rs886853905 3035 dbSNP
rs1249281808 3039 dbSNP
rs1352187811 3046 dbSNP
rs1308845316 3052 dbSNP
rs1418988256 3072 dbSNP
rs1373711843 3073 dbSNP
rs563465043 3074 dbSNP
rs1174348899 3087 dbSNP
rs1478979681 3094 dbSNP
rs532383295 3100 dbSNP
rs1021525969 3105 dbSNP
rs1471480383 3106 dbSNP
rs1024688032 3108 dbSNP
rs1205436176 3111 dbSNP
rs1485119202 3135 dbSNP
rs970506340 3136 dbSNP
rs969134929 3140 dbSNP
rs777533132 3160 dbSNP
rs1373874881 3161 dbSNP
rs186399744 3162 dbSNP
rs373086900 3165 dbSNP
rs1414427259 3168 dbSNP
rs989880975 3171 dbSNP
rs1336298296 3178 dbSNP
rs1395925510 3180 dbSNP
rs913943634 3181 dbSNP
rs554695744 3182 dbSNP
rs1365308882 3184 dbSNP
rs1303365489 3194 dbSNP
rs546053834 3198 dbSNP
rs1413948710 3200 dbSNP
rs1331425975 3202 dbSNP
rs1182575710 3218 dbSNP
rs976797882 3219 dbSNP
rs1474706113 3225 dbSNP
rs918764030 3226 dbSNP
rs1233314907 3228 dbSNP
rs987522192 3229 dbSNP
rs566002407 3234 dbSNP
rs911995337 3239 dbSNP
rs1300720025 3244 dbSNP
rs1269186041 3250 dbSNP
rs1233031105 3251 dbSNP
rs527651646 3272 dbSNP
rs1343848335 3274 dbSNP
rs1377295625 3274 dbSNP
rs1205497357 3282 dbSNP
rs750245971 3288 dbSNP
rs910164077 3291 dbSNP
rs1479394605 3293 dbSNP
rs1039244156 3295 dbSNP
rs920835372 3300 dbSNP
rs948285117 3301 dbSNP
rs1270121790 3312 dbSNP
rs1454934613 3325 dbSNP
rs1044107178 3330 dbSNP
rs1164646906 3336 dbSNP
rs1393722318 3337 dbSNP
rs1472882727 3346 dbSNP
rs1241046268 3349 dbSNP
rs1186065529 3354 dbSNP
rs1451533692 3355 dbSNP
rs1466675793 3367 dbSNP
rs1249155187 3372 dbSNP
rs1213531472 3374 dbSNP
rs755965429 3387 dbSNP
rs150895830 3391 dbSNP
rs1353973948 3397 dbSNP
rs372245324 3399 dbSNP
rs886741769 3403 dbSNP
rs1204470435 3404 dbSNP
rs1003847068 3413 dbSNP
rs190335842 3414 dbSNP
rs1295562062 3415 dbSNP
rs1437331974 3432 dbSNP
rs1367356385 3435 dbSNP
rs1002632006 3438 dbSNP
rs1321130665 3443 dbSNP
rs1435596996 3459 dbSNP
rs1056861049 3465 dbSNP
rs1325233942 3486 dbSNP
rs1405616026 3489 dbSNP
rs1389143657 3490 dbSNP
rs1391366231 3492 dbSNP
rs1166217050 3503 dbSNP
rs1440161271 3506 dbSNP
rs891651178 3514 dbSNP
rs1010043454 3515 dbSNP
rs1021457084 3522 dbSNP
rs1367153148 3527 dbSNP
rs968689556 3533 dbSNP
rs1248845651 3535 dbSNP
rs906313953 3535 dbSNP
rs752940706 3541 dbSNP
rs139371148 3544 dbSNP
rs770868025 3550 dbSNP
rs145532652 3558 dbSNP
rs976807886 3560 dbSNP
rs918648071 3561 dbSNP
rs951563760 3562 dbSNP
rs1302673028 3564 dbSNP
rs984276786 3570 dbSNP
rs182893605 3581 dbSNP
rs1365343632 3595 dbSNP
rs1469296430 3597 dbSNP
rs1436891890 3598 dbSNP
rs1010784584 3602 dbSNP
rs1021299906 3609 dbSNP
rs1431183488 3612 dbSNP
rs1370671467 3620 dbSNP
rs777934251 3622 dbSNP
rs1174688877 3632 dbSNP
rs1431998525 3638 dbSNP
rs1427833168 3645 dbSNP
rs1192208695 3649 dbSNP
rs1472463362 3657 dbSNP
rs1207560235 3661 dbSNP
rs538872693 3666 dbSNP
rs1251490482 3675 dbSNP
rs305112 3676 dbSNP
rs572418601 3678 dbSNP
rs1208081345 3680 dbSNP
rs987489792 3683 dbSNP
rs926978609 3684 dbSNP
rs1349665941 3685 dbSNP
rs938302133 3688 dbSNP
rs1419094059 3692 dbSNP
rs147282439 3694 dbSNP
rs554550235 3697 dbSNP
rs964820561 3698 dbSNP
rs945761565 3711 dbSNP
rs1361472909 3737 dbSNP
rs771476490 3744 dbSNP
rs187747066 3752 dbSNP
rs1410251196 3757 dbSNP
rs930812217 3759 dbSNP
rs1473068023 3760 dbSNP
rs1162750179 3761 dbSNP
rs1390515016 3766 dbSNP
rs1484269162 3767 dbSNP
rs1256602246 3768 dbSNP
rs1210766763 3778 dbSNP
rs1328329974 3794 dbSNP
rs1266068879 3795 dbSNP
rs1229969929 3799 dbSNP
rs368994980 3804 dbSNP
rs1435572524 3807 dbSNP
rs1287865556 3808 dbSNP
rs1393877641 3809 dbSNP
rs1047947882 3822 dbSNP
rs1359433034 3822 dbSNP
rs1435037314 3834 dbSNP
rs9998860 3834 dbSNP
rs1006816216 3835 dbSNP
rs1368172183 3839 dbSNP
rs1162963599 3840 dbSNP
rs1046076358 3851 dbSNP
rs906285771 3853 dbSNP
rs1187980744 3858 dbSNP
rs746290242 3860 dbSNP
rs770122481 3869 dbSNP
rs1246112580 3874 dbSNP
rs1210424174 3877 dbSNP
rs1486081911 3879 dbSNP
rs1055286090 3893 dbSNP
rs563401101 3893 dbSNP
rs1323093274 3912 dbSNP
rs200653511 3914 dbSNP
rs201215786 3915 dbSNP
rs1226984473 3926 dbSNP
rs901193098 3931 dbSNP
rs1331605539 3940 dbSNP
rs1011172221 3957 dbSNP
rs1292100349 3963 dbSNP
rs1216968315 3970 dbSNP
rs998114141 3971 dbSNP
rs1241962846 3972 dbSNP
rs1447715706 3973 dbSNP
rs1392036542 3974 dbSNP
rs1190434780 3976 dbSNP
rs1447466228 3976 dbSNP
rs1266440178 3978 dbSNP
rs1207824348 3989 dbSNP
rs1489282927 3991 dbSNP
rs1485006044 3998 dbSNP
rs1025580594 4000 dbSNP
rs532319433 4007 dbSNP
rs1339468182 4012 dbSNP
rs902456804 4013 dbSNP
rs1228833436 4019 dbSNP
rs1331009176 4023 dbSNP
rs773247230 4024 dbSNP
rs1299692692 4033 dbSNP
rs1388882930 4035 dbSNP
rs1391796476 4043 dbSNP
rs1307669254 4044 dbSNP
rs1427987249 4045 dbSNP
rs546036312 4050 dbSNP
rs1169251953 4057 dbSNP
rs1474938456 4063 dbSNP
rs1196566515 4074 dbSNP
rs559646241 4076 dbSNP
rs1269265021 4078 dbSNP
rs1181015395 4086 dbSNP
rs1481845957 4087 dbSNP
rs1276216532 4111 dbSNP
rs1195838328 4115 dbSNP
rs1345006564 4118 dbSNP
rs1254752692 4121 dbSNP
rs1018993973 4124 dbSNP
rs528390126 4126 dbSNP
rs964708337 4133 dbSNP
rs11938873 4134 dbSNP
rs1414108963 4136 dbSNP
rs1346542304 4138 dbSNP
rs769608282 4142 dbSNP
rs775690961 4143 dbSNP
rs1017109629 4144 dbSNP
rs762911448 4144 dbSNP
rs1401006051 4154 dbSNP
rs35002634 4164 dbSNP
rs762697625 4177 dbSNP
rs764120858 4179 dbSNP
rs1308760632 4189 dbSNP
rs1413977028 4198 dbSNP
rs773924148 4207 dbSNP
rs981063282 4208 dbSNP
rs1170759223 4211 dbSNP
rs1395273355 4213 dbSNP
rs1313146464 4223 dbSNP
rs928175413 4240 dbSNP
rs1354219199 4241 dbSNP
rs1412401734 4245 dbSNP
rs1291908016 4250 dbSNP
rs1181127847 4255 dbSNP
rs1429776132 4255 dbSNP
rs1471428825 4260 dbSNP
rs532467436 4261 dbSNP
rs1253517082 4263 dbSNP
rs1352866902 4263 dbSNP
rs952223186 4267 dbSNP
rs1224879371 4269 dbSNP
rs939568767 4269 dbSNP
rs548232601 4270 dbSNP
rs1267952992 4283 dbSNP
rs912901897 4288 dbSNP
rs751802991 4293 dbSNP
rs1226912408 4298 dbSNP
rs1280348112 4300 dbSNP
rs1331583247 4300 dbSNP
rs945815361 4305 dbSNP
rs1338782303 4309 dbSNP
rs1043168031 4310 dbSNP
rs544481260 4316 dbSNP
rs865888475 4318 dbSNP
rs1315546144 4333 dbSNP
rs1212454761 4338 dbSNP
rs567640698 4344 dbSNP
rs942505039 4353 dbSNP
rs1039638412 4355 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Yang F; Zhang L; Wang F; Wang Y; Huo XS; et al.
- Neoplasia (New York, N.Y.), 2011
The loss of microRNA-122 (miR-122) expression correlates to many characteristic properties of hepatocellular carcinoma (HCC) cells, including clonogenic survival, anchorage-independent growth, migration, invasion, epithelial-mesenchymal transition, and tumorigenesis. However, all of these findings do not sufficiently explain the oncogenic potential of miR-122. In the current study, we used two-dimensional differential in-gel electrophoresis to measure changes in the expression of thousands of proteins in response to the inhibition of miR-122 in human hepatoma cells. Several proteins that were upregulated on miR-122 inhibition were involved in the unfolded protein response (UPR) pathway. The overexpression of miR-122 resulted in the repression of UPR pathway activation. Therefore, miR-122 may act as an inhibitor of the chaperone gene expression and negatively regulate the UPR pathway in HCC. We further showed that the miR-122 inhibitor enhanced the stability of the 26S proteasome non-ATPase regulatory subunit 10 (PSMD10) through the up-regulation of its target gene cyclin-dependent kinase 4 (CDK4). This process may activate the UPR pathway to prevent chemotherapy-mediated tumor cell apoptosis. The current study suggests that miR-122 negatively regulates the UPR through the CDK4-PSMD10 pathway. The down-regulation of miR-122 activated the CDK4-PSMD10-UPR pathway to decrease tumor cell anticancer drug-mediated apoptosis. We identified a new HCC therapeutic target and proclaimed the potential risk of the therapeutic use of miR-122 silencing.
LinkOut: [PMID: 21750653]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*