miRTarBase - #MIRT023294 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLC11A2   
Synonyms AHMIO1, DCT1, DMT1, NRAMP2
Description solute carrier family 11 member 2
Transcript NM_000617   
Other Transcripts NM_001174125 , NM_001174126 , NM_001174127 , NM_001174128 , NM_001174129 , NM_001174130   
Expression
Putative miRNA Targets on SLC11A2
3'UTR of SLC11A2
(miRNA target sites are highlighted)
>SLC11A2|NM_000617|3'UTR
   1 CACTGGATTAGTCTGTCTTCTGCAGGTAGCCATCAGAGCCAGTGTGTTTCTATGGTTTACTGTGTGAACATAGCCAAAAG
  81 TATGTGCCGTTGCACAGACTGTGTTTATGACTCAACCGTTGGTTGGAAAAGACTTTGTTTCATGTGTATTTGAAAGATGG
 161 AATTATTTTTTCCTTCCTGACCTAACCTTAGAACTGGATTAGGGTGGGATCTTTGAAAAGCTGACATTTGCTGCTATCAT
 241 TCCAACACTAAATTCTTAAGTAGTTGCCCAAGGGCCAGCTCAGTTTATCCTTCGGAGAGACAAGGATATGCATGATTCTT
 321 AACCAGGCTATATGTTAAAAAAAAATTGGAAAATGCAATACATTTTTTATTATACAAACTACAGAATGAGTATGCAAGTT
 401 TTATTTATCAAAATGTAATGGATTTTTAAAGGCTGAGAAATTTTCCTTATACCTACCTTTTCAGTTATTTTAATTATACC
 481 AAATTATCAACTAGAATAGCTTCATCCATATGAAATATAAAATGAAGAGACACCTAGCTCTATCAGGCTTAGGATTCTTT
 561 GAACTTATTTCCACTTTAATTTCTCAGTGGAAGTTAAGAGGGGTGAGAAAACAAAGAAGGGGAAAAACTGACAACTAACA
 641 AAACCAGCACCACATCGCTAGGTGGTGCTTACTAATTACCTTCTCAGGATTTTCCTCAGATTGAAAAGCTTATGAGGATT
 721 TCTTGGGAGTCTTAATAACCTGCCTGTTAGTACAGAGCTTTCCTGATGATATTTACTCTTGAGCACATGTGGTTGTAAAA
 801 CCTTAACTTTCTTTCTCCAGGAGGGTGGTGATAGAAACAGATGGTAGTATTTATGAACTGATGTTCTCGTGAAATGTTGA
 881 GGGTGGGGAGAAAAGACTTTAAGGGAGGAGAGCCATCTATTTTGTTCCTAAAGCCACCTCTCAGCAGAATCGTCATGTTT
 961 TTCTGATGCACCGCTCTGCTTCATGCCCAAGATGACTTGCGAGGCAATCTCAGGAGCTGTGGACTTAACCGTTGCAAAGC
1041 ACACTGTCTTTCTCAGCGTTCTCTGCAAGTCAGTAGGTGTTAGTATGGTTGCAAAGTTCACTGTCTCAGCAAAGTTGAAC
1121 TGGGCTACCTCTCTACAGCTGTTTCCTCAGAGGGAAAAATCTTGAGACCAGATGGTGGAGCTCTGGAGTCAGAGGAAATG
1201 GGTGTCTTCAGCACAAAGCTGCTGCTTTTACTTCAGCCACTTCTGACATTTTTACATACCGAGCCTGAGATTGTGTGATT
1281 ATCTCAAATCAAATCACTTTGATGGAGATAAATAATCAAAACTGTTTTATAGTCATTGATTTGGTGAGAACAGTAATGGA
1361 AAATGGTGTTGAAGGACTTCTCATTTTTGGAGCTTTCCTTCCAGAGTCCTGGCTGATTGGTGTTCGCTGTTCATCTGAGC
1441 CCCCAAAAGCATTATTACTGATACTTGCACACAGTCAAAAGCGCAGACTGGATGGATGGTCTTTTATAAGGCATTTAAGG
1521 GTACACTACTGTGTTTCACTGACCATACATTTTTCTTAGCCCCTCAAGTAATATAGCACAGAGTTATGAATGACAATTCC
1601 CCTAACCATTCCTCTTCATATCTGCCTCTTCCCCTTACCATCGTAATTCTCCAAACTGGTCATAAAGGCACTCTGTGAAG
1681 ATATTGGGGACTGACATCTTAAGCTCTCACCTGGCTGCAGTAGGAAAGGCCAAACTGACGACAAAAAAAAAATTCTTTAT
1761 AAAGATGATATGGTAACATGTATCTTTGCCCTGGGTCTGGGTGGGTCCAGTCAGTCTCAGATTTACAAGCATTTAGGAGC
1841 CTAGGTAAAAGCTGCTAGTATTCTTTTAAAAGTTATATTTATGACTTGCAATGATAGAAAACTCCTTCCAATTAAATGGC
1921 ATTTTATAATATTATGTGTGTACTTCACAGTGTTAAAAATACCCTCATACGTTATTGCATTTGATCTTCACAGAAAGTGC
2001 ATTTTAACCAGTACTCTGGGTGCAATAAATAATATGTAGAAATTTAAGTCCTCCAATTCCAGCATATCCAGTGAGTTTTG
2081 ACAGTGTGTTTATGTGGAATGTTTAAGGATATACAATTGTACTTTATATAAATTGGTTCTTGTTCTTCTTAAATGTGACA
2161 TGAAATAATTGTGCTGCTACATTATACTGGAAATTAACAGGGGAAAAGGGAAGAGCTCTTGGCTCCCTTGAGGTTCTGCT
2241 AGTGGTGTTAGGAGTGGTTACAACTGAGCTTTTAGTAACCATTTAACCGTATGTAAACTTGGTTTCTAATTAAAAAAAAA
2321 TTTCTTTTTCCAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              :||||| || |: |||| 
Target 5' ccctTACCATCGTAATTCTCCa 3'
1632 - 1653 122.00 -14.70
2
miRNA  3' guuugUGGUAAC----AGUGUGAggu 5'
               |||:|||     ||||||   
Target 5' acttaACCGTTGCAAAGCACACTgtc 3'
1023 - 1048 119.00 -16.10
3
miRNA  3' guUUGUGGUA-ACAGUGUGAGGu 5'
            ||:|::|| ||| ::|||:| 
Target 5' atAATATTATGTGT-GTACTTCa 3'
1926 - 1947 119.00 -12.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
309303 11 ClinVar
309302 32 ClinVar
309301 153 ClinVar
883596 295 ClinVar
309300 358 ClinVar
309299 390 ClinVar
309298 415 ClinVar
309297 420 ClinVar
309296 546 ClinVar
882810 716 ClinVar
882809 789 ClinVar
309295 872 ClinVar
309294 970 ClinVar
309293 985 ClinVar
309292 986 ClinVar
309291 1007 ClinVar
309290 1031 ClinVar
881184 1057 ClinVar
881183 1058 ClinVar
309289 1215 ClinVar
309288 1261 ClinVar
309287 1273 ClinVar
881182 1360 ClinVar
881181 1367 ClinVar
881180 1444 ClinVar
309286 1467 ClinVar
309285 1486 ClinVar
309284 1559 ClinVar
309283 1599 ClinVar
882760 1615 ClinVar
882759 1739 ClinVar
309282 1753 ClinVar
882758 1795 ClinVar
309281 1876 ClinVar
309280 1902 ClinVar
309279 1949 ClinVar
309278 2085 ClinVar
309277 2289 ClinVar
309276 2321 ClinVar
881136 2332 ClinVar
COSN24705496 1 COSMIC
COSN30510633 5 COSMIC
COSN30517506 20 COSMIC
COSN30489650 88 COSMIC
COSN5945790 89 COSMIC
COSN24014951 289 COSMIC
COSN1575836 460 COSMIC
COSN28547775 544 COSMIC
COSN17181744 709 COSMIC
COSN30423131 731 COSMIC
COSN20986313 817 COSMIC
COSN29277676 1030 COSMIC
COSN22278474 1209 COSMIC
COSN7373315 1285 COSMIC
COSN29540211 1742 COSMIC
COSN20109575 1743 COSMIC
COSN15107875 2289 COSMIC
COSN5945789 2302 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs779127497 1 dbSNP
rs755553232 3 dbSNP
rs1370565577 4 dbSNP
rs954282535 5 dbSNP
rs749794949 7 dbSNP
rs903163485 10 dbSNP
rs201382454 11 dbSNP
rs1432365644 13 dbSNP
rs1365212060 21 dbSNP
rs1321831576 22 dbSNP
rs756262905 23 dbSNP
rs1452323992 25 dbSNP
rs750524130 26 dbSNP
rs886049565 32 dbSNP
rs979394886 34 dbSNP
rs767908116 38 dbSNP
rs1419154796 39 dbSNP
rs1361593841 41 dbSNP
rs545806943 52 dbSNP
rs1419140880 66 dbSNP
rs763634560 69 dbSNP
rs1266669681 79 dbSNP
rs1476441670 80 dbSNP
rs1394457676 81 dbSNP
rs781190264 88 dbSNP
rs1182949352 89 dbSNP
rs764971858 95 dbSNP
rs1244870071 97 dbSNP
rs1210627357 103 dbSNP
rs1306704059 105 dbSNP
rs371736382 115 dbSNP
rs776447248 117 dbSNP
rs766238984 118 dbSNP
rs760246899 128 dbSNP
rs1326607173 131 dbSNP
rs188179273 136 dbSNP
rs771763859 144 dbSNP
rs1305103339 147 dbSNP
rs747728769 148 dbSNP
rs146016854 153 dbSNP
rs1327133115 155 dbSNP
rs367902302 158 dbSNP
rs1035488223 161 dbSNP
rs41510444 164 dbSNP
rs1467084790 165 dbSNP
rs529830430 167 dbSNP
rs1163064457 180 dbSNP
rs749596220 181 dbSNP
rs927684512 189 dbSNP
rs981881706 194 dbSNP
rs961432580 201 dbSNP
rs1048369641 202 dbSNP
rs1480196348 203 dbSNP
rs1371603195 211 dbSNP
rs1477535289 221 dbSNP
rs1230921676 222 dbSNP
rs542538964 223 dbSNP
rs984195678 224 dbSNP
rs1290565664 229 dbSNP
rs1219702138 236 dbSNP
rs1460359516 244 dbSNP
rs756673561 249 dbSNP
rs147543992 250 dbSNP
rs1229346397 260 dbSNP
rs1373097398 264 dbSNP
rs896802347 267 dbSNP
rs1412040711 271 dbSNP
rs1371470513 274 dbSNP
rs143304230 276 dbSNP
rs1302778651 280 dbSNP
rs1422830441 289 dbSNP
rs1351635152 293 dbSNP
rs1165433382 294 dbSNP
rs745991716 296 dbSNP
rs1405668715 303 dbSNP
rs952658417 308 dbSNP
rs781388985 309 dbSNP
rs1486710538 310 dbSNP
rs1472793134 318 dbSNP
rs1267737818 323 dbSNP
rs1219724060 328 dbSNP
rs943769309 330 dbSNP
rs1490703003 332 dbSNP
rs1265477332 333 dbSNP
rs912303340 335 dbSNP
rs1214424382 336 dbSNP
rs1316894445 337 dbSNP
rs185716790 339 dbSNP
rs1188687683 346 dbSNP
rs745644051 346 dbSNP
rs932848760 347 dbSNP
rs1164668537 355 dbSNP
rs1364941701 356 dbSNP
rs2285230 358 dbSNP
rs996624195 362 dbSNP
rs575183627 365 dbSNP
rs1415039147 370 dbSNP
rs556916905 371 dbSNP
rs1403286064 374 dbSNP
rs1019426878 378 dbSNP
rs224446 390 dbSNP
rs142574280 392 dbSNP
rs1453124934 393 dbSNP
rs754734883 409 dbSNP
rs1236542458 413 dbSNP
rs765348165 415 dbSNP
rs886049564 420 dbSNP
rs1428277887 421 dbSNP
rs1196878381 431 dbSNP
rs1434587117 432 dbSNP
rs1267586380 433 dbSNP
rs1185488827 437 dbSNP
rs1484606889 440 dbSNP
rs779038580 441 dbSNP
rs759580400 442 dbSNP
rs1211066738 446 dbSNP
rs1056086048 447 dbSNP
rs1262950331 449 dbSNP
rs1347865063 450 dbSNP
rs1222039807 453 dbSNP
rs1284468966 463 dbSNP
rs1034212707 476 dbSNP
rs1302235618 477 dbSNP
rs574989172 478 dbSNP
rs1421408215 482 dbSNP
rs1359882946 483 dbSNP
rs149602502 486 dbSNP
rs1435673239 500 dbSNP
rs1405227484 501 dbSNP
rs1174060831 504 dbSNP
rs1380109228 508 dbSNP
rs1467378043 517 dbSNP
rs1377911222 533 dbSNP
rs1319938403 536 dbSNP
rs938812945 540 dbSNP
rs193030246 546 dbSNP
rs1373298638 554 dbSNP
rs1426235786 558 dbSNP
rs766363673 559 dbSNP
rs1036540629 564 dbSNP
rs766464377 568 dbSNP
rs1243054608 571 dbSNP
rs1308502648 582 dbSNP
rs1173551373 585 dbSNP
rs760586326 593 dbSNP
rs1484403147 596 dbSNP
rs1026837943 598 dbSNP
rs772752245 600 dbSNP
rs1282739125 601 dbSNP
rs761116058 603 dbSNP
rs1169861111 613 dbSNP
rs1251983717 615 dbSNP
rs766970834 618 dbSNP
rs983796975 621 dbSNP
rs952514604 627 dbSNP
rs921163766 634 dbSNP
rs1238153516 635 dbSNP
rs1454969546 637 dbSNP
rs1229205195 653 dbSNP
rs572570102 654 dbSNP
rs552634630 656 dbSNP
rs535029460 657 dbSNP
rs1402577361 662 dbSNP
rs1297276070 672 dbSNP
rs1170485999 676 dbSNP
rs1460118711 678 dbSNP
rs1355743055 686 dbSNP
rs943741572 698 dbSNP
rs1019370012 713 dbSNP
rs571129669 716 dbSNP
rs1168738323 719 dbSNP
rs1443471656 725 dbSNP
rs1049972973 727 dbSNP
rs1442749138 738 dbSNP
rs1185975315 740 dbSNP
rs1300995756 742 dbSNP
rs1365690673 749 dbSNP
rs1425948375 750 dbSNP
rs967484274 753 dbSNP
rs552810613 771 dbSNP
rs932805907 772 dbSNP
rs768346443 776 dbSNP
rs1195558468 778 dbSNP
rs771164993 781 dbSNP
rs772485740 784 dbSNP
rs1277023017 786 dbSNP
rs79206015 789 dbSNP
rs1043878932 790 dbSNP
rs564071030 791 dbSNP
rs1246843113 792 dbSNP
rs1340879882 793 dbSNP
rs1055821766 796 dbSNP
rs1389443752 804 dbSNP
rs1251556700 808 dbSNP
rs1372091298 811 dbSNP
rs1308186229 815 dbSNP
rs914193414 816 dbSNP
rs1423467361 818 dbSNP
rs1003093319 819 dbSNP
rs376188378 824 dbSNP
rs907456272 828 dbSNP
rs1186724025 840 dbSNP
rs1363110910 843 dbSNP
rs1426217147 846 dbSNP
rs757182678 849 dbSNP
rs775972186 850 dbSNP
rs1369531940 860 dbSNP
rs1181616559 862 dbSNP
rs1395049104 868 dbSNP
rs992162970 868 dbSNP
rs111817978 869 dbSNP
rs73297974 872 dbSNP
rs537304184 877 dbSNP
rs1490214743 882 dbSNP
rs926708595 883 dbSNP
rs940890290 885 dbSNP
rs952121771 886 dbSNP
rs746407483 909 dbSNP
rs886850357 910 dbSNP
rs1454175641 919 dbSNP
rs1260067465 924 dbSNP
rs1026785314 928 dbSNP
rs1330644668 929 dbSNP
rs1352034830 934 dbSNP
rs1288611430 935 dbSNP
rs995342892 937 dbSNP
rs1328963675 939 dbSNP
rs1325007280 941 dbSNP
rs781745738 942 dbSNP
rs961282994 951 dbSNP
rs182125518 952 dbSNP
rs1158430079 955 dbSNP
rs1048644048 966 dbSNP
rs1414589608 968 dbSNP
rs886049563 970 dbSNP
rs1160228377 971 dbSNP
rs774980110 972 dbSNP
rs1015963346 973 dbSNP
rs1201172945 979 dbSNP
rs920903497 980 dbSNP
rs886049562 985 dbSNP
rs886049561 986 dbSNP
rs537388261 989 dbSNP
rs1384909507 990 dbSNP
rs747044356 1000 dbSNP
rs150426997 1001 dbSNP
rs1049425900 1002 dbSNP
rs1222650419 1005 dbSNP
rs886049560 1007 dbSNP
rs758635229 1010 dbSNP
rs1276246528 1011 dbSNP
rs1436579362 1015 dbSNP
rs1325294312 1020 dbSNP
rs753676302 1021 dbSNP
rs1356147994 1024 dbSNP
rs1433482436 1030 dbSNP
rs150909 1031 dbSNP
rs903612741 1038 dbSNP
rs779795966 1041 dbSNP
rs755867482 1042 dbSNP
rs1174471958 1043 dbSNP
rs912517049 1044 dbSNP
rs750386714 1045 dbSNP
rs1257846539 1048 dbSNP
rs190239649 1054 dbSNP
rs767436028 1057 dbSNP
rs41398049 1058 dbSNP
rs1470478994 1064 dbSNP
rs114477310 1072 dbSNP
rs77629814 1076 dbSNP
rs72561484 1080 dbSNP
rs990615340 1083 dbSNP
rs1202874826 1088 dbSNP
rs763696315 1090 dbSNP
rs1405483209 1093 dbSNP
rs939637159 1094 dbSNP
rs1219397046 1095 dbSNP
rs926587901 1099 dbSNP
rs1376368035 1107 dbSNP
rs1294824620 1109 dbSNP
rs1229949969 1111 dbSNP
rs756275201 1124 dbSNP
rs1321729546 1129 dbSNP
rs1447776505 1131 dbSNP
rs1443597062 1132 dbSNP
rs1357732484 1133 dbSNP
rs980776420 1134 dbSNP
rs1439937706 1136 dbSNP
rs775291249 1149 dbSNP
rs866778898 1151 dbSNP
rs1239951183 1162 dbSNP
rs1329440854 1170 dbSNP
rs1415297199 1172 dbSNP
rs958790909 1175 dbSNP
rs1370159689 1178 dbSNP
rs1034312003 1180 dbSNP
rs1002914988 1186 dbSNP
rs1166854701 1189 dbSNP
rs1404593733 1201 dbSNP
rs762674290 1202 dbSNP
rs920717648 1204 dbSNP
rs973895202 1206 dbSNP
rs769260493 1212 dbSNP
rs1015493907 1214 dbSNP
rs17125172 1215 dbSNP
rs745529197 1238 dbSNP
rs1436916619 1249 dbSNP
rs887921862 1256 dbSNP
rs1272030786 1260 dbSNP
rs60725885 1261 dbSNP
rs777290057 1264 dbSNP
rs1467797990 1267 dbSNP
rs11169654 1273 dbSNP
rs899592573 1275 dbSNP
rs1401542006 1287 dbSNP
rs1377581254 1288 dbSNP
rs996505421 1292 dbSNP
rs1398821913 1293 dbSNP
rs186973090 1297 dbSNP
rs747124260 1298 dbSNP
rs777876037 1299 dbSNP
rs1306339197 1300 dbSNP
rs772230183 1305 dbSNP
rs1043482328 1312 dbSNP
rs1273931303 1316 dbSNP
rs1371191505 1316 dbSNP
rs1339461668 1318 dbSNP
rs1197106807 1319 dbSNP
rs34220901 1322 dbSNP
rs1256004976 1329 dbSNP
rs1457274917 1330 dbSNP
rs1164037951 1332 dbSNP
rs748388993 1339 dbSNP
rs12480 1343 dbSNP
rs138011955 1344 dbSNP
rs1182297235 1354 dbSNP
rs573581505 1360 dbSNP
rs1249176383 1365 dbSNP
rs1235162595 1367 dbSNP
rs1196991255 1370 dbSNP
rs1183828742 1376 dbSNP
rs142166519 1381 dbSNP
rs1475778564 1382 dbSNP
rs912465753 1384 dbSNP
rs1056647247 1397 dbSNP
rs1218714195 1398 dbSNP
rs1398667309 1399 dbSNP
rs1320499725 1401 dbSNP
rs1465581386 1402 dbSNP
rs939564318 1404 dbSNP
rs1397114191 1417 dbSNP
rs1229254422 1419 dbSNP
rs1350193753 1425 dbSNP
rs977765058 1426 dbSNP
rs1289988644 1435 dbSNP
rs1326664936 1435 dbSNP
rs946003076 1444 dbSNP
rs1359628714 1459 dbSNP
rs1317186135 1460 dbSNP
rs920666715 1461 dbSNP
rs1293068694 1462 dbSNP
rs972167048 1463 dbSNP
rs1434388285 1464 dbSNP
rs561463670 1467 dbSNP
rs1280115135 1468 dbSNP
rs1195873415 1471 dbSNP
rs940806544 1478 dbSNP
rs746988310 1482 dbSNP
rs757190615 1483 dbSNP
rs1409436768 1485 dbSNP
rs116731209 1486 dbSNP
rs1472741641 1491 dbSNP
rs1163060001 1493 dbSNP
rs1385168696 1497 dbSNP
rs1401500940 1498 dbSNP
rs955466891 1502 dbSNP
rs1028228620 1504 dbSNP
rs1189018488 1505 dbSNP
rs1489136390 1510 dbSNP
rs1248979459 1515 dbSNP
rs1222889526 1517 dbSNP
rs1328945061 1521 dbSNP
rs1266671737 1523 dbSNP
rs1312526294 1525 dbSNP
rs1366487834 1527 dbSNP
rs1230601239 1528 dbSNP
rs990002369 1531 dbSNP
rs1330149628 1533 dbSNP
rs1243722591 1540 dbSNP
rs1261116613 1544 dbSNP
rs975035056 1545 dbSNP
rs763684336 1547 dbSNP
rs1369752486 1548 dbSNP
rs1294071430 1555 dbSNP
rs1434329496 1556 dbSNP
rs777649881 1559 dbSNP
rs1178309174 1562 dbSNP
rs1322363363 1563 dbSNP
rs762513303 1573 dbSNP
rs542347738 1574 dbSNP
rs1173448058 1582 dbSNP
rs144968585 1583 dbSNP
rs1258805738 1587 dbSNP
rs760035407 1591 dbSNP
rs1187354119 1592 dbSNP
rs1464883782 1596 dbSNP
rs886049559 1599 dbSNP
rs557225035 1615 dbSNP
rs1164473451 1617 dbSNP
rs1486361506 1624 dbSNP
rs537671498 1625 dbSNP
rs1255647819 1633 dbSNP
rs1231278482 1634 dbSNP
rs1421953248 1635 dbSNP
rs1314130315 1638 dbSNP
rs1156440998 1640 dbSNP
rs578240585 1642 dbSNP
rs761220255 1643 dbSNP
rs1213184195 1645 dbSNP
rs971412714 1647 dbSNP
rs1284299360 1650 dbSNP
rs1363027768 1651 dbSNP
rs755397829 1658 dbSNP
rs1299645587 1662 dbSNP
rs1321259443 1670 dbSNP
rs773539780 1671 dbSNP
rs755074642 1681 dbSNP
rs772166626 1683 dbSNP
rs191887833 1684 dbSNP
rs1359360311 1688 dbSNP
rs1167482223 1691 dbSNP
rs1005518516 1693 dbSNP
rs1405398595 1695 dbSNP
rs1388869024 1696 dbSNP
rs1191000852 1701 dbSNP
rs1429510431 1702 dbSNP
rs186583435 1706 dbSNP
rs1028196487 1714 dbSNP
rs1428836172 1718 dbSNP
rs1353280800 1720 dbSNP
rs1045371340 1721 dbSNP
rs748156013 1728 dbSNP
rs1281300098 1736 dbSNP
rs1204527545 1737 dbSNP
rs766628921 1739 dbSNP
rs1276715869 1740 dbSNP
rs751992159 1741 dbSNP
rs1229004333 1742 dbSNP
rs899143415 1745 dbSNP
rs1177160892 1747 dbSNP
rs1379241840 1748 dbSNP
rs1036379403 1753 dbSNP
rs1356900378 1753 dbSNP
rs755515112 1753 dbSNP
rs763680321 1753 dbSNP
rs1310375877 1755 dbSNP
rs1298675999 1758 dbSNP
rs1397552284 1763 dbSNP
rs1379530493 1767 dbSNP
rs1427888009 1769 dbSNP
rs1306959601 1776 dbSNP
rs59280115 1778 dbSNP
rs796672052 1780 dbSNP
rs750648046 1795 dbSNP
rs1261410748 1797 dbSNP
rs921160441 1799 dbSNP
rs375705399 1803 dbSNP
rs1462986488 1809 dbSNP
rs1368383865 1816 dbSNP
rs1185950634 1826 dbSNP
rs1425855603 1829 dbSNP
rs975276787 1836 dbSNP
rs1258502908 1838 dbSNP
rs1181669166 1839 dbSNP
rs1482132675 1840 dbSNP
rs1276911768 1843 dbSNP
rs1196432616 1850 dbSNP
rs1459489486 1854 dbSNP
rs1355628978 1864 dbSNP
rs1202547206 1866 dbSNP
rs1263609693 1867 dbSNP
rs967949766 1874 dbSNP
rs149411 1876 dbSNP
rs1335176445 1877 dbSNP
rs756970075 1878 dbSNP
rs1287353469 1890 dbSNP
rs956658272 1891 dbSNP
rs1351922005 1893 dbSNP
rs1308169090 1897 dbSNP
rs1385727145 1898 dbSNP
rs1390648200 1900 dbSNP
rs886049558 1902 dbSNP
rs1459788155 1909 dbSNP
rs528056084 1936 dbSNP
rs72561485 1949 dbSNP
rs1295497047 1950 dbSNP
rs1438421757 1950 dbSNP
rs377220960 1953 dbSNP
rs144174412 1959 dbSNP
rs1278938576 1960 dbSNP
rs1320569932 1960 dbSNP
rs1254231815 1962 dbSNP
rs777505507 1967 dbSNP
rs1023830008 1970 dbSNP
rs563773129 1971 dbSNP
rs1211517744 1985 dbSNP
rs1468831526 1986 dbSNP
rs945920509 1992 dbSNP
rs899426163 1993 dbSNP
rs1267314890 1996 dbSNP
rs1226329247 1997 dbSNP
rs914533926 1998 dbSNP
rs1330851587 2013 dbSNP
rs1279701361 2036 dbSNP
rs372821814 2038 dbSNP
rs530604780 2044 dbSNP
rs775017037 2051 dbSNP
rs1322181102 2053 dbSNP
rs1389076740 2056 dbSNP
rs764636192 2058 dbSNP
rs1004916799 2063 dbSNP
rs890522494 2070 dbSNP
rs1455972390 2078 dbSNP
rs1414476724 2079 dbSNP
rs981499182 2082 dbSNP
rs886049557 2085 dbSNP
rs971482919 2085 dbSNP
rs1418566593 2088 dbSNP
rs1477754971 2092 dbSNP
rs1051879616 2107 dbSNP
rs1375962346 2108 dbSNP
rs907831818 2111 dbSNP
rs983471305 2112 dbSNP
rs1201057442 2114 dbSNP
rs1454699218 2115 dbSNP
rs184114633 2117 dbSNP
rs1206591802 2119 dbSNP
rs1299072635 2119 dbSNP
rs1278051631 2125 dbSNP
rs1357690594 2128 dbSNP
rs1466041660 2130 dbSNP
rs1284546513 2136 dbSNP
rs1230339946 2137 dbSNP
rs1372870696 2142 dbSNP
rs1321539729 2146 dbSNP
rs1199486492 2147 dbSNP
rs551258639 2148 dbSNP
rs1039519772 2151 dbSNP
rs762702736 2151 dbSNP
rs921067168 2151 dbSNP
rs141880064 2153 dbSNP
rs1027942440 2159 dbSNP
rs1182560890 2162 dbSNP
rs1372449229 2163 dbSNP
rs1297430797 2171 dbSNP
rs1433371177 2174 dbSNP
rs765049101 2180 dbSNP
rs1319269559 2182 dbSNP
rs1414164826 2186 dbSNP
rs1400313899 2194 dbSNP
rs1174454942 2201 dbSNP
rs1381033514 2206 dbSNP
rs762552222 2210 dbSNP
rs1244396830 2225 dbSNP
rs915198738 2230 dbSNP
rs559045140 2231 dbSNP
rs964873556 2232 dbSNP
rs956428196 2238 dbSNP
rs1480232566 2247 dbSNP
rs1249420140 2256 dbSNP
rs1341551680 2258 dbSNP
rs542609450 2261 dbSNP
rs1282991574 2267 dbSNP
rs1186540396 2269 dbSNP
rs1019089908 2270 dbSNP
rs1241408437 2271 dbSNP
rs1287640491 2273 dbSNP
rs1351076255 2279 dbSNP
rs1393583245 2280 dbSNP
rs1007903841 2288 dbSNP
rs867212578 2289 dbSNP
rs969141095 2293 dbSNP
rs573624530 2295 dbSNP
rs1207909695 2306 dbSNP
rs754201482 2312 dbSNP
rs1041774078 2319 dbSNP
rs1009938138 2320 dbSNP
rs1382350564 2321 dbSNP
rs141968385 2321 dbSNP
rs763361132 2321 dbSNP
rs1440396355 2322 dbSNP
rs893029060 2324 dbSNP
rs1054395639 2325 dbSNP
rs563410514 2326 dbSNP
rs575495762 2332 dbSNP
rs377068307 2333 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*