miRTarBase - #MIRT023285 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MARCKS   
Synonyms 80K-L, MACS, PKCSL, PRKCSL
Description myristoylated alanine rich protein kinase C substrate
Transcript NM_002356   
Expression
Putative miRNA Targets on MARCKS
3'UTR of MARCKS
(miRNA target sites are highlighted)
>MARCKS|NM_002356|3'UTR
   1 AAGAGCAAGCTTTTGTGAGATAATCGAAGAACTTTTCTCCCCCGTTTGTTTGTTGGAGTGGTGCCAGGTACTGGTTTTGG
  81 AGAACTTGTCTACAACCAGGGATTGATTTTAAAGATGTCTTTTTTTATTTTACTTTTTTTTAAGCACCAAATTTTGTTGT
 161 TTTTTTTTTTTCTCCCCTCCCCACAGATCCCATCTCAAATCATTCTGTTAACCACCATTCCAACAGGTCGAGGAGAGCTT
 241 AAACACCTTCTTCCTCTGCCTTGTTTCTCTTTTATTTTTTATTTTTTCGCATCAGTATTAATGTTTTTGCATACTTTGCA
 321 TCTTTATTCAAAAGTGTAAACTTTCTTTGTCAATCTATGGACATGCCCATATATGAAGGAGATGGGTGGGTCAAAAAGGG
 401 ATATCAAATGAAGTGATGGGGTCACAATGGGGAAATTGAAGTGGTGCATAACATTGCCAAAATAGTGTGCCACTAGAAAT
 481 GGTGTAAAGGCTGTCTTTTTTTTTTTTTTAAAAGAAAAGTTATTACCATGTATTTTGTGAGGCAGGTTTACAACACTACA
 561 AGTCTTGAGTTAAGAAGGAAAGAGGAAAAAAGAAAAAACACCAATACCCAGATTTAAAAAAAAAAAAACGATCATAGTCT
 641 TAGGAGTTCATTTAAACCATAGGAACTTTTCACTTATCTCATGTTAGCTGTACCAGTCAGTGATTAAGTAGAACTACAAG
 721 TTGTATAGGCTTTATTGTTTATTGCTGGTTTATGACCTTAATAAAGTGTAATTATGTATTACCAGCAGGGTGTTTTTAAC
 801 TGTGACTATTGTATAAAAACAAATCTTGATATCCAGAAGCACATGAAGTTTGCAACTTTCCACCCTGCCCATTTTTGTAA
 881 AACTGCAGTCATCTTGGACCTTTTAAAACACAAATTTTAAACTCAACCAAGCTGTGATAAGTGGAATGGTTACTGTTTAT
 961 ACTGTGGTATGTTTTTGATTACAGCAGATAATGCTTTCTTTTCCAGTCGTCTTTGAGAATAAAGGAAAAAAAATCTTCAG
1041 ATGCAATGGTTTTGTGTAGCATCTTGTCTATCATGTTTTGTAAATACTGGAGAAGCTTTGACCAATTTGACTTAGAGATG
1121 GAATGTAACTTTGCTTACAAAAATTGCTATTAAACTCCTGCTTAAGGTGTTCTAATTTTCTGTGAGCACACTAAAAGCGA
1201 AAAATAAATGTGAATAAAATGTACAAATTTGTTGTGTTTTTTTATGTTCTAATAATACTGAGACTTCTAGGTCTTAGGTT
1281 AATTTTTAGGAAGATCTTGCATGCCATCAGGAGTAAATTTTATTGTGGTTCTTAATCTGAAGTTTTCAAGCTCTGAAATT
1361 CATAATCCGCAGTGTCAGATTACGTAGAGGAAGATCTTACAACATTTCCATGTCAAATCTGTTACCATTTATTGGCATTT
1441 AGTTTTCATTTAAGAATTGAACATAATTATTTTTATTGTAGCTATATAGCATGTCAGATTAAATCATTTACAACAAAAGG
1521 GGTGTGAACCTAAGACTATTTAAATGTCTTATGAGAAAATTTCATAAAGCCATTCTCTTGTCATTCAGGTCCAGAAACAA
1601 ATTTTAAACTGAGTGAGAGTCTATAGAATCCATACTGCAGATGGGTCATGAAATGTGACCAAATGTGTTTCAAAAATTGA
1681 TGGTGTATTACCTGCTATTGTAATTGCTTAGTGCTTGGCTAATTTCCAAATTATTGCATAATATGTTCTACCTTAAGAAA
1761 ACAGGTTTATGTAACAAAGTAATGGTGTTGAATGGATGATGTCAGTTCATGGGCCTTTAGCATAGTTTTAAGCATCCTTT
1841 TTTTTTTTTTTTTTTGAAAGTGTGTTAGCATCTTGTTACTCAAAGGATAAGACAGACAATAATACTTCACTGAATCTTAA
1921 TAATCTTTACTAGTTTACCTCCTCTGCTCTTTGCCACCCGATAACTGGATATCTTTTCCTTCAAAGGACCCTAAACTGAT
2001 TGAAATTTAAGATATGTATCAAAAACATTATTTCATTTAATGCACATCTGTTTTGCTGTTTTTGAGCAGTGTGCAGTTTA
2081 GGGTTCATGATAAATCATTGAACCACATGTGTAACAACTGAATGCCAAATCTTAAACTCATTAGAAAAATAACAAATTAG
2161 GTTTTGACACGCATTCTTAATTGGAATAATGGATCAAAAATAGTGGTTCATGACCTTACCAAACACCCTTGCTACTAATA
2241 AAATCAAATAACACTTAGAAGGGTATGTATTTTTAGTTAGGGTTTCTTGATCTTGGAGGATGTTTGAAAGTTAAAAATTG
2321 AATTTGGTAACCAAAGGACTGATTTATGGGTCTTTCCTATCTTAACCAACGTTTTCTTAGTTACCTAGATGGCCAAGTAC
2401 AGTGCCTGGTATGTAGTAAGACTCAGTAAAAAAGTGGATTTTTAAAAATAACTCCCAAAGTGAATAGTCAAAAATCCTGT
2481 TAGCAAACTGTTATATATTGCTAAGTTTGTTCTTTTAACAGCTGGAATTTATTAAGATGCATTATTTTGATTTTATTCAC
2561 TGCCTAAAACACTTTGGGTGGTATTGATGGAGTTGGTGGATTTTCCTCCAAGTGATTAAATGAAATTTGACGTATCTTTT
2641 CATCCAAAGTTTTGTACATCATGTTTTCTAACGGAAAAAAATGTTAATATGGCTTTTTTGTATTACTAAAAATAGCTTTG
2721 AGATTAAGGAAAAATAAATAACTCTTGTACAGTTCAGTATTGTCTATTAAATCTGTATTGGCAGTATGTATAATGGCATT
2801 TGCTGTGGTTACAAAATACTTCCTCTGGGTTATAATAATCATTTGATCCAATTCCTATTGCTTGTAAAATAAAGTTTTAC
2881 CAGTTGATATAATCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            || |::: | |:| ||||| 
Target 5' caAAAATTGCTATTAAACTCCt 3'
1138 - 1159 128.00 -8.00
2
miRNA  3' guUUGUGGUAACAGUGUGAGgu 5'
            ||||| | | |:| ||||  
Target 5' aaAACACAAATTTTAAACTCaa 3'
905 - 926 120.00 -9.47
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            || |:| ||   |||:|:| 
Target 5' ggAAGATC-TTACAACATTTCc 3'
1389 - 1409 119.00 -8.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30178993 7 COSMIC
COSN26578881 21 COSMIC
COSN26983783 21 COSMIC
COSN28877940 25 COSMIC
COSN31601286 26 COSMIC
COSN26983782 30 COSMIC
COSN26553139 49 COSMIC
COSN509333 71 COSMIC
COSN31607384 78 COSMIC
COSN30556734 85 COSMIC
COSN30104254 100 COSMIC
COSN31604142 106 COSMIC
COSN28846119 142 COSMIC
COSN20402152 160 COSMIC
COSN20103278 171 COSMIC
COSN23249849 172 COSMIC
COSN20075743 224 COSMIC
COSN30534795 237 COSMIC
COSN31534130 271 COSMIC
COSN31530332 289 COSMIC
COSN32057752 354 COSMIC
COSN30544438 403 COSMIC
COSN31567592 477 COSMIC
COSN26567757 593 COSMIC
COSN26855243 617 COSMIC
COSN20103280 629 COSMIC
COSN31589964 668 COSMIC
COSN19444567 694 COSMIC
COSN19444568 715 COSMIC
COSN31513154 783 COSMIC
COSN31530340 825 COSMIC
COSN31483854 826 COSMIC
COSN24301779 832 COSMIC
COSN24488133 899 COSMIC
COSN30175896 1010 COSMIC
COSN8493504 1047 COSMIC
COSN26639364 1050 COSMIC
COSN31556248 1244 COSMIC
COSN31534146 1278 COSMIC
COSN26664322 1279 COSMIC
COSN31528220 1317 COSMIC
COSN2134717 1688 COSMIC
COSN16592270 1809 COSMIC
COSN20103289 1838 COSMIC
COSN7594656 1841 COSMIC
COSN32065009 2264 COSMIC
COSN21663625 2280 COSMIC
COSN14798275 2493 COSMIC
COSN27279405 2623 COSMIC
COSN24106941 2633 COSMIC
COSN21206317 2638 COSMIC
COSN19487470 2700 COSMIC
rs28558559 2493 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1444169803 6 dbSNP
rs182598859 9 dbSNP
rs1373713975 10 dbSNP
rs1020788014 11 dbSNP
rs1274848749 14 dbSNP
rs1342944074 16 dbSNP
rs1216345722 18 dbSNP
rs1271661034 18 dbSNP
rs1273809603 20 dbSNP
rs781128418 21 dbSNP
rs1224821554 23 dbSNP
rs748038159 25 dbSNP
rs565228199 30 dbSNP
rs769625706 31 dbSNP
rs548079843 39 dbSNP
rs1334295847 42 dbSNP
rs746065255 44 dbSNP
rs752257051 44 dbSNP
rs559763616 69 dbSNP
rs1209952595 75 dbSNP
rs944421509 81 dbSNP
rs981861317 86 dbSNP
rs1474563404 88 dbSNP
rs974523509 88 dbSNP
rs958592840 98 dbSNP
rs530132101 119 dbSNP
rs1188801528 120 dbSNP
rs984745086 120 dbSNP
rs1210097226 123 dbSNP
rs921593761 123 dbSNP
rs940522409 131 dbSNP
rs1274879859 132 dbSNP
rs1036089144 134 dbSNP
rs1338386714 134 dbSNP
rs1353036491 134 dbSNP
rs923027584 134 dbSNP
rs933114422 135 dbSNP
rs1185039046 139 dbSNP
rs1262715894 149 dbSNP
rs1050033774 154 dbSNP
rs1165910573 160 dbSNP
rs1396134750 160 dbSNP
rs1408543301 160 dbSNP
rs1415780446 160 dbSNP
rs397897544 160 dbSNP
rs45449896 160 dbSNP
rs74374599 160 dbSNP
rs888822248 161 dbSNP
rs942949206 162 dbSNP
rs548583110 163 dbSNP
rs893263671 165 dbSNP
rs570200803 166 dbSNP
rs1360746511 171 dbSNP
rs78826488 171 dbSNP
rs1451322997 172 dbSNP
rs1297255229 173 dbSNP
rs1340770202 175 dbSNP
rs1228451020 176 dbSNP
rs1374749631 177 dbSNP
rs1281780695 178 dbSNP
rs537535746 179 dbSNP
rs1335563308 181 dbSNP
rs552654189 182 dbSNP
rs1463229045 190 dbSNP
rs1366217936 191 dbSNP
rs1164349619 194 dbSNP
rs1401352268 200 dbSNP
rs1410144302 201 dbSNP
rs1175423858 228 dbSNP
rs1469505142 233 dbSNP
rs1253428044 238 dbSNP
rs907267176 246 dbSNP
rs1219219088 247 dbSNP
rs1251956945 249 dbSNP
rs1318187231 250 dbSNP
rs1002980655 258 dbSNP
rs371006571 258 dbSNP
rs1034347996 259 dbSNP
rs1314357151 261 dbSNP
rs377678298 264 dbSNP
rs1304686050 266 dbSNP
rs571427141 272 dbSNP
rs1443521183 274 dbSNP
rs1214115372 275 dbSNP
rs371174019 275 dbSNP
rs1431680515 282 dbSNP
rs374058543 282 dbSNP
rs1347044692 284 dbSNP
rs45537138 290 dbSNP
rs538419580 292 dbSNP
rs1156962466 297 dbSNP
rs146698195 308 dbSNP
rs1063446 309 dbSNP
rs747726352 316 dbSNP
rs1285705078 326 dbSNP
rs1175328675 327 dbSNP
rs1452338363 330 dbSNP
rs757735258 336 dbSNP
rs763760630 341 dbSNP
rs1486607612 351 dbSNP
rs12307 354 dbSNP
rs187145968 358 dbSNP
rs1488271105 363 dbSNP
rs554134745 366 dbSNP
rs1237030722 385 dbSNP
rs746183624 390 dbSNP
rs768114506 391 dbSNP
rs1346182820 392 dbSNP
rs1477735648 417 dbSNP
rs1171466209 418 dbSNP
rs145476378 418 dbSNP
rs1364288090 419 dbSNP
rs543117743 423 dbSNP
rs933064689 427 dbSNP
rs775717367 428 dbSNP
rs1376069695 433 dbSNP
rs1314633909 437 dbSNP
rs1432725020 444 dbSNP
rs1394258942 445 dbSNP
rs1427156381 447 dbSNP
rs1417185864 451 dbSNP
rs1346998390 452 dbSNP
rs910186722 459 dbSNP
rs1475240016 461 dbSNP
rs936340985 470 dbSNP
rs1157863858 475 dbSNP
rs1054610418 476 dbSNP
rs1255793225 490 dbSNP
rs1360856660 491 dbSNP
rs893390504 491 dbSNP
rs1309527791 493 dbSNP
rs1421152493 494 dbSNP
rs1401354100 496 dbSNP
rs1405719663 496 dbSNP
rs532752513 496 dbSNP
rs79053472 497 dbSNP
rs1463324956 506 dbSNP
rs946346477 507 dbSNP
rs1169322694 509 dbSNP
rs1352456723 509 dbSNP
rs1042258895 510 dbSNP
rs397888484 510 dbSNP
rs558330638 511 dbSNP
rs1436544595 512 dbSNP
rs1481816692 514 dbSNP
rs372965870 515 dbSNP
rs1249919782 517 dbSNP
rs1002949568 529 dbSNP
rs551462727 531 dbSNP
rs1335675353 538 dbSNP
rs1275155050 541 dbSNP
rs1231510596 548 dbSNP
rs1339868113 555 dbSNP
rs1307598175 560 dbSNP
rs1393002070 562 dbSNP
rs1370911307 567 dbSNP
rs1330376440 571 dbSNP
rs1034441373 572 dbSNP
rs1461660112 572 dbSNP
rs11544236 579 dbSNP
rs1162221892 585 dbSNP
rs1049866 586 dbSNP
rs1460463347 591 dbSNP
rs1368455683 593 dbSNP
rs1276057094 602 dbSNP
rs1370401732 605 dbSNP
rs189101937 614 dbSNP
rs1248905097 616 dbSNP
rs549493672 616 dbSNP
rs752660224 616 dbSNP
rs10585 617 dbSNP
rs1049873 618 dbSNP
rs1355739294 624 dbSNP
rs1016296082 626 dbSNP
rs1354843656 629 dbSNP
rs1219151030 630 dbSNP
rs1308313359 633 dbSNP
rs1441338667 637 dbSNP
rs1287950741 639 dbSNP
rs541240412 660 dbSNP
rs1323472713 671 dbSNP
rs1451161782 682 dbSNP
rs1385066359 694 dbSNP
rs962252395 694 dbSNP
rs1290062938 701 dbSNP
rs1316647091 703 dbSNP
rs1378967535 719 dbSNP
rs1158467289 723 dbSNP
rs1454981581 724 dbSNP
rs1803844 729 dbSNP
rs972046738 730 dbSNP
rs1222435175 732 dbSNP
rs1192004015 746 dbSNP
rs1248493061 749 dbSNP
rs1030573627 751 dbSNP
rs747750640 758 dbSNP
rs1206941981 767 dbSNP
rs45460602 776 dbSNP
rs1285203509 800 dbSNP
rs1380745195 803 dbSNP
rs1441312175 804 dbSNP
rs1161327383 809 dbSNP
rs181436457 813 dbSNP
rs542287099 823 dbSNP
rs1326608929 833 dbSNP
rs1319758662 846 dbSNP
rs1380001034 847 dbSNP
rs910318974 852 dbSNP
rs1298132245 853 dbSNP
rs1435825859 855 dbSNP
rs1377678052 856 dbSNP
rs936311282 857 dbSNP
rs747210493 869 dbSNP
rs1373837730 877 dbSNP
rs563674198 880 dbSNP
rs913589966 882 dbSNP
rs768988192 889 dbSNP
rs530884087 890 dbSNP
rs1211522195 895 dbSNP
rs1486582485 901 dbSNP
rs1242737415 903 dbSNP
rs200123264 905 dbSNP
rs552654528 914 dbSNP
rs1199630505 923 dbSNP
rs1339715403 925 dbSNP
rs1282742069 938 dbSNP
rs776819339 947 dbSNP
rs1229042808 949 dbSNP
rs1293319861 951 dbSNP
rs570827525 955 dbSNP
rs1357883312 961 dbSNP
rs1332666505 973 dbSNP
rs879534367 978 dbSNP
rs1397564103 986 dbSNP
rs3210346 1000 dbSNP
rs374346755 1004 dbSNP
rs1238681826 1005 dbSNP
rs1464211168 1020 dbSNP
rs1458996782 1021 dbSNP
rs1185179354 1025 dbSNP
rs1188695168 1026 dbSNP
rs1450686169 1026 dbSNP
rs397718021 1026 dbSNP
rs398085233 1026 dbSNP
rs77809813 1026 dbSNP
rs1186642673 1037 dbSNP
rs1038102725 1038 dbSNP
rs1274792006 1041 dbSNP
rs1193741316 1047 dbSNP
rs1236615748 1055 dbSNP
rs1316881130 1058 dbSNP
rs1273315039 1065 dbSNP
rs1234571035 1069 dbSNP
rs1472929401 1075 dbSNP
rs1063524 1083 dbSNP
rs762032868 1089 dbSNP
rs879137498 1098 dbSNP
rs185776191 1118 dbSNP
rs1447857641 1119 dbSNP
rs1164621010 1121 dbSNP
rs765216822 1136 dbSNP
rs897859154 1139 dbSNP
rs993785879 1144 dbSNP
rs1399793368 1147 dbSNP
rs1464618142 1155 dbSNP
rs1030248559 1156 dbSNP
rs1411617182 1160 dbSNP
rs1162607761 1162 dbSNP
rs954524615 1167 dbSNP
rs1170652443 1169 dbSNP
rs1234428647 1170 dbSNP
rs1176513863 1173 dbSNP
rs1401695871 1174 dbSNP
rs1253228033 1178 dbSNP
rs1215095416 1187 dbSNP
rs1319408310 1189 dbSNP
rs1007362319 1191 dbSNP
rs1228273441 1197 dbSNP
rs1332618867 1199 dbSNP
rs1281679617 1201 dbSNP
rs1238398233 1218 dbSNP
rs1340188753 1234 dbSNP
rs1449105831 1235 dbSNP
rs1286172527 1236 dbSNP
rs548527443 1239 dbSNP
rs1218069736 1242 dbSNP
rs1348234678 1245 dbSNP
rs1322931022 1247 dbSNP
rs374987606 1252 dbSNP
rs1410043324 1258 dbSNP
rs773310080 1265 dbSNP
rs762738480 1269 dbSNP
rs868674093 1270 dbSNP
rs1438846451 1272 dbSNP
rs547258665 1278 dbSNP
rs1487272870 1279 dbSNP
rs1245654089 1280 dbSNP
rs766098375 1288 dbSNP
rs1448125928 1307 dbSNP
rs1288763315 1308 dbSNP
rs957766778 1314 dbSNP
rs1353438295 1323 dbSNP
rs1319917703 1325 dbSNP
rs569959697 1329 dbSNP
rs1304569199 1348 dbSNP
rs1198604125 1363 dbSNP
rs1236814863 1368 dbSNP
rs552826723 1369 dbSNP
rs989285845 1370 dbSNP
rs1431556703 1379 dbSNP
rs352083 1384 dbSNP
rs1418959719 1385 dbSNP
rs754585621 1388 dbSNP
rs1189233627 1399 dbSNP
rs978038052 1401 dbSNP
rs1332006557 1405 dbSNP
rs397897545 1405 dbSNP
rs1476103920 1408 dbSNP
rs1260318413 1411 dbSNP
rs938943815 1425 dbSNP
rs1477261782 1431 dbSNP
rs1199943856 1432 dbSNP
rs367945569 1437 dbSNP
rs1278185063 1438 dbSNP
rs916119886 1448 dbSNP
rs752185798 1464 dbSNP
rs1467660999 1466 dbSNP
rs942084071 1476 dbSNP
rs1037796707 1479 dbSNP
rs190105919 1486 dbSNP
rs1314544235 1487 dbSNP
rs897778090 1491 dbSNP
rs1415374137 1495 dbSNP
rs1170710460 1498 dbSNP
rs1411233952 1508 dbSNP
rs755648204 1514 dbSNP
rs1192268498 1516 dbSNP
rs1477810287 1520 dbSNP
rs993528570 1521 dbSNP
rs1184030885 1526 dbSNP
rs1482485097 1536 dbSNP
rs1052090619 1538 dbSNP
rs1338750294 1539 dbSNP
rs890361563 1551 dbSNP
rs1320221421 1552 dbSNP
rs571157123 1553 dbSNP
rs1218066817 1554 dbSNP
rs1017389727 1558 dbSNP
rs1314762879 1559 dbSNP
rs1278931719 1570 dbSNP
rs1342435992 1571 dbSNP
rs1231060704 1572 dbSNP
rs569321680 1573 dbSNP
rs759991825 1577 dbSNP
rs1345509593 1578 dbSNP
rs1443981459 1581 dbSNP
rs1201983010 1610 dbSNP
rs1011038406 1612 dbSNP
rs1283574319 1620 dbSNP
rs1487761988 1624 dbSNP
rs1461504919 1625 dbSNP
rs1419309026 1626 dbSNP
rs352084 1629 dbSNP
rs553174158 1634 dbSNP
rs149350734 1646 dbSNP
rs112051674 1659 dbSNP
rs927637047 1672 dbSNP
rs1197423294 1681 dbSNP
rs1198160508 1682 dbSNP
rs1468967476 1688 dbSNP
rs1377538588 1689 dbSNP
rs960274781 1704 dbSNP
rs576844500 1705 dbSNP
rs1321020692 1709 dbSNP
rs1478616150 1712 dbSNP
rs1307509432 1715 dbSNP
rs541647979 1720 dbSNP
rs1374289062 1728 dbSNP
rs1330273312 1730 dbSNP
rs1441114119 1738 dbSNP
rs1358959030 1745 dbSNP
rs1392287055 1746 dbSNP
rs1291250479 1748 dbSNP
rs1368378532 1760 dbSNP
rs1419390219 1760 dbSNP
rs1160361240 1765 dbSNP
rs758733479 1766 dbSNP
rs1378778190 1769 dbSNP
rs1178269562 1772 dbSNP
rs1454834883 1791 dbSNP
rs1269615092 1802 dbSNP
rs1299026728 1812 dbSNP
rs942213177 1815 dbSNP
rs776071238 1819 dbSNP
rs1218617719 1827 dbSNP
rs553285049 1829 dbSNP
rs973869613 1833 dbSNP
rs1385129360 1835 dbSNP
rs1342067879 1836 dbSNP
rs1332432321 1837 dbSNP
rs1491209603 1837 dbSNP
rs1158374451 1838 dbSNP
rs1196939004 1838 dbSNP
rs1262447721 1838 dbSNP
rs1379579324 1838 dbSNP
rs1432680219 1838 dbSNP
rs145532268 1838 dbSNP
rs1491555848 1838 dbSNP
rs352085 1838 dbSNP
rs371572578 1838 dbSNP
rs57774858 1838 dbSNP
rs962110395 1839 dbSNP
rs1331638628 1840 dbSNP
rs1235239791 1841 dbSNP
rs1306828881 1842 dbSNP
rs1352704195 1845 dbSNP
rs1240513615 1849 dbSNP
rs1285093621 1854 dbSNP
rs1287680595 1854 dbSNP
rs1211302840 1856 dbSNP
rs1172551249 1857 dbSNP
rs1392709701 1858 dbSNP
rs1208749587 1859 dbSNP
rs1267356094 1861 dbSNP
rs1452705828 1863 dbSNP
rs1196036585 1865 dbSNP
rs1326516593 1875 dbSNP
rs1279483445 1880 dbSNP
rs1402428663 1882 dbSNP
rs1339063940 1884 dbSNP
rs1378925550 1898 dbSNP
rs1415403645 1909 dbSNP
rs45457891 1917 dbSNP
rs929412138 1933 dbSNP
rs1424466536 1948 dbSNP
rs567429487 1959 dbSNP
rs1159525822 1961 dbSNP
rs1172870359 1963 dbSNP
rs1476827672 1988 dbSNP
rs1262369390 1989 dbSNP
rs1365782635 2002 dbSNP
rs1443932376 2012 dbSNP
rs1253743019 2014 dbSNP
rs1456545345 2015 dbSNP
rs1293024277 2019 dbSNP
rs1199542882 2027 dbSNP
rs1391473402 2030 dbSNP
rs763584780 2043 dbSNP
rs1339609197 2069 dbSNP
rs1259473558 2087 dbSNP
rs747438920 2097 dbSNP
rs972458310 2107 dbSNP
rs56254935 2113 dbSNP
rs890497112 2115 dbSNP
rs542546280 2116 dbSNP
rs45495999 2118 dbSNP
rs1038936562 2120 dbSNP
rs1342660235 2127 dbSNP
rs893602681 2127 dbSNP
rs12223 2129 dbSNP
rs1401276726 2130 dbSNP
rs1172984287 2155 dbSNP
rs1311121331 2161 dbSNP
rs1464125740 2163 dbSNP
rs138404099 2169 dbSNP
rs1021236052 2172 dbSNP
rs1473706693 2183 dbSNP
rs545855557 2185 dbSNP
rs1366527814 2191 dbSNP
rs564637981 2199 dbSNP
rs1265576265 2200 dbSNP
rs1357843462 2202 dbSNP
rs1216140608 2205 dbSNP
rs1239615175 2210 dbSNP
rs1196297808 2220 dbSNP
rs902241839 2224 dbSNP
rs1457669858 2238 dbSNP
rs1179688633 2258 dbSNP
rs1273216404 2258 dbSNP
rs528567145 2260 dbSNP
rs1359044100 2263 dbSNP
rs1253013302 2266 dbSNP
rs547617460 2268 dbSNP
rs1282844485 2270 dbSNP
rs1378287849 2281 dbSNP
rs1244497875 2287 dbSNP
rs1378011069 2296 dbSNP
rs565541644 2327 dbSNP
rs1422300989 2330 dbSNP
rs1003742757 2332 dbSNP
rs781587120 2333 dbSNP
rs1399668540 2345 dbSNP
rs1324236251 2346 dbSNP
rs1164333181 2348 dbSNP
rs554505594 2350 dbSNP
rs1034676234 2352 dbSNP
rs1463054799 2360 dbSNP
rs1176422132 2363 dbSNP
rs1438653144 2366 dbSNP
rs1246826469 2367 dbSNP
rs1223101437 2369 dbSNP
rs748195776 2371 dbSNP
rs1288343468 2372 dbSNP
rs1222309706 2377 dbSNP
rs991699725 2387 dbSNP
rs182919904 2392 dbSNP
rs1238281971 2400 dbSNP
rs1466041160 2406 dbSNP
rs1299679568 2409 dbSNP
rs963849708 2412 dbSNP
rs548095601 2413 dbSNP
rs1275563365 2417 dbSNP
rs973585830 2421 dbSNP
rs1348135838 2426 dbSNP
rs1376680929 2428 dbSNP
rs1420186332 2431 dbSNP
rs1362254627 2436 dbSNP
rs1156580720 2452 dbSNP
rs1418765107 2455 dbSNP
rs575947449 2456 dbSNP
rs1192492358 2457 dbSNP
rs569588122 2461 dbSNP
rs1245563748 2470 dbSNP
rs1199354897 2475 dbSNP
rs1488878393 2485 dbSNP
rs28558559 2493 dbSNP
rs1214872754 2494 dbSNP
rs1316610169 2495 dbSNP
rs987552071 2496 dbSNP
rs1221100245 2498 dbSNP
rs1341794200 2502 dbSNP
rs1365614533 2503 dbSNP
rs1274296477 2513 dbSNP
rs1400580235 2526 dbSNP
rs1342269743 2533 dbSNP
rs551873272 2534 dbSNP
rs1038904326 2541 dbSNP
rs1177807261 2562 dbSNP
rs893710931 2578 dbSNP
rs1423893090 2587 dbSNP
rs930348497 2597 dbSNP
rs1048616485 2599 dbSNP
rs1042220369 2616 dbSNP
rs1265954820 2628 dbSNP
rs902377926 2632 dbSNP
rs888673078 2633 dbSNP
rs1003258402 2636 dbSNP
rs45448797 2640 dbSNP
rs1310632568 2654 dbSNP
rs186191751 2673 dbSNP
rs1219315393 2674 dbSNP
rs34402773 2675 dbSNP
rs558553704 2675 dbSNP
rs1181543243 2682 dbSNP
rs1213860610 2684 dbSNP
rs895987270 2688 dbSNP
rs1304329304 2701 dbSNP
rs1014750498 2707 dbSNP
rs397831730 2715 dbSNP
rs774933617 2732 dbSNP
rs1476282577 2733 dbSNP
rs1331503870 2734 dbSNP
rs1044519421 2743 dbSNP
rs1420765309 2745 dbSNP
rs905850206 2746 dbSNP
rs1045598994 2751 dbSNP
rs1428404276 2798 dbSNP
rs1422928809 2800 dbSNP
rs1000220930 2804 dbSNP
rs1466127980 2809 dbSNP
rs1172439757 2814 dbSNP
rs1033029700 2819 dbSNP
rs552989838 2823 dbSNP
rs1465340073 2832 dbSNP
rs1459153047 2834 dbSNP
rs1256181815 2835 dbSNP
rs575098973 2841 dbSNP
rs1010163311 2843 dbSNP
rs1322221565 2846 dbSNP
rs1376926455 2857 dbSNP
rs1019155945 2858 dbSNP
rs965946070 2859 dbSNP
rs950958423 2860 dbSNP
rs571431418 2869 dbSNP
rs974893130 2872 dbSNP
rs1381671646 2880 dbSNP
rs577236806 2883 dbSNP
rs190766195 2884 dbSNP
rs557713866 2891 dbSNP
rs375641331 2894 dbSNP
rs1298336947 2895 dbSNP
rs1461965768 2896 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*