miRTarBase - #MIRT023284 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLC19A2   
Synonyms TC1, THMD1, THT1, THTR1, TRMA
Description solute carrier family 19 member 2
Transcript NM_006996   
Expression
Putative miRNA Targets on SLC19A2
3'UTR of SLC19A2
(miRNA target sites are highlighted)
>SLC19A2|NM_006996|3'UTR
   1 TATACTGCTGAAGGGCTTCTTCTTATAGCAAGAACTCTGCACAGCAACTGCCTGGATGTGTTTGATTTTTTAAAGCGTAG
  81 ACATATATTTATGAATGTGCATTTCTTGACTTCACAGCAGCCACTTGACTAATACCTTGTGTTCCGGGAATAACATGATA
 161 CTATTCAGAGGAGCCAGAAGTAAAGTTTATTTCATGGATTATTTATGAGAGCTAATTTAAGGATGACTTTTTTTCTGATT
 241 CAAAAGTGAACTTGATTTTAAAAACCAGTCAAGAGCAATCAAAGCAGCACATGGTGTTGTATACTTCATTAGCAAGTGAG
 321 TTTGGTGTTTTATAGGTCACATATGTCTGTATCTACTTAGCCAGATGCTTGGCCTGGTGGGACCAGGGCTCCACAGAGGC
 401 CACAAAATGTTGCAAGTCATGATGGATGGAAATATGTTCTAACAGCATCTGCCTCTATTCAATTTAATTCTTATTTCTGT
 481 GTTACTCATGTACATTGGTCTTTCTACATAGTTATTCTATCACTGGCAATATTTGTTCTGGTTTAGTGTTCTGTATTTTA
 561 AGGTGTACGTATCATTTCTAATTTTAAGTTATTTTAAAAAAATTCATCATATGAATGTTCTTGGTTCCCATTGTGACGAT
 641 TATTTATTTCTGTAAAATTTGTTTAGAAGTACGTTTTTGCATTATTCATATGCTTCCCAGAGAAGCTCATTTAGTTAGAA
 721 AATAAGGCAAGTTTTGAAGCCTGCTAAATGAAGAGACTTAAGAAAGCTTAAGGTACGCTTGCTTGTCTTTAAATCTTCAA
 801 TATGAAGGACTATTAATTCCAAGATTAAAAGTTCATATATAGGCTAAAGATGTAACTAGGCCATTTGTATTTGTATTCCC
 881 TTTTATTTCCAAAATAAAATGAAAAATCTTTTTTTAATAATTTCATCCCTATTTATAGTTTTTATATTAATTTGTTTTTC
 961 TTATCCAAGTAAAGATGTCAATAGGAATTGCATTAGTCCAAGGCCTTTTTCATAAACTGAGCCTCTTTTCAATTATTTCA
1041 ATGGGACAGGAACTAGGATAGATGTGATTCCTGCATTTTTTTACCTTAAATCTGCCTTTGTTTCTAAAGGTAGATCATCT
1121 TGAATATTTGCTTAAAATTGCTAGTGATTTCATTACCAAGTTACTTGAAAAAATGTTCTATATGCATTTAATTCTGAAAT
1201 CAGTCTACCAAGGGGCTGCTAGTATATGTCAGACATGAAAACTATTTTAAAGCTGACTTTGTTGCCTTATCTTGAAAAGA
1281 ATCTAGATAGGTGCTTTTAACTGGGGTATTAACTTTTTTAGAATGACACAGCTGAACAGTGTTAATAATAGTGTGTCAAG
1361 ATTGCAAAGTCGACATACTCATTTGGTTTAAGCAGGAATCCTAGAAGCAAATGGATGGGGATAAGAATAGGTCATTTTCT
1441 ATTCACCATCCTTTACTATTAAGGGAAAGGAAAAGAACACTAGCTAAGGAAGGGAAAGGGAAGTGATATCATAAAAGTAG
1521 CAACCTTCATTTTACATTCTGTCTGTTTTTCTTTTTTTGCTTTGTTTTGTTTGTGCTAATTTGGGAATTGTGTACTCCGA
1601 AACAAGTAGAAAAGTGCTGTTTGAGGGATTTTATTAAATCTTTTTTTAATGGAATGTGGTACAAATTGTTCATGTTACCA
1681 AAGCAATATTTCCCTGGAATTTAATTCAAAGTTTGTGGCATACAACCTGAGCCTTTTCTTATATAAGACAAGAATATGTT
1761 CACATCTTGGTATGTGGCCATATTTATAGAATGCTGAACTCAATGTGCAAGTTGTACTGTATGCAGTTTTGTAAATAAGT
1841 GAAAATAATTTGTTGTACTTTTTATTCAATTCTGTATAGATTATAAAATTATTTTTATTAAATAAATATTTTACAGTATA
1921 TTTTCTCTTTTTAATCAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            | | :|||| |:|||:||: 
Target 5' caACCTTCATT-TTACATTCTg 3'
1521 - 1541 131.00 -10.70
2
miRNA  3' guUUGUG----GUAACAGUGUGAGGu 5'
            |:|||    ::|||| |:|||:| 
Target 5' gcAGCACATGGTGTTGT-ATACTTCa 3'
284 - 308 129.00 -14.80
3
miRNA  3' guuuguggUAACAGUGUGAGGu 5'
                  ||||| ::||||| 
Target 5' atttgggaATTGT-GTACTCCg 3'
1579 - 1599 125.00 -12.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
874151 31 ClinVar
874150 51 ClinVar
293520 60 ClinVar
876938 174 ClinVar
293519 255 ClinVar
293518 390 ClinVar
876937 440 ClinVar
293517 627 ClinVar
293516 638 ClinVar
876936 658 ClinVar
293515 713 ClinVar
293514 900 ClinVar
293513 967 ClinVar
875951 1186 ClinVar
875950 1246 ClinVar
875949 1349 ClinVar
875948 1421 ClinVar
293512 1493 ClinVar
293511 1523 ClinVar
293510 1524 ClinVar
875029 1543 ClinVar
293509 1547 ClinVar
293508 1588 ClinVar
293507 1814 ClinVar
293506 1909 ClinVar
875028 1927 ClinVar
875027 1928 ClinVar
COSN30514457 15 COSMIC
COSN30151286 22 COSMIC
COSN8649126 56 COSMIC
COSN30470600 70 COSMIC
COSN30506445 71 COSMIC
COSN30500588 76 COSMIC
COSN31605716 83 COSMIC
COSN30516669 105 COSMIC
COSN30488700 144 COSMIC
COSN30496366 145 COSMIC
COSN17182840 205 COSMIC
COSN8636754 221 COSMIC
COSN31482971 223 COSMIC
COSN31567692 307 COSMIC
COSN31480023 318 COSMIC
COSN9365883 335 COSMIC
COSN31597333 420 COSMIC
COSN7183552 551 COSMIC
COSN17473338 915 COSMIC
COSN28642341 1045 COSMIC
COSN30175635 1235 COSMIC
COSN9365882 1330 COSMIC
COSN25459050 1503 COSMIC
COSN7183551 1528 COSMIC
COSN31568537 1599 COSMIC
COSN20090396 1621 COSMIC
COSN1412351 1780 COSMIC
COSN26643622 1814 COSMIC
COSN31542778 1825 COSMIC
COSN31489099 1867 COSMIC
COSN31528499 1886 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1393813617 2 dbSNP
rs748525459 3 dbSNP
rs745611642 8 dbSNP
rs1381398858 9 dbSNP
rs370695604 20 dbSNP
rs778887209 22 dbSNP
rs562605945 25 dbSNP
rs770711548 26 dbSNP
rs776884481 27 dbSNP
rs777625943 31 dbSNP
rs1323381991 39 dbSNP
rs756212103 46 dbSNP
rs1199512290 48 dbSNP
rs1401663519 49 dbSNP
rs376279404 51 dbSNP
rs928810339 54 dbSNP
rs1475655068 55 dbSNP
rs1411579038 57 dbSNP
rs2678166 60 dbSNP
rs1481844969 64 dbSNP
rs951456169 76 dbSNP
rs116013739 77 dbSNP
rs974015639 78 dbSNP
rs1221409103 80 dbSNP
rs1170934425 86 dbSNP
rs962672003 101 dbSNP
rs1018252600 108 dbSNP
rs1234660780 113 dbSNP
rs1304113396 123 dbSNP
rs879481344 135 dbSNP
rs1007470423 140 dbSNP
rs566226584 141 dbSNP
rs1030126008 143 dbSNP
rs149502153 145 dbSNP
rs902908738 146 dbSNP
rs1041477198 153 dbSNP
rs911621402 155 dbSNP
rs1262721218 168 dbSNP
rs1342007511 169 dbSNP
rs1321720502 170 dbSNP
rs947145817 172 dbSNP
rs892806060 173 dbSNP
rs1439990588 177 dbSNP
rs1483500462 189 dbSNP
rs1392280630 194 dbSNP
rs1055901285 196 dbSNP
rs1478668176 203 dbSNP
rs1194169903 212 dbSNP
rs191990888 226 dbSNP
rs77864015 227 dbSNP
rs79128536 228 dbSNP
rs372805813 230 dbSNP
rs1467924856 235 dbSNP
rs928881638 236 dbSNP
rs1462074263 241 dbSNP
rs1359239917 245 dbSNP
rs562829928 255 dbSNP
rs930158689 277 dbSNP
rs1452507959 286 dbSNP
rs1287613363 290 dbSNP
rs1388141968 305 dbSNP
rs1157142507 320 dbSNP
rs1283075898 328 dbSNP
rs1343812684 332 dbSNP
rs918783817 332 dbSNP
rs747523631 341 dbSNP
rs1221163009 343 dbSNP
rs1421130283 344 dbSNP
rs1409096643 350 dbSNP
rs1191048940 355 dbSNP
rs962806740 364 dbSNP
rs544195919 369 dbSNP
rs1255498612 371 dbSNP
rs973032322 371 dbSNP
rs963276324 372 dbSNP
rs1214982362 382 dbSNP
rs1213794169 386 dbSNP
rs886045528 390 dbSNP
rs953298251 394 dbSNP
rs1017069727 395 dbSNP
rs1489249026 398 dbSNP
rs1217010794 401 dbSNP
rs1012345673 415 dbSNP
rs959449796 420 dbSNP
rs1030676786 430 dbSNP
rs1035032548 435 dbSNP
rs1417974366 443 dbSNP
rs1259656515 459 dbSNP
rs1213145752 462 dbSNP
rs997473478 471 dbSNP
rs1318361256 482 dbSNP
rs1302857731 483 dbSNP
rs1004026015 493 dbSNP
rs1294318019 504 dbSNP
rs1372923326 506 dbSNP
rs967188107 515 dbSNP
rs758543698 517 dbSNP
rs1011324862 523 dbSNP
rs1311588838 535 dbSNP
rs1368665636 538 dbSNP
rs892898484 538 dbSNP
rs1055423300 541 dbSNP
rs1291034019 551 dbSNP
rs1001624959 553 dbSNP
rs907420960 563 dbSNP
rs1305588497 568 dbSNP
rs1480122840 569 dbSNP
rs1441587363 595 dbSNP
rs1046392066 596 dbSNP
rs1287203728 603 dbSNP
rs1455537983 612 dbSNP
rs746004427 617 dbSNP
rs886045527 627 dbSNP
rs529146231 628 dbSNP
rs1439849443 629 dbSNP
rs1163495320 631 dbSNP
rs1383980669 635 dbSNP
rs779167856 637 dbSNP
rs757466309 638 dbSNP
rs1354108807 639 dbSNP
rs943146095 650 dbSNP
rs1038511649 658 dbSNP
rs890217993 664 dbSNP
rs1051546162 666 dbSNP
rs572118017 671 dbSNP
rs1449413080 672 dbSNP
rs1260355633 673 dbSNP
rs1184324808 686 dbSNP
rs911314340 687 dbSNP
rs985449599 688 dbSNP
rs543041681 690 dbSNP
rs1306493708 691 dbSNP
rs922653724 701 dbSNP
rs1196363678 704 dbSNP
rs1260993570 709 dbSNP
rs886045526 713 dbSNP
rs187199406 716 dbSNP
rs1236194178 724 dbSNP
rs1282228230 744 dbSNP
rs967323847 747 dbSNP
rs1164140460 757 dbSNP
rs578039543 762 dbSNP
rs973448753 767 dbSNP
rs1325789314 771 dbSNP
rs1020094257 776 dbSNP
rs941638805 777 dbSNP
rs1293507921 793 dbSNP
rs1384045716 800 dbSNP
rs1011415460 819 dbSNP
rs1362885471 820 dbSNP
rs1312457606 823 dbSNP
rs910096226 824 dbSNP
rs112286287 825 dbSNP
rs957084382 828 dbSNP
rs554293594 837 dbSNP
rs1034525067 850 dbSNP
rs1450141830 856 dbSNP
rs990954337 858 dbSNP
rs1360997010 859 dbSNP
rs1216625025 860 dbSNP
rs1001321069 879 dbSNP
rs1035146321 889 dbSNP
rs886045525 900 dbSNP
rs1275913611 907 dbSNP
rs906843557 912 dbSNP
rs1444572171 915 dbSNP
rs1174665303 916 dbSNP
rs545614174 926 dbSNP
rs1242101229 937 dbSNP
rs1461918866 945 dbSNP
rs1196348409 946 dbSNP
rs1424554887 949 dbSNP
rs764555028 966 dbSNP
rs16862199 967 dbSNP
rs556680908 973 dbSNP
rs994369905 979 dbSNP
rs1167671986 981 dbSNP
rs1429812954 983 dbSNP
rs1261852339 997 dbSNP
rs897415737 1003 dbSNP
rs1344577673 1005 dbSNP
rs753015280 1011 dbSNP
rs1038479954 1012 dbSNP
rs754840404 1019 dbSNP
rs1340688654 1021 dbSNP
rs1484492815 1022 dbSNP
rs1259272032 1032 dbSNP
rs1011303145 1037 dbSNP
rs1200580761 1041 dbSNP
rs1284140110 1053 dbSNP
rs1487612103 1063 dbSNP
rs911424164 1064 dbSNP
rs1338645008 1074 dbSNP
rs1206017924 1076 dbSNP
rs1249588802 1078 dbSNP
rs1197012438 1083 dbSNP
rs1229561397 1083 dbSNP
rs1379641065 1095 dbSNP
rs1478379642 1096 dbSNP
rs1050255733 1101 dbSNP
rs934133379 1113 dbSNP
rs1417805486 1123 dbSNP
rs1299740602 1128 dbSNP
rs1308106766 1140 dbSNP
rs1386060991 1152 dbSNP
rs1321148381 1157 dbSNP
rs1017501066 1158 dbSNP
rs535577313 1161 dbSNP
rs1278467192 1164 dbSNP
rs1352071947 1175 dbSNP
rs1242954635 1177 dbSNP
rs1231614762 1181 dbSNP
rs922589020 1186 dbSNP
rs1313853506 1197 dbSNP
rs751510425 1201 dbSNP
rs1490282687 1207 dbSNP
rs1208472351 1219 dbSNP
rs1391226372 1224 dbSNP
rs1269687996 1235 dbSNP
rs1052019673 1236 dbSNP
rs1181109478 1242 dbSNP
rs759676560 1245 dbSNP
rs181914254 1246 dbSNP
rs1313168545 1264 dbSNP
rs1037373622 1265 dbSNP
rs189219624 1271 dbSNP
rs1457187870 1273 dbSNP
rs557147631 1279 dbSNP
rs772636197 1291 dbSNP
rs913170054 1299 dbSNP
rs1163586664 1313 dbSNP
rs1392371559 1314 dbSNP
rs989951177 1315 dbSNP
rs1419642775 1320 dbSNP
rs1330007535 1321 dbSNP
rs957417037 1334 dbSNP
rs556203557 1337 dbSNP
rs980255864 1347 dbSNP
rs1243007577 1359 dbSNP
rs1267624277 1367 dbSNP
rs971204017 1369 dbSNP
rs184461354 1371 dbSNP
rs993813990 1372 dbSNP
rs938245219 1374 dbSNP
rs897384353 1375 dbSNP
rs1197430300 1378 dbSNP
rs1017128346 1382 dbSNP
rs575277340 1385 dbSNP
rs1480923041 1396 dbSNP
rs554988505 1416 dbSNP
rs74121673 1421 dbSNP
rs868440233 1423 dbSNP
rs889952001 1430 dbSNP
rs982661350 1431 dbSNP
rs566263903 1441 dbSNP
rs1238638135 1448 dbSNP
rs1021419018 1450 dbSNP
rs1379014856 1456 dbSNP
rs551167128 1458 dbSNP
rs934036364 1477 dbSNP
rs989505584 1478 dbSNP
rs1341437228 1489 dbSNP
rs1218459361 1492 dbSNP
rs886045524 1493 dbSNP
rs1309620434 1498 dbSNP
rs958059254 1503 dbSNP
rs901258549 1506 dbSNP
rs1392410256 1509 dbSNP
rs1199294216 1511 dbSNP
rs1042387060 1514 dbSNP
rs886045523 1523 dbSNP
rs79478264 1524 dbSNP
rs1007510450 1531 dbSNP
rs1459451923 1539 dbSNP
rs1396073162 1540 dbSNP
rs1424145343 1541 dbSNP
rs79893694 1542 dbSNP
rs886045522 1547 dbSNP
rs568966897 1551 dbSNP
rs372669561 1559 dbSNP
rs1361783731 1561 dbSNP
rs1478606542 1568 dbSNP
rs1170697562 1573 dbSNP
rs1183810594 1581 dbSNP
rs886045521 1588 dbSNP
rs1440225642 1592 dbSNP
rs915271488 1598 dbSNP
rs764896791 1599 dbSNP
rs541789066 1607 dbSNP
rs150793931 1614 dbSNP
rs1399737038 1615 dbSNP
rs927110661 1633 dbSNP
rs1342541643 1640 dbSNP
rs979966989 1642 dbSNP
rs971531760 1645 dbSNP
rs1235565289 1657 dbSNP
rs894166580 1667 dbSNP
rs1055376429 1671 dbSNP
rs1204714452 1672 dbSNP
rs1024022105 1673 dbSNP
rs1215552336 1685 dbSNP
rs972485137 1692 dbSNP
rs1260776696 1720 dbSNP
rs1489189777 1725 dbSNP
rs961010604 1731 dbSNP
rs1348816250 1732 dbSNP
rs536850703 1739 dbSNP
rs1262857385 1743 dbSNP
rs770797020 1750 dbSNP
rs1240280757 1764 dbSNP
rs1370868535 1780 dbSNP
rs537870709 1792 dbSNP
rs938281333 1792 dbSNP
rs181359517 1802 dbSNP
rs1378665157 1803 dbSNP
rs12091844 1814 dbSNP
rs1372468627 1815 dbSNP
rs945503116 1819 dbSNP
rs1401050376 1820 dbSNP
rs543080574 1821 dbSNP
rs1028872627 1825 dbSNP
rs1365796933 1831 dbSNP
rs914067127 1851 dbSNP
rs998381007 1856 dbSNP
rs901228518 1857 dbSNP
rs1399754225 1867 dbSNP
rs1348420274 1876 dbSNP
rs1239338007 1877 dbSNP
rs990010418 1879 dbSNP
rs1216288866 1880 dbSNP
rs1245725860 1890 dbSNP
rs1299795718 1894 dbSNP
rs1192366546 1896 dbSNP
rs1042480823 1900 dbSNP
rs910568915 1902 dbSNP
rs1160067049 1908 dbSNP
rs745730912 1909 dbSNP
rs945465581 1917 dbSNP
rs1382750853 1918 dbSNP
rs1420651086 1919 dbSNP
rs1394280995 1924 dbSNP
rs527666245 1925 dbSNP
rs776987873 1928 dbSNP
rs1455540756 1929 dbSNP
rs1247294992 1933 dbSNP
rs1438885159 1938 dbSNP
rs1294412728 1941 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*