miRTarBase - #MIRT023282 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol B4GALT1   
Synonyms B4GAL-T1, CDG2D, GGTB2, GT1, GTB, beta4Gal-T1
Description beta-1,4-galactosyltransferase 1
Transcript NM_001497   
Expression
Putative miRNA Targets on B4GALT1
3'UTR of B4GALT1
(miRNA target sites are highlighted)
>B4GALT1|NM_001497|3'UTR
   1 CGTTTTGGTACACGGATAAGAGACCTGAAATTAGCCAGGGACCTCTGCTGTGTGTCTCTGCCAATCTGCTGGGCTGGTCC
  81 CTCTCATTTTTACCAGTCTGAGTGACAGGTCCCCTTCGCTCATCATTCAGATGGCTTTCCAGATGACCAGGACGAGTGGG
 161 ATATTTTGCCCCCAACTTGGCTCGGCATGTGAATTCTTAGCTCTGCAAGGTGTTTATGCCTTTGCGGGTTTCTTGATGTG
 241 TTCGCAGTGTCACCCCAGAGTCAGAACTGTACACATCCCAAAATTTGGTGGCCGTGGAACACATTCCCGGTGATAGAATT
 321 GCTAAATTGTCGTGAAATAGGTTAGAATTTTTCTTTAAATTATGGTTTTCTTATTCGTGAAAATTCGGAGAGTGCTGCTA
 401 AAATTGGATTGGTGTGATCTTTTTGGTAGTTGTAATTTAACAGAAAAACACAAAATTTCAACCATTCTTAATGTTACGTC
 481 CTCCCCCCACCCCCTTCTTTCAGTGGTATGCAACCACTGCAATCACTGTGCATATGTCTTTTCTTAGCAAAAGGATTTTA
 561 AAACTTGAGCCCTGGACCTTTTGTCCTATGTGTGTGGATTCCAGGGCAACTCTAGCATCAGAGCAAAAGCCTTGGGTTTC
 641 TCGCATTCAGTGGCCTATCTCCAGATTGTCTGATTTCTGAATGTAAAGTTGTTGTGTTTTTTTTTAAATAGTAGTTTGTA
 721 GTATTTTAAAGAAAGAACAGATCGAGTTCTAATTATGATCTAGCTTGATTTTGTGTTGATCCAAATTTGCATAGCTGTTT
 801 AATGTTAAGTCATGACAATTTATTTTTCTTGGCATGCTATGTAAACTTGAATTTCCTATGTATTTTTATTGTGGTGTTTT
 881 AAATATGGGGAGGGGTATTGAGCATTTTTTAGGGAGAAAAATAAATATATGCTGTAGTGGCCACAAATAGGCCTATGATT
 961 TAGCTGGCAGGCCAGGTTTTCTCAAGAGCAAAATCACCCTCTGGCCCCTTGGCAGGTAAGGCCTCCCGGTCAGCATTATC
1041 CTGCCAGACCTCGGGGAGGATACCTGGGAGACAGAAGCCTCTGCACCTACTGTGCAGAACTCTCCACTTCCCCAACCCTC
1121 CCCAGGTGGGCAGGGCGGAGGGAGCCTCAGCCTCCTTAGACTGACCCCTCAGGCCCCTAGGCTGGGGGGTTGTAAATAAC
1201 AGCAGTCAGGTTGTTTACCAGCCCTTTGCACCTCCCCAGGCAGAGGGAGCCTCTGTTCTGGTGGGGGCCACCTCCCTCAG
1281 AGGCTCTGCTAGCCACACTCCGTGGCCCACCCTTTGTTACCAGTTCTTCCTCCTTCCTCTTTTCCCCTGCCTTTCTCATT
1361 CCTTCCTTCGTCTCCCTTTTTGTTCCTTTGCCTCTTGCCTGTCCCCTAAAACTTGACTGTGGCACTCAGGGTCAAACAGA
1441 CTATCCATTCCCCAGCATGAATGTGCCTTTTAATTAGTGATCTAGAAAGAAGTTCAGCCGAACCCACACCCCAACTCCCT
1521 CCCAAGAACTTCGGTGCCTAAAGCCTCCTGTTCCACCTCAGGTTTTCACAGGTGCTCCCACCCCAGTTGAGGCTCCCACC
1601 CACAGGGCTGTCTGTCACAAACCCACCTCTGTTGGGAGCTATTGAGCCACCTGGGATGAGATGACACAAGGCACTCCTAC
1681 CACTGAGCGCCTTTGCCAGGTCCAGCCTGGGCTCAGGTTCCAAGACTCAGCTGCCTAATCCCAGGGTTGAGCCTTGTGCT
1761 CGTGGCGGACCCCAAACCACTGCCCTCCTGGGTACCAGCCCTCAGTGTGGAGGCTGAGCTGGTGCCTGGCCCCAGTCTTA
1841 TCTGTGCCTTTACTGCTTTGCGCATCTCAGATGCTAACTTGGTTCTTTTTCCAGAAGCCTTTGTATTGGTTAAAAATTAT
1921 TTTCCATTGCAGAAGCAGCTGGACTATGCAAAAAGTATTTCTCTGTCAGTTCCCCACTCTATACCAAGGATATTATTAAA
2001 ACTAGAAATGACTGCATTGAGAGGGAGTTGTGGGAAATAAGAAGAATGAAAGCCTCTCTTTCTGTCCGCAGATCCTGACT
2081 TTTCCAAAGTGCCTTAAAAGAAATCAGACAAATGCCCTGAGTGGTAACTTCTGTGTTATTTTACTCTTAAAACCAAACTC
2161 TACCTTTTCTTGTTGTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGTTACCTTCTCATTCATGTCAAGTATGTGGTTCATT
2241 CTTAGAACCAAGGGAAATACTGCTCCCCCCATTTGCTGACGTAGTGCTCTCATGGGCTCACCTGGGCCCAAGGCACAGCC
2321 AGGGCACAGTTAGGCCTGGATGTTTGCCTGGTCCGTGAGATGCCGCGGGTCCTGTTTCCTTACTGGGGATTTCAGGGCTG
2401 GGGGTTCAGGGAGCATTTCCTTTTCCTGGGAGTTATGACCGCGAAGTTGTCATGTGCCGTGCCCTTTTCTGTTTCTGTGT
2481 ATCCTATTGCTGGTGACTCTGTGTGAACTGGCCTTTGGGAAAGATCAGAGAGGGCAGAGGTGGCACAGGACAGTAAAGGA
2561 GATGCTGTGCTGGCCTTCAGCCTGGACAGGGTCTCTGCTGACTGCCAGGGGCGGGGGCTCTGCATAGCCAGGATGACGGC
2641 TTTCATGTCCCAGAGACCTGTTGTGCTGTGTATTTTGATTTCCTGTGTATGCAAATGTGTGTATTTACCATTGTGTAGGG
2721 GGCTGTGTCTGATCTTGGTGTTCAAAACAGAACTGTATTTTTGCCTTTAAAATTAAATAATATAACGTGAATAAATGACC
2801 CTATCTTTGTAACAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGU-AACAGUGUGAGGu 5'
            ::| |:: | | |||||||| 
Target 5' gaGGCTCTGCTAGCCACACTCCg 3'
1280 - 1302 152.00 -16.90
2
miRNA  3' guuugUGGUAAC-AGUGUGAGGu 5'
               :||:| |  ||||:||| 
Target 5' tggtgGCCGTGGAACACATTCCc 3'
286 - 308 137.00 -15.20
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            :|||| |  |  :|||||| 
Target 5' atGACACAA--G--GCACTCCt 3'
1661 - 1678 132.00 -11.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1199111 154 ClinVar
366641 706 ClinVar
366639 714 ClinVar
366638 738 ClinVar
366631 1088 ClinVar
366623 1676 ClinVar
366620 1874 ClinVar
366619 1891 ClinVar
366615 2177 ClinVar
366614 2178 ClinVar
366612 2204 ClinVar
366608 2399 ClinVar
366600 2718 ClinVar
COSN30496663 2 COSMIC
COSN20887155 9 COSMIC
COSN30178966 15 COSMIC
COSN30533689 34 COSMIC
COSN31508292 39 COSMIC
COSN30457252 56 COSMIC
COSN24394558 68 COSMIC
COSN30166427 85 COSMIC
COSN31555953 118 COSMIC
COSN19770563 130 COSMIC
COSN31588303 190 COSMIC
COSN31543065 260 COSMIC
COSN19658336 331 COSMIC
COSN30174987 371 COSMIC
COSN31534493 390 COSMIC
COSN4889322 403 COSMIC
COSN30172446 411 COSMIC
COSN31565368 419 COSMIC
COSN1377964 434 COSMIC
COSN5703063 444 COSMIC
COSN22742768 449 COSMIC
COSN31547537 454 COSMIC
COSN26635508 485 COSMIC
COSN30173418 567 COSMIC
COSN30540892 612 COSMIC
COSN31527922 626 COSMIC
COSN26640337 706 COSMIC
COSN23475861 714 COSMIC
COSN31538440 718 COSMIC
COSN31527924 724 COSMIC
COSN31537520 744 COSMIC
COSN31537804 761 COSMIC
COSN31520742 821 COSMIC
COSN21198951 828 COSMIC
COSN31552196 856 COSMIC
COSN31549571 946 COSMIC
COSN30169257 949 COSMIC
COSN28380604 953 COSMIC
COSN14935278 1087 COSMIC
COSN31530907 1335 COSMIC
COSN23550605 1519 COSMIC
COSN17182110 1521 COSMIC
COSN31489564 1532 COSMIC
COSN25773113 1641 COSMIC
COSN28676564 1664 COSMIC
COSN31484716 1728 COSMIC
COSN31521586 1767 COSMIC
COSN6603965 1767 COSMIC
COSN24303022 1808 COSMIC
COSN31552541 1862 COSMIC
COSN28703208 2041 COSMIC
COSN25435399 2176 COSMIC
COSN9282701 2185 COSMIC
COSN31588182 2260 COSMIC
COSN4889321 2283 COSMIC
COSN28662780 2317 COSMIC
COSN31540928 2319 COSMIC
COSN20878246 2386 COSMIC
COSN2507049 2403 COSMIC
COSN31545930 2436 COSMIC
COSN9710733 2635 COSMIC
COSN18983813 2697 COSMIC
COSN2322320 2755 COSMIC
rs7019909 130 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs767768449 1 dbSNP
rs774770478 2 dbSNP
rs377742682 3 dbSNP
rs764400945 5 dbSNP
rs763374161 13 dbSNP
rs537402869 14 dbSNP
rs1169760574 15 dbSNP
rs374328236 16 dbSNP
rs571848514 25 dbSNP
rs1276344427 28 dbSNP
rs1225115638 32 dbSNP
rs1323938144 34 dbSNP
rs771875889 38 dbSNP
rs1202594097 41 dbSNP
rs1020457484 43 dbSNP
rs1483933713 45 dbSNP
rs369256675 46 dbSNP
rs1184317810 50 dbSNP
rs778858783 50 dbSNP
rs202081755 51 dbSNP
rs530256316 56 dbSNP
rs909287528 62 dbSNP
rs1176230045 64 dbSNP
rs1173483960 86 dbSNP
rs757496621 93 dbSNP
rs1469649036 109 dbSNP
rs985399192 117 dbSNP
rs1431778217 118 dbSNP
rs181556643 121 dbSNP
rs1026570828 123 dbSNP
rs1361181395 124 dbSNP
rs1428721743 127 dbSNP
rs7019909 130 dbSNP
rs1362761035 132 dbSNP
rs1382660523 134 dbSNP
rs759202880 142 dbSNP
rs907493787 144 dbSNP
rs1469712414 147 dbSNP
rs149800125 153 dbSNP
rs140867747 154 dbSNP
rs1461987506 160 dbSNP
rs147243611 169 dbSNP
rs1262738862 175 dbSNP
rs1196434366 180 dbSNP
rs72720992 183 dbSNP
rs569375888 184 dbSNP
rs1427707721 185 dbSNP
rs113541188 187 dbSNP
rs1318473472 194 dbSNP
rs931131003 202 dbSNP
rs549373637 207 dbSNP
rs1021370743 210 dbSNP
rs1345818930 211 dbSNP
rs561534035 219 dbSNP
rs1223097332 220 dbSNP
rs1370561608 225 dbSNP
rs143871976 226 dbSNP
rs777622118 243 dbSNP
rs891591306 244 dbSNP
rs542029937 247 dbSNP
rs541306145 249 dbSNP
rs886063873 251 dbSNP
rs1052976821 255 dbSNP
rs7019896 256 dbSNP
rs1464884570 258 dbSNP
rs561943265 262 dbSNP
rs901751832 264 dbSNP
rs986446525 266 dbSNP
rs140170339 268 dbSNP
rs1176800778 272 dbSNP
rs1020004878 274 dbSNP
rs1441609440 277 dbSNP
rs190558555 286 dbSNP
rs1365041009 287 dbSNP
rs1423874432 290 dbSNP
rs1324160947 293 dbSNP
rs957133647 294 dbSNP
rs1439812965 296 dbSNP
rs1034514477 308 dbSNP
rs57903353 309 dbSNP
rs543881966 311 dbSNP
rs1049105472 315 dbSNP
rs41274023 316 dbSNP
rs907418686 318 dbSNP
rs1018 323 dbSNP
rs869 331 dbSNP
rs992309306 332 dbSNP
rs1436413298 334 dbSNP
rs1204339561 341 dbSNP
rs1486739669 348 dbSNP
rs1459206538 357 dbSNP
rs1181992403 369 dbSNP
rs1384643153 375 dbSNP
rs535304342 377 dbSNP
rs1285860020 381 dbSNP
rs1445357691 382 dbSNP
rs41274021 383 dbSNP
rs10971412 386 dbSNP
rs980213146 387 dbSNP
rs969710415 394 dbSNP
rs1400771844 395 dbSNP
rs1246123190 397 dbSNP
rs930702492 400 dbSNP
rs1021798611 406 dbSNP
rs1358052208 409 dbSNP
rs1334324996 410 dbSNP
rs1381367019 412 dbSNP
rs41274019 414 dbSNP
rs1383497840 418 dbSNP
rs1286457504 425 dbSNP
rs1338091797 426 dbSNP
rs1214504202 429 dbSNP
rs1259043405 430 dbSNP
rs1320481841 431 dbSNP
rs1201974626 439 dbSNP
rs148351595 453 dbSNP
rs569460810 454 dbSNP
rs1430446512 461 dbSNP
rs1359240201 462 dbSNP
rs143366665 477 dbSNP
rs750880059 477 dbSNP
rs901804073 478 dbSNP
rs1165987040 481 dbSNP
rs1467030107 487 dbSNP
rs1173790177 488 dbSNP
rs1404979712 489 dbSNP
rs1414542181 492 dbSNP
rs181621586 493 dbSNP
rs967349862 495 dbSNP
rs878951274 500 dbSNP
rs768154677 505 dbSNP
rs1162966924 508 dbSNP
rs767254817 516 dbSNP
rs532823850 522 dbSNP
rs1262675930 535 dbSNP
rs1262744786 536 dbSNP
rs1345894879 549 dbSNP
rs912873619 553 dbSNP
rs887750583 558 dbSNP
rs1487167047 561 dbSNP
rs989871701 563 dbSNP
rs1192818981 569 dbSNP
rs767972737 569 dbSNP
rs577696308 581 dbSNP
rs555971971 588 dbSNP
rs570405801 592 dbSNP
rs1056680108 594 dbSNP
rs1223069630 597 dbSNP
rs547053456 601 dbSNP
rs1263095107 611 dbSNP
rs926863439 615 dbSNP
rs981011210 619 dbSNP
rs1173992263 624 dbSNP
rs970139373 628 dbSNP
rs914217014 636 dbSNP
rs1228968390 638 dbSNP
rs189274653 642 dbSNP
rs955820156 643 dbSNP
rs1031377257 648 dbSNP
rs971573064 649 dbSNP
rs562412427 651 dbSNP
rs997346003 654 dbSNP
rs1403639769 668 dbSNP
rs1282971533 669 dbSNP
rs1024530433 671 dbSNP
rs1294381002 673 dbSNP
rs1235637062 679 dbSNP
rs149481193 690 dbSNP
rs1350023351 691 dbSNP
rs1217516149 692 dbSNP
rs1338850844 694 dbSNP
rs1305515527 696 dbSNP
rs185861239 705 dbSNP
rs779761525 706 dbSNP
rs886063872 706 dbSNP
rs1266351011 708 dbSNP
rs1017947758 709 dbSNP
rs762311151 711 dbSNP
rs886063871 714 dbSNP
rs1200521204 718 dbSNP
rs1361761049 729 dbSNP
rs537888935 738 dbSNP
rs1463567388 739 dbSNP
rs1007449052 741 dbSNP
rs1169958991 742 dbSNP
rs887673017 743 dbSNP
rs1158651915 744 dbSNP
rs1381636376 747 dbSNP
rs1423232554 749 dbSNP
rs1303108840 755 dbSNP
rs776922607 756 dbSNP
rs900557962 759 dbSNP
rs531529824 763 dbSNP
rs1335470916 764 dbSNP
rs1241157580 773 dbSNP
rs1311483101 793 dbSNP
rs1357399833 801 dbSNP
rs993897011 809 dbSNP
rs897950332 811 dbSNP
rs1056522106 813 dbSNP
rs942510129 818 dbSNP
rs563811595 820 dbSNP
rs1480107091 821 dbSNP
rs939506613 822 dbSNP
rs905329846 823 dbSNP
rs16918999 829 dbSNP
rs947015726 831 dbSNP
rs137953955 832 dbSNP
rs915468428 837 dbSNP
rs989868209 858 dbSNP
rs764473672 868 dbSNP
rs1396245447 872 dbSNP
rs145214286 873 dbSNP
rs41316025 879 dbSNP
rs1380637670 885 dbSNP
rs971165035 888 dbSNP
rs1299775690 893 dbSNP
rs1393244224 895 dbSNP
rs1246916490 897 dbSNP
rs1249349071 903 dbSNP
rs975772091 906 dbSNP
rs965863788 913 dbSNP
rs983675797 924 dbSNP
rs886063870 925 dbSNP
rs1459584661 929 dbSNP
rs1162864921 951 dbSNP
rs951023277 955 dbSNP
rs1256253699 957 dbSNP
rs776466184 964 dbSNP
rs1408567970 965 dbSNP
rs1176963428 972 dbSNP
rs1479975885 982 dbSNP
rs1423308483 983 dbSNP
rs1375898326 986 dbSNP
rs1466506515 991 dbSNP
rs1017414877 994 dbSNP
rs757663178 999 dbSNP
rs76703260 1005 dbSNP
rs1249145171 1006 dbSNP
rs1303441871 1007 dbSNP
rs1397671305 1008 dbSNP
rs1176404378 1010 dbSNP
rs1339568203 1012 dbSNP
rs41274017 1014 dbSNP
rs900524876 1021 dbSNP
rs1320894580 1024 dbSNP
rs375458325 1027 dbSNP
rs535693848 1028 dbSNP
rs897793583 1032 dbSNP
rs569899973 1038 dbSNP
rs760321607 1053 dbSNP
rs1035114852 1054 dbSNP
rs1478350455 1064 dbSNP
rs375455006 1080 dbSNP
rs1344700113 1081 dbSNP
rs1427654421 1084 dbSNP
rs905255636 1086 dbSNP
rs753854896 1088 dbSNP
rs1045267424 1089 dbSNP
rs1241728288 1090 dbSNP
rs1360932887 1094 dbSNP
rs946869093 1107 dbSNP
rs1451778140 1111 dbSNP
rs1296251627 1119 dbSNP
rs146744987 1122 dbSNP
rs1308702065 1136 dbSNP
rs1053078929 1149 dbSNP
rs1343435909 1152 dbSNP
rs934337448 1154 dbSNP
rs180823182 1155 dbSNP
rs1313418021 1164 dbSNP
rs1385321278 1165 dbSNP
rs924251328 1166 dbSNP
rs975822912 1170 dbSNP
rs1337602244 1171 dbSNP
rs1469130639 1179 dbSNP
rs944487572 1183 dbSNP
rs551622189 1185 dbSNP
rs771909430 1186 dbSNP
rs935623998 1187 dbSNP
rs1417401302 1190 dbSNP
rs926932396 1190 dbSNP
rs547381574 1210 dbSNP
rs1363155358 1212 dbSNP
rs986019722 1221 dbSNP
rs1420183955 1231 dbSNP
rs1299998364 1234 dbSNP
rs949776952 1236 dbSNP
rs1435560887 1237 dbSNP
rs951931183 1243 dbSNP
rs1243405288 1247 dbSNP
rs1293741151 1248 dbSNP
rs917038137 1260 dbSNP
rs1182544158 1264 dbSNP
rs983989529 1265 dbSNP
rs1263053859 1266 dbSNP
rs950933954 1267 dbSNP
rs878970707 1269 dbSNP
rs533509723 1271 dbSNP
rs1321476955 1277 dbSNP
rs1222852317 1287 dbSNP
rs1248829760 1291 dbSNP
rs568413248 1293 dbSNP
rs1178287439 1298 dbSNP
rs1238827304 1299 dbSNP
rs189592532 1301 dbSNP
rs1160362302 1302 dbSNP
rs1411613322 1308 dbSNP
rs964956386 1319 dbSNP
rs886063869 1327 dbSNP
rs886063868 1332 dbSNP
rs1444067320 1334 dbSNP
rs886063867 1337 dbSNP
rs1017556568 1340 dbSNP
rs1376960064 1341 dbSNP
rs962054740 1347 dbSNP
rs1282935316 1350 dbSNP
rs1356186145 1355 dbSNP
rs1352108524 1357 dbSNP
rs1285901285 1359 dbSNP
rs1306160821 1359 dbSNP
rs778604135 1369 dbSNP
rs150168782 1370 dbSNP
rs1459135868 1372 dbSNP
rs1181897052 1373 dbSNP
rs1236988682 1374 dbSNP
rs562648583 1380 dbSNP
rs1316023746 1384 dbSNP
rs1415654005 1386 dbSNP
rs867596198 1387 dbSNP
rs1338493468 1398 dbSNP
rs1400659626 1401 dbSNP
rs1010460454 1403 dbSNP
rs1449352527 1405 dbSNP
rs1320123728 1409 dbSNP
rs891638705 1412 dbSNP
rs1338875561 1416 dbSNP
rs969536906 1422 dbSNP
rs1024138153 1440 dbSNP
rs1320196550 1441 dbSNP
rs552058659 1446 dbSNP
rs1011078801 1451 dbSNP
rs1198969957 1456 dbSNP
rs533482397 1457 dbSNP
rs564383128 1461 dbSNP
rs1210695947 1463 dbSNP
rs1044074125 1468 dbSNP
rs1385247082 1483 dbSNP
rs1052650394 1484 dbSNP
rs999709603 1488 dbSNP
rs41303661 1499 dbSNP
rs56800565 1500 dbSNP
rs944368064 1501 dbSNP
rs548121061 1506 dbSNP
rs1047488808 1510 dbSNP
rs562079950 1514 dbSNP
rs542096432 1516 dbSNP
rs1399938960 1524 dbSNP
rs973581935 1530 dbSNP
rs964923582 1532 dbSNP
rs1050563933 1533 dbSNP
rs1231297026 1539 dbSNP
rs780311179 1544 dbSNP
rs191562209 1545 dbSNP
rs1283975601 1550 dbSNP
rs1490865127 1554 dbSNP
rs1263582638 1557 dbSNP
rs1448565811 1577 dbSNP
rs1196280815 1579 dbSNP
rs1376773886 1584 dbSNP
rs1478068163 1585 dbSNP
rs1292507867 1586 dbSNP
rs1173753413 1594 dbSNP
rs1377970066 1599 dbSNP
rs1419583494 1600 dbSNP
rs987394990 1609 dbSNP
rs1354589308 1610 dbSNP
rs920398173 1612 dbSNP
rs1385506515 1613 dbSNP
rs556356971 1628 dbSNP
rs1323130904 1634 dbSNP
rs1331826642 1640 dbSNP
rs971870718 1641 dbSNP
rs1438890297 1643 dbSNP
rs961982052 1652 dbSNP
rs16918998 1664 dbSNP
rs1239303459 1672 dbSNP
rs113144091 1676 dbSNP
rs1352558246 1676 dbSNP
rs1207911920 1677 dbSNP
rs1266415816 1678 dbSNP
rs1451763524 1681 dbSNP
rs576876668 1687 dbSNP
rs17326539 1688 dbSNP
rs1366109684 1689 dbSNP
rs1159767935 1690 dbSNP
rs1322369245 1696 dbSNP
rs1032840532 1697 dbSNP
rs1398234149 1702 dbSNP
rs757723914 1709 dbSNP
rs1023730028 1712 dbSNP
rs1168096401 1717 dbSNP
rs905743531 1718 dbSNP
rs1423290687 1723 dbSNP
rs1011380108 1724 dbSNP
rs17247945 1738 dbSNP
rs886063866 1751 dbSNP
rs1481744561 1753 dbSNP
rs1309882561 1760 dbSNP
rs1031154035 1761 dbSNP
rs1270221443 1763 dbSNP
rs17326497 1766 dbSNP
rs901471912 1767 dbSNP
rs867937924 1778 dbSNP
rs1449912159 1779 dbSNP
rs1255824261 1781 dbSNP
rs1456923975 1782 dbSNP
rs1178642428 1784 dbSNP
rs1252062579 1785 dbSNP
rs1275407098 1788 dbSNP
rs1008570797 1791 dbSNP
rs1463393133 1797 dbSNP
rs888749134 1805 dbSNP
rs1050201011 1807 dbSNP
rs943544271 1818 dbSNP
rs930411221 1834 dbSNP
rs1400187539 1835 dbSNP
rs528782588 1840 dbSNP
rs1311981484 1841 dbSNP
rs1036232682 1847 dbSNP
rs1225100528 1860 dbSNP
rs187075558 1861 dbSNP
rs955158465 1862 dbSNP
rs1316849462 1871 dbSNP
rs886063865 1874 dbSNP
rs1198904315 1888 dbSNP
rs3841451 1891 dbSNP
rs913885804 1893 dbSNP
rs927871021 1898 dbSNP
rs1257559048 1905 dbSNP
rs981993234 1909 dbSNP
rs376719802 1910 dbSNP
rs969429731 1912 dbSNP
rs1423372741 1918 dbSNP
rs1478244230 1920 dbSNP
rs1172856076 1924 dbSNP
rs916545028 1936 dbSNP
rs1465657627 1941 dbSNP
rs1302187876 1942 dbSNP
rs1329144530 1949 dbSNP
rs1464719171 1955 dbSNP
rs989479490 1958 dbSNP
rs1397670958 1968 dbSNP
rs1339626676 1972 dbSNP
rs371446418 1975 dbSNP
rs753100140 1982 dbSNP
rs958138287 1984 dbSNP
rs1231981741 1995 dbSNP
rs1256079744 2001 dbSNP
rs1426540164 2016 dbSNP
rs1803717 2021 dbSNP
rs763928825 2022 dbSNP
rs1191087624 2023 dbSNP
rs1477087146 2024 dbSNP
rs1215116831 2026 dbSNP
rs767384487 2035 dbSNP
rs1488848980 2038 dbSNP
rs78409522 2041 dbSNP
rs527240435 2044 dbSNP
rs978550562 2047 dbSNP
rs978231896 2062 dbSNP
rs1176805091 2064 dbSNP
rs965484177 2066 dbSNP
rs532160095 2067 dbSNP
rs564649137 2068 dbSNP
rs1019836635 2070 dbSNP
rs1156818230 2074 dbSNP
rs184203621 2079 dbSNP
rs1323940944 2103 dbSNP
rs16918997 2104 dbSNP
rs1217349858 2115 dbSNP
rs1374884964 2122 dbSNP
rs1301300153 2125 dbSNP
rs895763052 2126 dbSNP
rs1445389802 2131 dbSNP
rs561769709 2133 dbSNP
rs1338261781 2135 dbSNP
rs1454948786 2138 dbSNP
rs1360047961 2143 dbSNP
rs1175978373 2144 dbSNP
rs1413328933 2146 dbSNP
rs1025972509 2147 dbSNP
rs1410783049 2160 dbSNP
rs1159378810 2162 dbSNP
rs1439130103 2163 dbSNP
rs1236614911 2164 dbSNP
rs1291920852 2165 dbSNP
rs1185600578 2166 dbSNP
rs759484311 2169 dbSNP
rs1236616932 2170 dbSNP
rs1488249127 2170 dbSNP
rs1207755087 2171 dbSNP
rs746956537 2172 dbSNP
rs1284846196 2173 dbSNP
rs1437960635 2173 dbSNP
rs1238849386 2174 dbSNP
rs1176689734 2175 dbSNP
rs7041909 2175 dbSNP
rs1029102981 2176 dbSNP
rs147768292 2176 dbSNP
rs374921974 2176 dbSNP
rs111345260 2177 dbSNP
rs1316748847 2177 dbSNP
rs886063864 2177 dbSNP
rs1307903241 2178 dbSNP
rs45480798 2178 dbSNP
rs754771244 2178 dbSNP
rs769799377 2178 dbSNP
rs770356020 2178 dbSNP
rs1064950 2179 dbSNP
rs1246166994 2179 dbSNP
rs1222553014 2180 dbSNP
rs1377977871 2180 dbSNP
rs763903279 2181 dbSNP
rs1456498318 2182 dbSNP
rs1238880898 2183 dbSNP
rs1302690542 2183 dbSNP
rs796930062 2184 dbSNP
rs906338622 2184 dbSNP
rs1328213165 2185 dbSNP
rs13289751 2185 dbSNP
rs1411322624 2185 dbSNP
rs1347503201 2186 dbSNP
rs1463743667 2186 dbSNP
rs1299300025 2187 dbSNP
rs796346335 2188 dbSNP
rs1282992752 2189 dbSNP
rs1378494269 2189 dbSNP
rs1037432896 2190 dbSNP
rs1234358909 2190 dbSNP
rs1046328462 2191 dbSNP
rs1316233777 2191 dbSNP
rs889269349 2192 dbSNP
rs1424674399 2193 dbSNP
rs1439678672 2195 dbSNP
rs1413338805 2197 dbSNP
rs1235728409 2198 dbSNP
rs1179937717 2202 dbSNP
rs35504729 2203 dbSNP
rs1160392153 2204 dbSNP
rs1169567012 2204 dbSNP
rs1218218821 2204 dbSNP
rs1271045387 2204 dbSNP
rs1332768103 2204 dbSNP
rs1341547414 2204 dbSNP
rs1359025158 2204 dbSNP
rs1411208259 2204 dbSNP
rs1415952971 2204 dbSNP
rs1419581682 2204 dbSNP
rs1419781808 2204 dbSNP
rs1423376687 2204 dbSNP
rs1476193152 2204 dbSNP
rs1476612908 2204 dbSNP
rs1482887107 2204 dbSNP
rs751351046 2204 dbSNP
rs886063863 2204 dbSNP
rs1170233673 2205 dbSNP
rs7041783 2206 dbSNP
rs1486709906 2208 dbSNP
rs1423885045 2211 dbSNP
rs1435845966 2213 dbSNP
rs1176126004 2214 dbSNP
rs1263838629 2216 dbSNP
rs1052387273 2217 dbSNP
rs1319392494 2219 dbSNP
rs1328361309 2220 dbSNP
rs947989541 2221 dbSNP
rs541787590 2222 dbSNP
rs989926711 2226 dbSNP
rs936635397 2234 dbSNP
rs368519327 2238 dbSNP
rs1310110319 2243 dbSNP
rs576341394 2248 dbSNP
rs925332395 2251 dbSNP
rs74995636 2253 dbSNP
rs371831330 2262 dbSNP
rs374364990 2265 dbSNP
rs74772022 2269 dbSNP
rs745322216 2271 dbSNP
rs1454375870 2280 dbSNP
rs116375484 2281 dbSNP
rs1379077220 2283 dbSNP
rs1419637935 2287 dbSNP
rs1159457117 2289 dbSNP
rs1387630916 2291 dbSNP
rs886063862 2292 dbSNP
rs985632600 2293 dbSNP
rs553864348 2295 dbSNP
rs954474360 2296 dbSNP
rs761196389 2299 dbSNP
rs994915693 2300 dbSNP
rs959950114 2304 dbSNP
rs1430113128 2308 dbSNP
rs898800578 2308 dbSNP
rs531869620 2310 dbSNP
rs774394805 2311 dbSNP
rs1261052777 2319 dbSNP
rs1014697177 2321 dbSNP
rs1352629449 2322 dbSNP
rs768566333 2325 dbSNP
rs1272220286 2327 dbSNP
rs533627511 2329 dbSNP
rs1192655968 2330 dbSNP
rs1476840782 2332 dbSNP
rs1214949013 2334 dbSNP
rs993156099 2335 dbSNP
rs1270924006 2340 dbSNP
rs749146295 2347 dbSNP
rs898849257 2351 dbSNP
rs367581361 2354 dbSNP
rs574554324 2355 dbSNP
rs775197030 2364 dbSNP
rs947905109 2365 dbSNP
rs1206100420 2366 dbSNP
rs895057619 2367 dbSNP
rs192108272 2379 dbSNP
rs537799576 2385 dbSNP
rs1399686291 2387 dbSNP
rs886063861 2399 dbSNP
rs1307681606 2400 dbSNP
rs188764568 2402 dbSNP
rs1242426712 2403 dbSNP
rs1292457014 2404 dbSNP
rs140793406 2405 dbSNP
rs1285722171 2410 dbSNP
rs558569071 2419 dbSNP
rs978042680 2420 dbSNP
rs1366945989 2436 dbSNP
rs944153101 2440 dbSNP
rs75201363 2441 dbSNP
rs1187610998 2442 dbSNP
rs1463778315 2443 dbSNP
rs34791389 2446 dbSNP
rs1419062928 2450 dbSNP
rs1053134036 2452 dbSNP
rs770013565 2453 dbSNP
rs1168852311 2455 dbSNP
rs184223660 2458 dbSNP
rs920180628 2459 dbSNP
rs974295364 2461 dbSNP
rs963061253 2464 dbSNP
rs749777226 2471 dbSNP
rs546746382 2486 dbSNP
rs746049762 2489 dbSNP
rs116898233 2490 dbSNP
rs992636228 2499 dbSNP
rs1275972668 2500 dbSNP
rs1306410180 2501 dbSNP
rs140042694 2506 dbSNP
rs13764 2508 dbSNP
rs568178663 2528 dbSNP
rs1457987431 2535 dbSNP
rs76945433 2540 dbSNP
rs1486886753 2544 dbSNP
rs1024724935 2552 dbSNP
rs781165196 2565 dbSNP
rs971941490 2567 dbSNP
rs886063860 2569 dbSNP
rs1172553320 2574 dbSNP
rs1376024471 2575 dbSNP
rs1432747596 2576 dbSNP
rs1258318120 2588 dbSNP
rs894950366 2589 dbSNP
rs1311689591 2591 dbSNP
rs1375825378 2593 dbSNP
rs1054131107 2612 dbSNP
rs10412 2613 dbSNP
rs1007214725 2618 dbSNP
rs1382458883 2621 dbSNP
rs902422945 2624 dbSNP
rs953095796 2637 dbSNP
rs563238472 2638 dbSNP
rs997668943 2640 dbSNP
rs892639032 2655 dbSNP
rs1214823446 2657 dbSNP
rs944037113 2658 dbSNP
rs912642354 2661 dbSNP
rs1486292161 2663 dbSNP
rs1188544444 2665 dbSNP
rs1265325352 2672 dbSNP
rs555420709 2680 dbSNP
rs747040675 2685 dbSNP
rs904141337 2687 dbSNP
rs1049803185 2688 dbSNP
rs1395538345 2697 dbSNP
rs1436518449 2702 dbSNP
rs932828127 2708 dbSNP
rs1045055969 2709 dbSNP
rs1173103888 2710 dbSNP
rs920085169 2715 dbSNP
rs1290316427 2717 dbSNP
rs886063859 2718 dbSNP
rs1465533797 2720 dbSNP
rs1375855004 2723 dbSNP
rs1391637737 2724 dbSNP
rs374700518 2729 dbSNP
rs948038002 2731 dbSNP
rs1439748314 2732 dbSNP
rs11548671 2734 dbSNP
rs1238642544 2743 dbSNP
rs756468800 2745 dbSNP
rs1237206948 2746 dbSNP
rs532766729 2747 dbSNP
rs1056965505 2755 dbSNP
rs1218189963 2757 dbSNP
rs961651633 2758 dbSNP
rs1803716 2759 dbSNP
rs1456718434 2773 dbSNP
rs1258627598 2783 dbSNP
rs190731618 2786 dbSNP
rs534250668 2787 dbSNP
rs983155566 2787 dbSNP
rs758971135 2791 dbSNP
rs1483234108 2799 dbSNP
rs971910434 2800 dbSNP
rs781337108 2801 dbSNP
rs1391750267 2802 dbSNP
rs1025157253 2807 dbSNP
rs1325939210 2811 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*