miRTarBase - #MIRT023277 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLC25A30   
Synonyms KMCP1
Description solute carrier family 25 member 30
Transcript NM_001010875   
Expression
Putative miRNA Targets on SLC25A30
3'UTR of SLC25A30
(miRNA target sites are highlighted)
>SLC25A30|NM_001010875|3'UTR
   1 CAAGCCAAGGCTGCATGAGACATCTTTCTGAAAATGGTAACTTCTGAAACAGCAAAGCTTCCTGTGTTTCACTCTGCTTC
  81 TCACTGCTTGGCTCATCACAGATTCTGGGATGTGAGCAACAGATGAAGACTGGGTTAGTTGAGATTGCTGTGTGTTGGCA
 161 TTGGATGCTCTTCATCAAACGTTTAATGGCATAAACTAACATCCAAACACTAGTCTTTACCACTGAAGTGCCCTTCAACA
 241 TCAAAGATAATATGTGAAATGCATGTTTCTTGCTAAAGAAAACTTGCAAGAAAATCAGGAGCGATGTATTGTTTTATTCA
 321 GGGAGAGTAGCTCCTGATGCATCTCAGCTCATGACTGAGAATCAGACTGCTCTAGAAAAGCTCACTGGAACCATGGAATG
 401 GAGCCTCCGAGAAGGTGTTATGGTTTCTGAATTTCTGGGAGATTTTGCTCCTTGTCAACTGAAGAAATTTCATGTATGGA
 481 GACCTGGACTGTTCAACCCCAGGTATAAACGGTGCAGGAAATGGATCCTAGGAATATCACACTGCTTTATCATTTCCTAT
 561 TTTGGCAGGATCTTCCACTTATAATAAGTGATTTTAAGCTTTGAAGACTTGACATTTGTGAGAAATTGTTACAAAGTAAT
 641 AATCTCTAAATTCGTGGTGGTGTTATGTGTTGGCTTTGAAGGTTGCAAGGTCTGTATTGGTGGGGGGTGTTTTCAAGCAG
 721 CTTAGGTTCTGTCTTAGGTCATGTTAGTAATTAGCTTTATGATTTTTAGCAAAGCATATGTATTTCTCAATGAGTAAAAT
 801 GGGGATAATAACGTCTATTGATGTAGAGGGTCAAATGAAGAACAAATAGTAGCTGCTGCTACTTGACTGGAAAGGTAAAT
 881 GTGTTTACATCATGCTGTGGAACAGCTCTAAACAGTCTATGTAGAAGAGGGGCATGTTCTCATGGGCTTCTCATGGTAAT
 961 TGTGAATGAAGCCCTTTGTTAAGGTCTTGTTGAAGAAAGAACACTGTATAAGTTCAGGCTTTAGTACATTTTCCTTAGCA
1041 AAATGTTGGTAGTGAATCAAAGAGTTGATTTTTCCAGGTTTCCAGTTTTTACTTTAGTTTATGTTGTGCCTGTCTTGGAC
1121 TTTCTGTTTAGTTTGGATGGAAAATACCTGCTTGAAATTTTAAAAATGATTTCTTTAGTGCATCTATTTAGCTAGTTTCT
1201 GATAGGTGGTATGTAATATTTTCCCTTTTTCTTTCCTTCTGTAGACACAATAAGTCATTCTCCCTCTTCTTTTTTTCTTT
1281 TTCTATTTTCTTATTCTTTACTCTAACCTGCTTCAGAGAAAGAGCCCTCTTCCTTCTTGTCTTCATCTTAGTCTTTTCAA
1361 AATAAAAGATGACTGTGAGAACCCCAAGAACTTCCACTTCTGGGAGGCAGCCACAGGACAGGGAACATATTTATTTGGGT
1441 CTCTTCAGTTCCCCCTTTGAGAACAACATTAAATACATGTTAGCTGGGGCTCCAGGGCATTCTCCTTCCACAGTAGTGCG
1521 GCCAAATTCCCAGTCTGGCCAGTCTCTTTGTTGAGACTGAATAGAAGGACTGCAGGTTTTTTTGGAGGATGAGATAATTT
1601 TTCCTCGCAGGCATTTTTCCCTTGCCTTCCTTATGCATGAATGGTCCCTTTGAATATTATTTCCAAAAGTGAGAGCTAAG
1681 ACAAAGTCATCAAAAAGAGAGGATAACAGAAGGTGGGGGCGGGGGCGGGGTGCAGTGGGGTAGGGTTACCTGTTAATTGC
1761 TGAGACTCAGATGAAAGTCCAGCTCTCCCTGGGCAACCCTAGAGGGCAGCAGAGGACCCCAGAGCTCATTCAGGCCTTGC
1841 TGCTTGTTCTAAACTACACCTTAGGATTTTTTCTTCTTTCCAAAACATTCCATTGATTTTATAAAGACTTTCTATAGAGA
1921 GGCTTTCACTTTTGAGTTCTTTGAGTTTAAAGATTGCTTTTCTTGAAATGCTCTTTTTTTAATGTAGAAAAATTTTACTT
2001 TTTCAAATATGCATACAATTTTTAAAACAGTAGAAGCAAATTCATTTTAATGACCATGTAAAGAGCGAATGTCAGACAGT
2081 ATTATTACCAGTTTATTCAAATTACATACATGTTCCTACCAAGGTGGAAAGAAATTCAAACCTCATGGTAAAACTTAAGC
2161 ACGATTTAAGATAAAAGCATAGTATTTCTTCAGTGTAGACTTATTAAGTGCCTTATTGAACAGGATCTTAACCTGCTTTT
2241 TCTGTTTTTTTGAAAGAGTTAATGCAATTGTTGAAGCTTCTAACCAAGAAACAACTTAAGGAATTGGGAGACTTGGTCCC
2321 CTCGTTGTCAGGGTTCTGGCTATAAGTACCTCCCCACCTTTGGGTTTTCTTAAATATGCCAAAAGGAATTCTAGTTTTTA
2401 TAACCAATGGGTTTTTTTGTTTGTGTGCTTATGGATTTGTGTAATCATTGATGCTTAATGTTGTGGATTCATAATATAAA
2481 AAGTGGCTCCTGTCCTTTATATTTATTCATGTGCTAGAAATAGTATGCATTATATAAAGAGTATGAAGTTTTCATAAGCC
2561 TTTATATTTCAAGCTCTTTATTTAAACATTGTTGGAATATGTGGCATAAGCCTTGTTTCATTTATTTAATAAACTGGAGT
2641 AATATATAATAATAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUA-ACAGUGUGAGGu 5'
            :|||| ||  ||||: |||| 
Target 5' taGACACAATAAGTCATTCTCCc 3'
1242 - 1264 124.00 -16.10
2
miRNA  3' guuugugguaacagUGUGAGGu 5'
                        |||:||| 
Target 5' ttcttctttccaaaACATTCCa 3'
1871 - 1892 124.00 -11.70
3
miRNA  3' guuuguggUAACAGUGUGAGGu 5'
                  | | ||||||| | 
Target 5' atcctaggAATATCACACTGCt 3'
525 - 546 122.00 -9.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28696812 1 COSMIC
COSN26677628 5 COSMIC
COSN30151828 30 COSMIC
COSN30749601 57 COSMIC
COSN31960906 67 COSMIC
COSN31569085 133 COSMIC
COSN31492086 202 COSMIC
COSN23655959 947 COSMIC
COSN21428045 1943 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs75330252 1 dbSNP
rs777978226 5 dbSNP
rs772694238 8 dbSNP
rs748664310 10 dbSNP
rs1357695504 15 dbSNP
rs1394875157 17 dbSNP
rs374975957 19 dbSNP
rs761886865 24 dbSNP
rs755053231 37 dbSNP
rs779243212 38 dbSNP
rs972211658 41 dbSNP
rs754138489 42 dbSNP
rs1378258556 51 dbSNP
rs372704862 52 dbSNP
rs533907706 53 dbSNP
rs1219639362 66 dbSNP
rs963708673 67 dbSNP
rs887101383 78 dbSNP
rs776411309 95 dbSNP
rs112957014 96 dbSNP
rs34049456 110 dbSNP
rs1258241125 115 dbSNP
rs1458757821 127 dbSNP
rs1201820345 131 dbSNP
rs1232853181 144 dbSNP
rs375469586 148 dbSNP
rs1193383576 156 dbSNP
rs150492995 157 dbSNP
rs1480278808 158 dbSNP
rs541697070 161 dbSNP
rs1426040893 176 dbSNP
rs78856045 180 dbSNP
rs553306379 181 dbSNP
rs1350492894 183 dbSNP
rs140706598 191 dbSNP
rs1295148434 198 dbSNP
rs1204283768 211 dbSNP
rs926180129 215 dbSNP
rs1020445976 216 dbSNP
rs1222661239 224 dbSNP
rs1306079231 238 dbSNP
rs1319524447 240 dbSNP
rs1042352216 248 dbSNP
rs576928712 253 dbSNP
rs1271712398 255 dbSNP
rs1451640051 262 dbSNP
rs892788063 266 dbSNP
rs1039415231 275 dbSNP
rs527809449 278 dbSNP
rs1490307114 287 dbSNP
rs1194797795 300 dbSNP
rs946346186 302 dbSNP
rs754906964 303 dbSNP
rs1167515745 306 dbSNP
rs1414633472 311 dbSNP
rs1407098847 315 dbSNP
rs749617355 328 dbSNP
rs558340792 338 dbSNP
rs1219835864 340 dbSNP
rs10654013 362 dbSNP
rs1404154364 362 dbSNP
rs79291372 362 dbSNP
rs1281528798 374 dbSNP
rs992432666 375 dbSNP
rs1269160740 380 dbSNP
rs76523926 404 dbSNP
rs927012957 408 dbSNP
rs929791177 410 dbSNP
rs1461319275 415 dbSNP
rs1359319629 421 dbSNP
rs1352590686 423 dbSNP
rs1217927696 428 dbSNP
rs973131024 436 dbSNP
rs963542559 439 dbSNP
rs1172533202 447 dbSNP
rs918468581 449 dbSNP
rs748318150 450 dbSNP
rs898910762 450 dbSNP
rs112612543 458 dbSNP
rs1014795553 473 dbSNP
rs557668735 481 dbSNP
rs1196660161 483 dbSNP
rs909189547 486 dbSNP
rs1481100119 491 dbSNP
rs1005194538 498 dbSNP
rs954674304 500 dbSNP
rs77443787 510 dbSNP
rs998152380 511 dbSNP
rs182052979 527 dbSNP
rs576381701 543 dbSNP
rs1312306114 552 dbSNP
rs1381349225 559 dbSNP
rs1199656379 569 dbSNP
rs1241513876 570 dbSNP
rs1039807619 574 dbSNP
rs1288707052 582 dbSNP
rs1323454364 584 dbSNP
rs755015321 585 dbSNP
rs904674981 587 dbSNP
rs1279657325 601 dbSNP
rs1444322546 606 dbSNP
rs1011728047 619 dbSNP
rs1242646107 632 dbSNP
rs114990198 633 dbSNP
rs1179198435 643 dbSNP
rs1365456582 643 dbSNP
rs1468442367 644 dbSNP
rs568376951 645 dbSNP
rs546906916 646 dbSNP
rs946223518 653 dbSNP
rs896042941 654 dbSNP
rs1017915905 657 dbSNP
rs1334208681 663 dbSNP
rs761400628 665 dbSNP
rs534672086 678 dbSNP
rs1312182389 683 dbSNP
rs537321254 686 dbSNP
rs1238848025 696 dbSNP
rs1389942779 702 dbSNP
rs1347530204 707 dbSNP
rs927003107 710 dbSNP
rs890829513 711 dbSNP
rs1262687894 713 dbSNP
rs1375786619 717 dbSNP
rs1200566810 718 dbSNP
rs1252638542 725 dbSNP
rs1436028043 730 dbSNP
rs1333200610 737 dbSNP
rs141335772 739 dbSNP
rs994123807 740 dbSNP
rs941819449 742 dbSNP
rs1038221483 751 dbSNP
rs1465727662 753 dbSNP
rs1299364939 760 dbSNP
rs1393634353 788 dbSNP
rs1467162627 789 dbSNP
rs1324711603 792 dbSNP
rs1333209375 793 dbSNP
rs1377746863 800 dbSNP
rs531021694 803 dbSNP
rs79183846 804 dbSNP
rs1282922388 808 dbSNP
rs1220639166 812 dbSNP
rs146578343 813 dbSNP
rs189890148 832 dbSNP
rs1338751077 838 dbSNP
rs114897486 843 dbSNP
rs1267956385 849 dbSNP
rs756745514 862 dbSNP
rs954709165 863 dbSNP
rs1196980399 868 dbSNP
rs1267797648 876 dbSNP
rs1055686588 880 dbSNP
rs1172038474 888 dbSNP
rs541357087 893 dbSNP
rs1370852034 896 dbSNP
rs1460996643 903 dbSNP
rs1164404750 915 dbSNP
rs1030213313 916 dbSNP
rs1367964008 919 dbSNP
rs1403537795 923 dbSNP
rs974696142 928 dbSNP
rs1302945001 929 dbSNP
rs1341474305 939 dbSNP
rs1384136709 941 dbSNP
rs573947284 943 dbSNP
rs964030473 952 dbSNP
rs1206163364 957 dbSNP
rs1266003339 971 dbSNP
rs1361476505 975 dbSNP
rs750163094 981 dbSNP
rs1018315101 983 dbSNP
rs553965604 984 dbSNP
rs1488457579 985 dbSNP
rs564889009 990 dbSNP
rs761725121 994 dbSNP
rs1259222802 1008 dbSNP
rs1427481518 1011 dbSNP
rs1187607226 1023 dbSNP
rs377185735 1030 dbSNP
rs1386503496 1033 dbSNP
rs1423325803 1036 dbSNP
rs1163428945 1038 dbSNP
rs1361586566 1049 dbSNP
rs1020802762 1061 dbSNP
rs758177321 1062 dbSNP
rs1010372331 1064 dbSNP
rs895992559 1077 dbSNP
rs543098326 1094 dbSNP
rs373003418 1095 dbSNP
rs913360519 1096 dbSNP
rs1318965443 1097 dbSNP
rs990337948 1099 dbSNP
rs957076332 1103 dbSNP
rs1314225966 1113 dbSNP
rs1310191264 1121 dbSNP
rs1240631074 1123 dbSNP
rs1217677548 1125 dbSNP
rs1258634231 1126 dbSNP
rs1485350870 1130 dbSNP
rs1018029887 1131 dbSNP
rs1244446601 1135 dbSNP
rs185204423 1147 dbSNP
rs1334414274 1165 dbSNP
rs937629653 1168 dbSNP
rs905523784 1186 dbSNP
rs776124787 1200 dbSNP
rs763880041 1206 dbSNP
rs1344928068 1212 dbSNP
rs1466774257 1217 dbSNP
rs941710745 1220 dbSNP
rs1338871656 1230 dbSNP
rs1404023059 1243 dbSNP
rs1314384294 1246 dbSNP
rs1029360799 1250 dbSNP
rs907583209 1251 dbSNP
rs1225341053 1254 dbSNP
rs1304634677 1260 dbSNP
rs994463982 1262 dbSNP
rs983608128 1268 dbSNP
rs1287784434 1271 dbSNP
rs1264600649 1272 dbSNP
rs1450922678 1273 dbSNP
rs1239370984 1277 dbSNP
rs897090098 1277 dbSNP
rs1381800227 1278 dbSNP
rs1158830577 1281 dbSNP
rs1443596023 1283 dbSNP
rs1383833508 1285 dbSNP
rs1434069138 1285 dbSNP
rs1178927569 1290 dbSNP
rs192630410 1302 dbSNP
rs1332147263 1314 dbSNP
rs1356311346 1324 dbSNP
rs923132853 1327 dbSNP
rs1296319532 1333 dbSNP
rs1372420499 1344 dbSNP
rs895015457 1349 dbSNP
rs1055801552 1370 dbSNP
rs1320955062 1378 dbSNP
rs974642261 1383 dbSNP
rs1222459998 1397 dbSNP
rs1273101918 1398 dbSNP
rs1308706047 1403 dbSNP
rs369754474 1406 dbSNP
rs1032277594 1413 dbSNP
rs928612771 1419 dbSNP
rs1261567025 1423 dbSNP
rs1203482123 1431 dbSNP
rs752240759 1433 dbSNP
rs978754788 1443 dbSNP
rs1171605465 1453 dbSNP
rs1421773025 1454 dbSNP
rs1408258303 1469 dbSNP
rs913493478 1484 dbSNP
rs1353854679 1486 dbSNP
rs760223458 1492 dbSNP
rs1425129340 1496 dbSNP
rs1222079510 1505 dbSNP
rs1343335935 1508 dbSNP
rs969133225 1513 dbSNP
rs375658091 1519 dbSNP
rs1010779173 1520 dbSNP
rs895982750 1525 dbSNP
rs957524291 1532 dbSNP
rs1035849649 1534 dbSNP
rs1360773435 1536 dbSNP
rs1225286682 1538 dbSNP
rs867867466 1541 dbSNP
rs911418656 1543 dbSNP
rs200334727 1550 dbSNP
rs764595077 1553 dbSNP
rs1001722986 1562 dbSNP
rs1244032895 1564 dbSNP
rs1341008057 1568 dbSNP
rs906102385 1582 dbSNP
rs1185992547 1584 dbSNP
rs1414554162 1591 dbSNP
rs574715744 1594 dbSNP
rs1165349579 1595 dbSNP
rs961553830 1602 dbSNP
rs1038373077 1606 dbSNP
rs1361942088 1607 dbSNP
rs1005845291 1611 dbSNP
rs763381450 1621 dbSNP
rs1233037344 1622 dbSNP
rs1423674352 1661 dbSNP
rs1273059437 1666 dbSNP
rs1382841031 1669 dbSNP
rs886142375 1673 dbSNP
rs1313533164 1674 dbSNP
rs775163976 1692 dbSNP
rs1206087922 1697 dbSNP
rs1165372822 1700 dbSNP
rs1473299214 1702 dbSNP
rs1243856645 1710 dbSNP
rs1373032551 1711 dbSNP
rs894963343 1712 dbSNP
rs925997873 1714 dbSNP
rs1033501426 1720 dbSNP
rs985514375 1720 dbSNP
rs933083970 1721 dbSNP
rs1315546871 1726 dbSNP
rs553180514 1727 dbSNP
rs1406239474 1730 dbSNP
rs907303363 1731 dbSNP
rs923078893 1732 dbSNP
rs1479072392 1738 dbSNP
rs1240318391 1742 dbSNP
rs1038861958 1744 dbSNP
rs1348934689 1745 dbSNP
rs1264057906 1753 dbSNP
rs1046111657 1755 dbSNP
rs943195282 1760 dbSNP
rs1462741587 1763 dbSNP
rs925158921 1769 dbSNP
rs1241258591 1777 dbSNP
rs1198783636 1778 dbSNP
rs534090836 1786 dbSNP
rs141078467 1789 dbSNP
rs749766296 1791 dbSNP
rs1365351361 1792 dbSNP
rs968748403 1795 dbSNP
rs753120242 1797 dbSNP
rs936269557 1799 dbSNP
rs1356733891 1807 dbSNP
rs911366342 1807 dbSNP
rs1404635449 1808 dbSNP
rs1250517539 1810 dbSNP
rs1225210253 1817 dbSNP
rs985645661 1818 dbSNP
rs933697444 1832 dbSNP
rs922382303 1840 dbSNP
rs1284240285 1845 dbSNP
rs1325907094 1860 dbSNP
rs1343275675 1862 dbSNP
rs187862457 1864 dbSNP
rs988898696 1866 dbSNP
rs1406350091 1867 dbSNP
rs571287591 1872 dbSNP
rs1166495306 1873 dbSNP
rs1435933484 1873 dbSNP
rs1181175392 1876 dbSNP
rs1269264944 1879 dbSNP
rs1481216326 1880 dbSNP
rs1467703867 1881 dbSNP
rs1035756924 1903 dbSNP
rs1462030692 1908 dbSNP
rs1170187619 1910 dbSNP
rs1001629692 1914 dbSNP
rs183967074 1919 dbSNP
rs557813385 1939 dbSNP
rs140679747 1943 dbSNP
rs773838677 1943 dbSNP
rs959295057 1943 dbSNP
rs1282863429 1952 dbSNP
rs1003339747 1954 dbSNP
rs75376019 1962 dbSNP
rs1253069794 1963 dbSNP
rs3210286 1969 dbSNP
rs748599255 1973 dbSNP
rs1437437317 1975 dbSNP
rs1249622994 1976 dbSNP
rs1196526676 1977 dbSNP
rs1292267050 1978 dbSNP
rs1010761264 1981 dbSNP
rs1196899866 1981 dbSNP
rs1319922215 1981 dbSNP
rs886092362 1981 dbSNP
rs1258572390 1982 dbSNP
rs1435638203 1982 dbSNP
rs1047872254 1984 dbSNP
rs997200782 1985 dbSNP
rs1320748386 1986 dbSNP
rs570091668 1991 dbSNP
rs901562607 2013 dbSNP
rs191242226 2016 dbSNP
rs1276076235 2018 dbSNP
rs535728265 2019 dbSNP
rs1436817669 2022 dbSNP
rs943146202 2030 dbSNP
rs188303179 2037 dbSNP
rs35019666 2049 dbSNP
rs1043642927 2057 dbSNP
rs1327273049 2058 dbSNP
rs1384081632 2061 dbSNP
rs1293533202 2063 dbSNP
rs1449384033 2064 dbSNP
rs1364497422 2065 dbSNP
rs1227603733 2067 dbSNP
rs945316599 2074 dbSNP
rs182828691 2077 dbSNP
rs913213779 2078 dbSNP
rs922798836 2079 dbSNP
rs972489200 2083 dbSNP
rs1176281542 2084 dbSNP
rs771135525 2086 dbSNP
rs191967811 2102 dbSNP
rs960045297 2108 dbSNP
rs1464007134 2115 dbSNP
rs1184797984 2119 dbSNP
rs75444174 2131 dbSNP
rs1443235216 2135 dbSNP
rs1164538777 2140 dbSNP
rs1469881443 2141 dbSNP
rs1362212181 2142 dbSNP
rs983768336 2145 dbSNP
rs980194685 2162 dbSNP
rs1388062671 2163 dbSNP
rs1467193613 2165 dbSNP
rs188483734 2173 dbSNP
rs1453430135 2176 dbSNP
rs1458891146 2177 dbSNP
rs959242709 2179 dbSNP
rs970190778 2182 dbSNP
rs1016872991 2193 dbSNP
rs543365684 2213 dbSNP
rs747031318 2216 dbSNP
rs1219236113 2230 dbSNP
rs1026579296 2235 dbSNP
rs1258553542 2238 dbSNP
rs1306567668 2244 dbSNP
rs1242805449 2248 dbSNP
rs970568948 2252 dbSNP
rs566746253 2257 dbSNP
rs1021236254 2263 dbSNP
rs1010294350 2264 dbSNP
rs956129556 2298 dbSNP
rs1460376661 2300 dbSNP
rs182831179 2303 dbSNP
rs1181750760 2304 dbSNP
rs1251718058 2305 dbSNP
rs1336454153 2321 dbSNP
rs1032974323 2324 dbSNP
rs1157246066 2342 dbSNP
rs1411502375 2345 dbSNP
rs1451167469 2346 dbSNP
rs1470376612 2347 dbSNP
rs1178694825 2357 dbSNP
rs1403911217 2362 dbSNP
rs1445772581 2386 dbSNP
rs1302139327 2391 dbSNP
rs1373842886 2397 dbSNP
rs1392918845 2404 dbSNP
rs1000206421 2412 dbSNP
rs1050000143 2419 dbSNP
rs889823726 2419 dbSNP
rs1264495668 2423 dbSNP
rs1309885540 2423 dbSNP
rs575966634 2428 dbSNP
rs1252374412 2430 dbSNP
rs78896652 2436 dbSNP
rs773361026 2443 dbSNP
rs1175835919 2444 dbSNP
rs901513332 2446 dbSNP
rs1251471403 2447 dbSNP
rs1017363963 2448 dbSNP
rs1406096780 2468 dbSNP
rs1160642989 2472 dbSNP
rs1427310328 2480 dbSNP
rs546833711 2480 dbSNP
rs1175361367 2483 dbSNP
rs1037619082 2486 dbSNP
rs903674099 2487 dbSNP
rs758539077 2488 dbSNP
rs114976360 2499 dbSNP
rs1182740014 2512 dbSNP
rs1284783315 2522 dbSNP
rs571840852 2525 dbSNP
rs535109979 2526 dbSNP
rs1296990097 2533 dbSNP
rs1309795837 2534 dbSNP
rs945247424 2542 dbSNP
rs892349721 2548 dbSNP
rs1048166502 2550 dbSNP
rs1210231425 2561 dbSNP
rs1490600391 2564 dbSNP
rs1225062937 2565 dbSNP
rs191037875 2570 dbSNP
rs1445877895 2572 dbSNP
rs1283224261 2585 dbSNP
rs1187202197 2598 dbSNP
rs1421662901 2601 dbSNP
rs937677183 2621 dbSNP
rs926315489 2622 dbSNP
rs1425029974 2629 dbSNP
rs1304653487 2633 dbSNP
rs1347742339 2637 dbSNP
rs1435233482 2645 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*