miRTarBase - #MIRT023270 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PFKFB2   
Synonyms PFK-2/FBPase-2
Description 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Transcript NM_006212   
Other Transcripts NM_001018053   
Expression
Putative miRNA Targets on PFKFB2
3'UTR of PFKFB2
(miRNA target sites are highlighted)
>PFKFB2|NM_006212|3'UTR
   1 CCGAAGACCCAAGTCAGCATTCCGGTGGTGTAACTGTGTGTTTCCCTCCAGCCCTGGCCTCCTGCCCTTGTCACTAATCA
  81 CCAAGGAGTCATTAACTTCCTCCCTCTATGCCCACCCCTGACACTTCACCATTAATCTTAACACAGAACATGAGGTTATG
 161 TGTTTATAGGACAACTTAAGCTGTTCTTCAGTTTGAAACATCTTTTCACCCAGGGGCAAGTTAGCAAATTGAGTCTTTTA
 241 GGACAGATTCTCAGATGGGATGATCTGGAGGAGGAGGAAAAAGATACACTCCCTTGGGGCTGAGCATGCCCCACACTCTT
 321 GGATCTTCTCTCTGTTCCCTGGTGTCTTCACTAATGTCCTCATGTTGGTGAAGTGTTGGGGGATGGAGGGCGGGTGAGCA
 401 GTCGGGGGACAAAAAGTCTATTTTTCCTTCACTTTTGTCTCTTCAATGTGTGTTTTCCTCACACTCCTTACTTGACTGCT
 481 TTCTTCCCCCACTTTCATGTCCCCTCTGGATTGTCCAGTGTAATGCATGGCATTGTGGTGTCTGTCTAGGAAGGAAGGGG
 561 TGATTGACAAGAGACAAGTCTGGCCCAGTTAATGCTTTCTGCAGTGGGTCTAAATGGATCTGGACTGGAGGAGTCTTTCC
 641 TTTCCTTTCTCCCTTCCTCTCCAGCCAGGTCCTGTAAGGGCCAGCCCAGACTACAGGACATCCACAGAATATTCTGGAGC
 721 TTGCAAGTAGACATAGGGTGAGAGTTCTTGCCTCCTTTCATGAGAAACAGTTCTAAGTCTTCGATGCCCTGGGAGAATCT
 801 GGCTCTGAGCATGTGGGAAATGTCTTGGTTTTTATTTTTAATTTAGAGTCAGGCCTGGGTCTTTTGAGGTCTGCAGAGTG
 881 GGGTTTAGGAGAGTAGGGTGGGCTCTAGCTCTTGCAGGGCTCTTAGAGAGCAGTCATGTCTTTTCTCCCATGACTCTCAG
 961 GTTCTTTGCCAATCACAGCAACTTTTCCTGCCAAAGCCAGTATCCTCTGGGGCTGTTTAGAAGGGCAGTTAGATTCAGGA
1041 GTCACCACTGATGTTTGAGTTGCTCAAGGCAAGAGGCAGAGAAGAGTTCACTAAAACTGCTTATTTTTGAATAATTTCAG
1121 CACACTGTCCTTAAGAAGAAAGAAACATCAAAACAAAATAGTTTTTACATGACCATTTTTTTCCCAAATGTGGAAAAGCT
1201 TGATGATGAATTTAATCTCTCTCATTGGAGTATTCTTTTGTTCATAAAGAGAAACTATCTCATCTTGATGTCCAGAGAAG
1281 TCCTTGGAACCCTGTGGGATCTAGCTCGTAACTGTTTGTATTTCTCTATTCACTTCTGTCATTTCATTTTCTTTGTAGGG
1361 TTAAACAGAAAATGTTTAGGGAAGAAATTCTTAGCCCCTTGATGACCATGATGGCTTATTCTCTTTCCCAATTTTGCATG
1441 CAAAATGTACGAATATATGTATGTTTTTCTGAGAGGCAAGTTTAGGGTTCTCATGGGATTTTAAAAAGAGATAGGTGACT
1521 CCCCACCTTAAAGTTATCTGCTGGTCTTTTAGAGGTAACCAGTGAGAAGGAGTTAGCTATTTTCCAAGGGTGTTTTCATT
1601 TGGTAATGGAAGACTTTTTGCTGTGGTTCTCATCCAGGAGTATTCCTTAGAATTGCCTTTAGGATTGTTGAATCATAAAC
1681 ATGCCTGTGTCCACCTTATGCTTAATACTGACTCAGAATCTCTGGGATCTGGGTCTGGACATGCATGTATTTAAGTAGCT
1761 TCCCGGATGATTCTGATTCATAGCTCGGGTTAAGAACTCCACCTTAGGAAGTTAGGTGGAAAAATACTGGATAGTAGTTT
1841 CTCAGACAAAAGTGTCAGCCTAGGAATTCTGAATTCCTCATAGTCCTGAAAGGACAGTTCTTTGGGTTTGATGTTTGAGC
1921 AGATCATAATGTTAAATGATATAACCCCCTGGAAGGCAGGCTGCTGTGTTTTAGAGGGTTATTCTAGGTTCTAGTCCCAT
2001 CTTTAACCCTTTACATTGCTGAGTGATGTGGAACAAATCACTGAATTAAATAATTGTCTCTAGAGAGCAGCTGGGGATTT
2081 TAAGCACCCTGGAGAGAGGTGCAGACCCTGCCAGGATGATAAAGGTTGTCATCACTGGCAACTGACTCCTGACCCCGGGT
2161 CCTTTACTCGTATGTCCCAAGTAGGATACCATAGGCAGCTTCTAAAGGCTGCTTACCTAGATTCTTCTCAAAATTGTGTC
2241 CAAGATGTTAAGTAACCTGCTATTCCTGTTTAGTGGTTACATAACATGTACTTAGTGTCTTTGTGGAGCTTTGGGCTGGT
2321 AGGGGCAGGGATAGGGGAAAGCTAAACAGAAGTAGAAGAAAAGGTCCTTGTCCAGAGGAAGGTTATTTTAAGAGACAGGA
2401 CATGTAATTTATAACAAATGGACATTTGCAATATAGCAACAGTCTGAGTCTAGAAGTGTTCAACCATCACATCGCTTCTC
2481 CTGACTTTTCTGTTGTCCTATGGCTATGAGACTACAGGGGTTGGGGGATGGGGATGCCCCCACCACCACCAGTGTGAGAA
2561 TGAGATATGGTTGGGGAGGCGTGTTTGGCACTTTTACAAGGTTGCATTGTCCACATTTGCTTGGATGGTGGCATCTGTAG
2641 CCCAAATGGGCATTCAGTCTTTTCTTCTGCTGTGAGGTAAGAGTAATTCAGACCTAATGAATGAGAAGAGGGAGCACTTT
2721 GATCCACAGACTTTGGATTAACACTGTACCCACTCTTAGCAAAAGGGGACTTCTCTAACAAGCTAGCATTGTGTTAACCT
2801 GTCATTAACCCAGCATTAGAGACAGGTCACTGGGATGTTCATTCTGGCTCTCAGCCTGCTGTTATTTCCCCACTCTCACC
2881 TGTGCTAGTTCGCTTTCTCCAGAAGAGGAGCTGAGGTGGTCTTATCCTCAGATAGGACATGAGAAATTGGAATTTGGCAA
2961 GCAAGGGCTTCAGCATCCTTTAGTTTCTAAAGCAAGATCCCTTCAGAGAAGTCTAGCAGGAAGAAGCCAGGAGAATGTAG
3041 AATGGAAAAGAGCTCTTACTCCAAATTTTAGAGAAGTTTCAGCTCTACTTCTCATCTTTTCTCTCCTGGTCTTACTTGAA
3121 TGCATGTTGGTAATCTGTATACATTACTATGACTGTGTCTATCACAAGTCCTACAAAATAAAAATGGACTTAAAAGTACT
3201 CTCTGCTGAGGCTGTAAGTTTTGTTTTGTGAGAAATAGGTAAAGACATTAGCATTTAATCTACTGGAATAAGCTGGTTGC
3281 TGTGGCTTATACCTGTAGTCCCAGATACTTGGGAGGCTGAGGCAGGAGAATCACTTGAGACCAGCCTGGGCAATATAGTG
3361 AGACCTCACCTCTAAAAAAGTTTTTTATAAATTTACTTGTCTAAAGTGGGGAAAGGGAAATTATTCTGTTTTCTTATTCT
3441 TGCTTCAAGACTATGACAGATTTGAAAGAGAATTCTAAAGCAGATTTAGAGAACCTGCTTCTCTTCTTATCTCCTAATCC
3521 CTAAATTGTAATTTAGCTCTTATCTGTATTGTTGTTTTGTTTTGGTAAAGGGATGATTTTTACATTGAGTTTTAAAGTAG
3601 AATAAGAAAAGCTTCTAAAAACTTGCATTGTGCTAGGGATCTGCCCTATATCTTTGCCTCTGGTGTTTCGTTGTTGTTGT
3681 TATTGTTTGTTTGTTTCCAAAGAAGTTGGAGTTAAGGACACAATATATTTGTACCCCTAGACTGAATGGGTGAGTATTCC
3761 ATATGAGGATCTGGGTAATCCTCTTTGCAACCCACATTTGGTCTTCAGAGACACTGGCATTTTGAAGAAACATATGATAT
3841 AGCTGTTTGGAAATAAATTCATCTATGTTACTTTTTTTTTCTTTTTTTTTTTTTTTTATGAGCAGGAGATCTTAATTGAC
3921 AGAAACTCATTGGTGGTTGGAGTGGCCAATGGGCACGGGAAAAAGTATCCAGTAATCAGAAGAATTGTATCTGGGTTATG
4001 TAATCTTATGCACATTCCATTGTCTTTGCCAAGCCCAGAAGCCATGTTGTGTTCATTGTTAAGAAATTTGATAGATTTAC
4081 CCAGCTTTTCTATGTATTTTGACTTATTGAAAATATGTAACAACTGAGTCGGGTTGCAGCACTGGTGGGGTAGAATCGAC
4161 TTTCCCTGAAGGTGACACAGATGTCAGAATTGTGTCCAGGGATTTAATTTAGACCCATACTGTCCAGGAGACTGTCTCTA
4241 GTTGGATCTCTGTGCTGACTGACTGACAGACAGACTTTAGTGTCTGTGTGCTGACTGACAGACTCTAGTAGTGTCTATAT
4321 GTTGACCAACTGGTAGACCAGGAGGATCTGTGTGCTGATTGACTCTAGTAGGATCTGTTTGTCACTGACAGACTGTAGTA
4401 GTGTCTGTGTGCTGACTGATAGATAGACTATAGTAAAATTTGGGTGTTGCCTGACTAACGGTCTAGGGTCTGTAAGCTGA
4481 CAGTCTGCCTGCTTTCTGATTGTATCCATTGAAGTGTATGTACATTATGGTAATTCTCTGTCTATTAAATGTGTCTAACA
4561 AAGGAAGGAATTAAGCACTCCACGTGTTTTCTTTATAGGGGAGTTCTGTACACTATGATTTTAAATAGATATTTCTTATA
4641 TAGTAGTGGCCAAATTCTCATTATTTTGTACAAGATAAAGGTTATGCATCACTTTTATGGTATTTTGTGAACTCAGCTAA
4721 GGGAATGCCTGTTCAGAGCCTGGAGTTGTTACCTTTACTTGAAGTCATCTCATCCAGTCCCCTGCTTTAGGGCAGGACTT
4801 CAGTTCCACTGTTCATTTCTGAAGCTTCTGTGTCCCCAGCTTACCCTGTTCTGAAATGTTGTATTCCATTGGACAGGGCT
4881 GCTATTTTTAGTCAGCCATGCATTTGGATTTTACACTTAATCTAGTAAGTAAAAATGAGAAGAAAATTTGGCATTTAAAA
4961 ATTGATTTTAAGGGTTGGCAAAAGTATTTTTTCCAGTAAGCCTTTCACTGGATATCTGTGACCAATGTTTACCTACGCAA
5041 TGTTTTTGTATCTGAATTGCTTATGTACGTTTTTTATTATATTGACCTAACAAGAAGATCAACTTATGCTGGTATGGTGA
5121 TGGTTTTGCTATGGCAAAATCAAAGGGCTGATCATACATGGTGCCCTTTGGGAAGGGGGATGGTGTGGGGCTGAGCACCT
5201 CTGGGTTGAATGGGAATGGGTCAGATTGGGAAGCCTAGGAAGAGAGTTCTACTGTAGATTTCCTAGGCACTGCTCTGTTG
5281 AAATAGGAACATAAGTCTTTAGCAACATTCTGATTTAATCGGGTGACACTGATAACAAAGTATGCCACTCAGATCCATTT
5361 AAAGTGTGCATAACTGTATTTGAAATGTGTTTTTGTGTGCGTGTGTGTAGAATGGGTAAATAAAATTGTTGAGTAACTTG
5441 AACCTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUG-GUAA---CAGUGUGAGGu 5'
            ||::: ::||    ||||||||| 
Target 5' tcAATGTGTGTTTTCCTCACACTCCt 3'
443 - 468 152.00 -14.00
2
miRNA  3' guuugugguaaCAGUGUGAGGu 5'
                     | :||||||| 
Target 5' aggaggaaaaaGATACACTCCc 3'
272 - 293 143.00 -10.70
3
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              ||||  ||  |||||:| 
Target 5' tgccCACCCCTG--ACACTTCa 3'
109 - 128 138.00 -15.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30187925 3 COSMIC
COSN13512258 24 COSMIC
COSN30184689 24 COSMIC
COSN20073735 45 COSMIC
COSN20576583 62 COSMIC
COSN30460191 62 COSMIC
COSN30166081 128 COSMIC
COSN6020186 159 COSMIC
COSN28088827 428 COSMIC
COSN22887866 884 COSMIC
COSN18963893 1081 COSMIC
COSN16493605 1146 COSMIC
COSN6020187 1561 COSMIC
COSN20095893 1762 COSMIC
COSN6020188 2516 COSMIC
COSN1096818 2626 COSMIC
COSN1427928 3045 COSMIC
COSN16563916 3122 COSMIC
COSN18723807 3306 COSMIC
COSN20090444 3781 COSMIC
COSN20090445 3882 COSMIC
COSN18928011 3898 COSMIC
COSN7199595 4012 COSMIC
COSN27374367 4304 COSMIC
COSN20090447 4318 COSMIC
COSN20090448 4320 COSMIC
COSN20090449 4323 COSMIC
COSN32064969 4559 COSMIC
COSN9057554 5101 COSMIC
COSN8637380 5205 COSMIC
COSN6020189 5217 COSMIC
COSN30165502 5276 COSMIC
COSN8637381 5298 COSMIC
COSN31487452 5321 COSMIC
COSN31519668 5353 COSMIC
COSN26568211 5401 COSMIC
rs1060286 4585 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs778828027 3 dbSNP
rs747927978 4 dbSNP
rs1419930509 10 dbSNP
rs1049469166 16 dbSNP
rs1409210268 18 dbSNP
rs1169999309 22 dbSNP
rs771795023 24 dbSNP
rs769483356 25 dbSNP
rs746092429 26 dbSNP
rs769907023 31 dbSNP
rs1327165010 35 dbSNP
rs777797262 35 dbSNP
rs1451057285 36 dbSNP
rs775616682 40 dbSNP
rs763423694 48 dbSNP
rs1475645922 60 dbSNP
rs1167264623 64 dbSNP
rs775425231 67 dbSNP
rs1443185508 75 dbSNP
rs1010779989 85 dbSNP
rs916466870 90 dbSNP
rs1326912649 92 dbSNP
rs1375949742 93 dbSNP
rs1043948658 96 dbSNP
rs762644843 100 dbSNP
rs1046040556 103 dbSNP
rs886230979 109 dbSNP
rs772387449 112 dbSNP
rs368203997 116 dbSNP
rs1230724313 119 dbSNP
rs1299253995 121 dbSNP
rs35255963 125 dbSNP
rs1399199449 132 dbSNP
rs1061958 135 dbSNP
rs960966731 152 dbSNP
rs534266400 154 dbSNP
rs1213485121 163 dbSNP
rs1346235661 184 dbSNP
rs996059673 185 dbSNP
rs1224593070 211 dbSNP
rs1390059099 212 dbSNP
rs1012288541 218 dbSNP
rs1441483219 221 dbSNP
rs1023640832 226 dbSNP
rs184432317 234 dbSNP
rs1281108678 243 dbSNP
rs76197836 253 dbSNP
rs984961081 253 dbSNP
rs1374671291 257 dbSNP
rs1159531461 260 dbSNP
rs908016371 264 dbSNP
rs1320610023 268 dbSNP
rs773393216 269 dbSNP
rs890025441 275 dbSNP
rs1475215814 282 dbSNP
rs145281846 285 dbSNP
rs1190778870 288 dbSNP
rs6667268 289 dbSNP
rs1237291017 290 dbSNP
rs1216903719 293 dbSNP
rs966792775 296 dbSNP
rs999581904 303 dbSNP
rs1335631170 307 dbSNP
rs111977500 308 dbSNP
rs1354686207 309 dbSNP
rs933613156 309 dbSNP
rs991048877 311 dbSNP
rs1049417639 312 dbSNP
rs1289258317 313 dbSNP
rs191850113 316 dbSNP
rs1486161101 331 dbSNP
rs1190340225 333 dbSNP
rs1432551457 342 dbSNP
rs1343085555 345 dbSNP
rs11120138 351 dbSNP
rs946431606 352 dbSNP
rs1419439299 353 dbSNP
rs780117726 354 dbSNP
rs907517236 358 dbSNP
rs902317270 359 dbSNP
rs999466810 363 dbSNP
rs184869891 373 dbSNP
rs1476628772 376 dbSNP
rs555223821 379 dbSNP
rs1460894939 385 dbSNP
rs1240719289 391 dbSNP
rs189210736 392 dbSNP
rs1056744865 393 dbSNP
rs1275147748 400 dbSNP
rs540999189 404 dbSNP
rs1296135328 405 dbSNP
rs920323438 406 dbSNP
rs931531677 409 dbSNP
rs1050346219 413 dbSNP
rs1441208872 421 dbSNP
rs1396173436 428 dbSNP
rs896497930 441 dbSNP
rs765644879 447 dbSNP
rs1023586755 449 dbSNP
rs1171816507 458 dbSNP
rs952152897 459 dbSNP
rs1430784769 461 dbSNP
rs1006246946 464 dbSNP
rs1417880272 469 dbSNP
rs1015112802 473 dbSNP
rs1454891858 487 dbSNP
rs1377944655 488 dbSNP
rs117981509 490 dbSNP
rs1191839660 491 dbSNP
rs1488229818 494 dbSNP
rs1297069498 495 dbSNP
rs1251959940 498 dbSNP
rs1206587227 500 dbSNP
rs999509623 505 dbSNP
rs758656378 508 dbSNP
rs1273688828 511 dbSNP
rs1234668464 513 dbSNP
rs1032458105 519 dbSNP
rs958356926 521 dbSNP
rs1012123618 526 dbSNP
rs1373481622 529 dbSNP
rs777510017 531 dbSNP
rs923555400 541 dbSNP
rs953608521 545 dbSNP
rs1464001756 557 dbSNP
rs985148411 559 dbSNP
rs192590868 560 dbSNP
rs946462945 567 dbSNP
rs1168353028 576 dbSNP
rs751211376 581 dbSNP
rs981968269 586 dbSNP
rs550012219 590 dbSNP
rs961715091 594 dbSNP
rs935126080 601 dbSNP
rs145022644 608 dbSNP
rs1251396732 609 dbSNP
rs896443930 610 dbSNP
rs570940450 628 dbSNP
rs1045072334 632 dbSNP
rs1049932607 641 dbSNP
rs1277889682 649 dbSNP
rs1232147007 653 dbSNP
rs185645594 670 dbSNP
rs112721961 675 dbSNP
rs1317092917 677 dbSNP
rs1006309928 681 dbSNP
rs1389104673 690 dbSNP
rs944289998 691 dbSNP
rs552195030 718 dbSNP
rs1015391066 728 dbSNP
rs1415930730 733 dbSNP
rs1041344449 734 dbSNP
rs189580921 739 dbSNP
rs1465749489 744 dbSNP
rs935381549 752 dbSNP
rs1161394500 758 dbSNP
rs1054194448 759 dbSNP
rs1411325620 761 dbSNP
rs998134673 763 dbSNP
rs1453985466 773 dbSNP
rs1486600392 780 dbSNP
rs534485055 783 dbSNP
rs1199628759 784 dbSNP
rs953639584 785 dbSNP
rs1012714710 803 dbSNP
rs769829151 825 dbSNP
rs1023484532 843 dbSNP
rs1262060163 847 dbSNP
rs1236413734 856 dbSNP
rs1327945065 857 dbSNP
rs1293332515 871 dbSNP
rs906397534 874 dbSNP
rs372880218 876 dbSNP
rs986353905 882 dbSNP
rs1304095581 905 dbSNP
rs547745272 912 dbSNP
rs1017972835 915 dbSNP
rs1386118195 921 dbSNP
rs1290925514 926 dbSNP
rs1451859886 929 dbSNP
rs1014826159 934 dbSNP
rs1165689810 938 dbSNP
rs961932390 941 dbSNP
rs967666596 951 dbSNP
rs1415490728 955 dbSNP
rs979211256 959 dbSNP
rs1027698908 973 dbSNP
rs953169383 977 dbSNP
rs181886214 978 dbSNP
rs536405550 979 dbSNP
rs1203049873 982 dbSNP
rs923718972 983 dbSNP
rs1277627315 984 dbSNP
rs935090628 991 dbSNP
rs1464143867 1004 dbSNP
rs1273292162 1023 dbSNP
rs992421978 1027 dbSNP
rs917734755 1029 dbSNP
rs1214970598 1042 dbSNP
rs1216761685 1055 dbSNP
rs747256958 1060 dbSNP
rs1337601414 1065 dbSNP
rs1283003210 1070 dbSNP
rs986262060 1071 dbSNP
rs1327432988 1076 dbSNP
rs376462052 1078 dbSNP
rs1298162946 1084 dbSNP
rs911626457 1085 dbSNP
rs1262641996 1098 dbSNP
rs944217773 1104 dbSNP
rs947984311 1117 dbSNP
rs1044922002 1120 dbSNP
rs1254228469 1130 dbSNP
rs1462403552 1146 dbSNP
rs1374631980 1148 dbSNP
rs1190697820 1151 dbSNP
rs78285730 1152 dbSNP
rs1189900520 1162 dbSNP
rs1195100265 1170 dbSNP
rs1466805097 1176 dbSNP
rs1288492272 1177 dbSNP
rs576122827 1183 dbSNP
rs1340619801 1185 dbSNP
rs1053802022 1200 dbSNP
rs893773327 1203 dbSNP
rs1364745344 1209 dbSNP
rs1304515273 1216 dbSNP
rs771053215 1218 dbSNP
rs538787061 1233 dbSNP
rs1443368651 1236 dbSNP
rs1160860784 1237 dbSNP
rs1329456426 1239 dbSNP
rs1322946712 1249 dbSNP
rs948059885 1250 dbSNP
rs1391915628 1251 dbSNP
rs1398493654 1256 dbSNP
rs558892601 1261 dbSNP
rs576712658 1262 dbSNP
rs1325956645 1266 dbSNP
rs1003369255 1273 dbSNP
rs1014670569 1275 dbSNP
rs541433666 1277 dbSNP
rs879711964 1278 dbSNP
rs1181857175 1281 dbSNP
rs1438603735 1283 dbSNP
rs997597612 1285 dbSNP
rs897749667 1288 dbSNP
rs1030519234 1293 dbSNP
rs889265373 1299 dbSNP
rs1341975610 1304 dbSNP
rs749150112 1308 dbSNP
rs1027341367 1309 dbSNP
rs113744370 1309 dbSNP
rs541714797 1309 dbSNP
rs1274368077 1313 dbSNP
rs143736099 1327 dbSNP
rs1018740535 1333 dbSNP
rs965785092 1334 dbSNP
rs1309465809 1337 dbSNP
rs976922498 1357 dbSNP
rs77757597 1361 dbSNP
rs1375892960 1369 dbSNP
rs935612149 1385 dbSNP
rs186259720 1393 dbSNP
rs1412437050 1396 dbSNP
rs1273880210 1410 dbSNP
rs368825459 1418 dbSNP
rs532231770 1419 dbSNP
rs1220010189 1421 dbSNP
rs1409119125 1423 dbSNP
rs1180694873 1424 dbSNP
rs1246579473 1426 dbSNP
rs1483001339 1429 dbSNP
rs1030646030 1439 dbSNP
rs1454613448 1440 dbSNP
rs956687206 1443 dbSNP
rs760819012 1450 dbSNP
rs771138209 1451 dbSNP
rs1481178441 1452 dbSNP
rs1179275488 1460 dbSNP
rs1409360988 1464 dbSNP
rs969161554 1469 dbSNP
rs552329629 1471 dbSNP
rs1472047153 1481 dbSNP
rs1278110161 1484 dbSNP
rs1165087845 1487 dbSNP
rs1419378803 1488 dbSNP
rs1224537035 1494 dbSNP
rs1286509307 1497 dbSNP
rs948082553 1499 dbSNP
rs1322824895 1504 dbSNP
rs1355971376 1516 dbSNP
rs776748719 1518 dbSNP
rs928054789 1523 dbSNP
rs1358351896 1538 dbSNP
rs939403833 1539 dbSNP
rs1402050573 1559 dbSNP
rs559422094 1564 dbSNP
rs528041055 1568 dbSNP
rs1295507594 1580 dbSNP
rs548177757 1590 dbSNP
rs77560413 1593 dbSNP
rs1036166588 1599 dbSNP
rs941942250 1607 dbSNP
rs897629225 1612 dbSNP
rs536594099 1622 dbSNP
rs1183978013 1626 dbSNP
rs994662646 1627 dbSNP
rs919236504 1630 dbSNP
rs1237231977 1635 dbSNP
rs933419893 1637 dbSNP
rs1228011508 1641 dbSNP
rs75151836 1663 dbSNP
rs889031831 1664 dbSNP
rs4279857 1666 dbSNP
rs1208114452 1668 dbSNP
rs868080194 1681 dbSNP
rs148113978 1685 dbSNP
rs569946876 1688 dbSNP
rs1226526537 1689 dbSNP
rs1378217610 1692 dbSNP
rs1007273352 1696 dbSNP
rs1432481643 1698 dbSNP
rs906041522 1704 dbSNP
rs1463580352 1709 dbSNP
rs115575628 1723 dbSNP
rs1007764318 1727 dbSNP
rs1461455474 1755 dbSNP
rs199564348 1761 dbSNP
rs753882343 1761 dbSNP
rs200549142 1762 dbSNP
rs201358351 1763 dbSNP
rs1043243710 1765 dbSNP
rs558750002 1766 dbSNP
rs999102320 1774 dbSNP
rs957119977 1778 dbSNP
rs1031096297 1787 dbSNP
rs1451568206 1789 dbSNP
rs956374173 1804 dbSNP
rs1188156896 1805 dbSNP
rs34918838 1808 dbSNP
rs1482560375 1809 dbSNP
rs1469020870 1814 dbSNP
rs1188220322 1816 dbSNP
rs989654170 1817 dbSNP
rs1013298318 1820 dbSNP
rs867532193 1825 dbSNP
rs915517316 1828 dbSNP
rs969626704 1846 dbSNP
rs1216037374 1848 dbSNP
rs566176810 1849 dbSNP
rs1296490915 1850 dbSNP
rs969109349 1855 dbSNP
rs1372601726 1868 dbSNP
rs1471534751 1885 dbSNP
rs1291239114 1893 dbSNP
rs927938999 1896 dbSNP
rs1349739489 1897 dbSNP
rs569540795 1898 dbSNP
rs1432073855 1899 dbSNP
rs1168246514 1901 dbSNP
rs1162098049 1922 dbSNP
rs1420203646 1931 dbSNP
rs763394321 1934 dbSNP
rs866508103 1938 dbSNP
rs1269590255 1942 dbSNP
rs1189511547 1943 dbSNP
rs534665822 1957 dbSNP
rs537063959 1961 dbSNP
rs1481989231 1965 dbSNP
rs1369723429 1978 dbSNP
rs1415108562 1979 dbSNP
rs1298561291 1993 dbSNP
rs1218067215 2007 dbSNP
rs556665661 2009 dbSNP
rs971983007 2024 dbSNP
rs116045064 2029 dbSNP
rs1299307577 2034 dbSNP
rs141275871 2041 dbSNP
rs1307761239 2043 dbSNP
rs1435608816 2051 dbSNP
rs1051757578 2053 dbSNP
rs1432735688 2057 dbSNP
rs1408802836 2062 dbSNP
rs543775102 2066 dbSNP
rs1445961078 2071 dbSNP
rs943416179 2080 dbSNP
rs1250839260 2084 dbSNP
rs755547930 2086 dbSNP
rs1211249011 2088 dbSNP
rs1043273525 2097 dbSNP
rs1484035975 2100 dbSNP
rs1040077816 2102 dbSNP
rs1208978343 2103 dbSNP
rs904658328 2105 dbSNP
rs999530035 2113 dbSNP
rs1283650825 2117 dbSNP
rs1289660532 2123 dbSNP
rs1230801110 2128 dbSNP
rs1053332705 2133 dbSNP
rs1288124592 2135 dbSNP
rs1396918821 2136 dbSNP
rs896050608 2139 dbSNP
rs1216824855 2143 dbSNP
rs145001863 2144 dbSNP
rs1024580298 2150 dbSNP
rs749132678 2154 dbSNP
rs1161410869 2156 dbSNP
rs1031870560 2157 dbSNP
rs1001881378 2161 dbSNP
rs1411064927 2163 dbSNP
rs957140008 2168 dbSNP
rs1011492980 2170 dbSNP
rs1211980182 2171 dbSNP
rs576900664 2173 dbSNP
rs963203816 2178 dbSNP
rs1485965056 2180 dbSNP
rs972400403 2181 dbSNP
rs969625569 2188 dbSNP
rs1026263311 2190 dbSNP
rs1246161388 2193 dbSNP
rs954607382 2209 dbSNP
rs980965968 2210 dbSNP
rs1311000047 2211 dbSNP
rs928200775 2225 dbSNP
rs778744678 2241 dbSNP
rs910542754 2242 dbSNP
rs1455761632 2246 dbSNP
rs747924724 2248 dbSNP
rs201729561 2253 dbSNP
rs1186611260 2259 dbSNP
rs1165608176 2263 dbSNP
rs75688200 2271 dbSNP
rs1366525937 2273 dbSNP
rs978843091 2281 dbSNP
rs1428754373 2287 dbSNP
rs1249442490 2293 dbSNP
rs1435139529 2304 dbSNP
rs1186266473 2331 dbSNP
rs559143869 2332 dbSNP
rs1464103580 2337 dbSNP
rs1253047873 2340 dbSNP
rs1211011558 2351 dbSNP
rs1359031048 2360 dbSNP
rs1264053649 2365 dbSNP
rs919377461 2376 dbSNP
rs528191857 2378 dbSNP
rs934881488 2382 dbSNP
rs61815043 2395 dbSNP
rs1412968753 2396 dbSNP
rs985039668 2397 dbSNP
rs541456579 2400 dbSNP
rs545579765 2401 dbSNP
rs1388482964 2402 dbSNP
rs1437290867 2404 dbSNP
rs950292334 2414 dbSNP
rs1365048569 2421 dbSNP
rs1391782286 2430 dbSNP
rs1235542225 2432 dbSNP
rs1448480957 2442 dbSNP
rs943288482 2443 dbSNP
rs1306071318 2449 dbSNP
rs116080852 2451 dbSNP
rs904844745 2460 dbSNP
rs1001912772 2462 dbSNP
rs1453847794 2466 dbSNP
rs1015981872 2474 dbSNP
rs898900855 2481 dbSNP
rs993382645 2498 dbSNP
rs1483608246 2503 dbSNP
rs1026548546 2504 dbSNP
rs1226489020 2506 dbSNP
rs954639442 2507 dbSNP
rs987355367 2510 dbSNP
rs1017634195 2519 dbSNP
rs1247389939 2521 dbSNP
rs1329408472 2521 dbSNP
rs1454640780 2528 dbSNP
rs934351745 2532 dbSNP
rs964666647 2534 dbSNP
rs1305901805 2543 dbSNP
rs979261408 2556 dbSNP
rs747119669 2573 dbSNP
rs926099989 2581 dbSNP
rs934725268 2582 dbSNP
rs1172222352 2589 dbSNP
rs1385877232 2593 dbSNP
rs552791675 2598 dbSNP
rs1199387204 2600 dbSNP
rs1011294834 2607 dbSNP
rs1254452960 2614 dbSNP
rs1203377203 2623 dbSNP
rs373487920 2632 dbSNP
rs1196801971 2637 dbSNP
rs530312205 2653 dbSNP
rs1022903338 2658 dbSNP
rs1279678747 2659 dbSNP
rs1202394396 2660 dbSNP
rs1343011187 2661 dbSNP
rs905392786 2668 dbSNP
rs989025031 2678 dbSNP
rs1002315087 2691 dbSNP
rs776799568 2694 dbSNP
rs917389375 2697 dbSNP
rs189071790 2699 dbSNP
rs950321760 2706 dbSNP
rs1044586613 2721 dbSNP
rs867371455 2725 dbSNP
rs972478124 2726 dbSNP
rs570032866 2728 dbSNP
rs904877299 2737 dbSNP
rs78603860 2739 dbSNP
rs1458237415 2748 dbSNP
rs1037770066 2754 dbSNP
rs1414763913 2758 dbSNP
rs552744844 2760 dbSNP
rs181296362 2768 dbSNP
rs535162655 2782 dbSNP
rs1226091259 2785 dbSNP
rs1238381409 2786 dbSNP
rs533608024 2796 dbSNP
rs984871841 2813 dbSNP
rs1026160516 2820 dbSNP
rs1440860269 2830 dbSNP
rs537635254 2843 dbSNP
rs890267250 2848 dbSNP
rs1209372932 2853 dbSNP
rs1331308281 2855 dbSNP
rs1266232163 2860 dbSNP
rs1227675677 2861 dbSNP
rs377550837 2862 dbSNP
rs1285684378 2871 dbSNP
rs537466004 2872 dbSNP
rs1468908652 2873 dbSNP
rs1215487831 2880 dbSNP
rs1320661392 2886 dbSNP
rs186328207 2892 dbSNP
rs975908849 2893 dbSNP
rs1182207956 2897 dbSNP
rs1364638666 2899 dbSNP
rs577217973 2901 dbSNP
rs533950472 2915 dbSNP
rs1400615605 2921 dbSNP
rs964622404 2925 dbSNP
rs1000226657 2928 dbSNP
rs1165323797 2929 dbSNP
rs923224464 2934 dbSNP
rs934558457 2940 dbSNP
rs1033415823 2946 dbSNP
rs572713416 2974 dbSNP
rs989278625 2977 dbSNP
rs545631118 2978 dbSNP
rs971504772 2988 dbSNP
rs1215006253 2990 dbSNP
rs1322208004 3005 dbSNP
rs980232537 3006 dbSNP
rs1226346044 3008 dbSNP
rs1295829019 3012 dbSNP
rs1297967014 3021 dbSNP
rs1389158757 3047 dbSNP
rs1044165865 3050 dbSNP
rs927587157 3053 dbSNP
rs1386606573 3060 dbSNP
rs764697805 3062 dbSNP
rs941588328 3066 dbSNP
rs1329941816 3086 dbSNP
rs1037398350 3095 dbSNP
rs774918526 3096 dbSNP
rs929089302 3098 dbSNP
rs1404018727 3109 dbSNP
rs1002329817 3124 dbSNP
rs190830483 3125 dbSNP
rs1287244038 3127 dbSNP
rs1334928712 3131 dbSNP
rs77948961 3137 dbSNP
rs1185931323 3144 dbSNP
rs1008768384 3148 dbSNP
rs1263642676 3156 dbSNP
rs1488772229 3166 dbSNP
rs1248446291 3172 dbSNP
rs34494079 3180 dbSNP
rs1355515421 3185 dbSNP
rs1038868812 3186 dbSNP
rs1219282018 3191 dbSNP
rs896775457 3198 dbSNP
rs762247452 3201 dbSNP
rs1000492603 3202 dbSNP
rs1339587193 3204 dbSNP
rs993749582 3211 dbSNP
rs1219247581 3212 dbSNP
rs541578073 3233 dbSNP
rs541939636 3238 dbSNP
rs561323144 3247 dbSNP
rs1277158212 3248 dbSNP
rs956197904 3253 dbSNP
rs1006604129 3271 dbSNP
rs1308969814 3282 dbSNP
rs761598359 3286 dbSNP
rs750006279 3292 dbSNP
rs1010330440 3299 dbSNP
rs1024380456 3301 dbSNP
rs1367288538 3305 dbSNP
rs971452534 3306 dbSNP
rs1427323229 3313 dbSNP
rs1457829492 3319 dbSNP
rs980261667 3321 dbSNP
rs1252312253 3322 dbSNP
rs1372798259 3325 dbSNP
rs927451616 3330 dbSNP
rs35851029 3341 dbSNP
rs923088397 3347 dbSNP
rs530395377 3351 dbSNP
rs755673579 3355 dbSNP
rs142279758 3357 dbSNP
rs765738749 3359 dbSNP
rs1298496228 3361 dbSNP
rs974704594 3366 dbSNP
rs1397309809 3370 dbSNP
rs878898801 3373 dbSNP
rs36037469 3374 dbSNP
rs920276525 3380 dbSNP
rs914446158 3381 dbSNP
rs561669749 3383 dbSNP
rs563595070 3386 dbSNP
rs1349014957 3393 dbSNP
rs928930615 3396 dbSNP
rs532716569 3397 dbSNP
rs1228073037 3417 dbSNP
rs1360993890 3424 dbSNP
rs1047419674 3443 dbSNP
rs552488753 3454 dbSNP
rs776735781 3467 dbSNP
rs944427068 3477 dbSNP
rs1038899018 3487 dbSNP
rs1471509752 3490 dbSNP
rs1204135069 3504 dbSNP
rs1223963387 3529 dbSNP
rs1249528064 3540 dbSNP
rs1056585301 3544 dbSNP
rs1484005878 3549 dbSNP
rs1253741292 3557 dbSNP
rs12036080 3566 dbSNP
rs1183732573 3570 dbSNP
rs1329218939 3573 dbSNP
rs1254162227 3574 dbSNP
rs1230746202 3583 dbSNP
rs753381329 3583 dbSNP
rs1000122185 3586 dbSNP
rs528556518 3590 dbSNP
rs994046101 3600 dbSNP
rs1452085699 3612 dbSNP
rs1194529557 3629 dbSNP
rs1054748156 3630 dbSNP
rs754966239 3631 dbSNP
rs1161343243 3633 dbSNP
rs1047986472 3635 dbSNP
rs1363041191 3641 dbSNP
rs56246017 3644 dbSNP
rs1006263781 3649 dbSNP
rs72741396 3649 dbSNP
rs907324121 3650 dbSNP
rs570591442 3670 dbSNP
rs964820468 3670 dbSNP
rs1001542942 3671 dbSNP
rs1034496102 3680 dbSNP
rs955911365 3682 dbSNP
rs989017222 3685 dbSNP
rs1260512078 3689 dbSNP
rs1245911829 3703 dbSNP
rs879740912 3710 dbSNP
rs1375731863 3711 dbSNP
rs1313277981 3719 dbSNP
rs1467247865 3726 dbSNP
rs963165011 3732 dbSNP
rs138296069 3734 dbSNP
rs758146050 3735 dbSNP
rs1380461321 3743 dbSNP
rs1384079901 3755 dbSNP
rs974359531 3759 dbSNP
rs377378366 3765 dbSNP
rs1294022832 3775 dbSNP
rs1459307782 3792 dbSNP
rs1300648511 3793 dbSNP
rs1162592700 3823 dbSNP
rs1026349643 3831 dbSNP
rs1391519661 3835 dbSNP
rs1400891776 3836 dbSNP
rs1445787915 3840 dbSNP
rs1261712532 3861 dbSNP
rs1210956047 3864 dbSNP
rs914497743 3867 dbSNP
rs938807917 3871 dbSNP
rs1289980321 3872 dbSNP
rs951657726 3877 dbSNP
rs1343055018 3878 dbSNP
rs1363513257 3882 dbSNP
rs1425663638 3882 dbSNP
rs374801550 3882 dbSNP
rs568062478 3882 dbSNP
rs763087244 3882 dbSNP
rs969036849 3882 dbSNP
rs77525039 3883 dbSNP
rs182694371 3886 dbSNP
rs539761547 3887 dbSNP
rs1165779169 3888 dbSNP
rs926946688 3888 dbSNP
rs184985494 3889 dbSNP
rs149614308 3890 dbSNP
rs1212514620 3892 dbSNP
rs1254421476 3898 dbSNP
rs1435382736 3898 dbSNP
rs200767812 3899 dbSNP
rs1209393795 3901 dbSNP
rs1250486122 3909 dbSNP
rs918300677 3910 dbSNP
rs1194263590 3916 dbSNP
rs929496593 3917 dbSNP
rs1256616762 3935 dbSNP
rs1048360878 3937 dbSNP
rs1343496618 3938 dbSNP
rs888071871 3945 dbSNP
rs1410270613 3946 dbSNP
rs191019928 3950 dbSNP
rs537728508 3957 dbSNP
rs935869269 3959 dbSNP
rs1054294265 3962 dbSNP
rs1396075856 3965 dbSNP
rs1408958445 3968 dbSNP
rs891732141 3971 dbSNP
rs1402334481 3973 dbSNP
rs78783521 3984 dbSNP
rs575000660 3988 dbSNP
rs1173548043 3990 dbSNP
rs1199320220 4005 dbSNP
rs769925254 4012 dbSNP
rs1254386465 4019 dbSNP
rs1179957281 4037 dbSNP
rs1437424345 4038 dbSNP
rs543803610 4043 dbSNP
rs1202194460 4045 dbSNP
rs997489354 4052 dbSNP
rs1030429148 4063 dbSNP
rs1358176889 4069 dbSNP
rs10494893 4077 dbSNP
rs1001574000 4095 dbSNP
rs749377635 4097 dbSNP
rs1021868916 4126 dbSNP
rs1434278164 4130 dbSNP
rs1034814089 4131 dbSNP
rs1449914114 4133 dbSNP
rs1404677180 4139 dbSNP
rs11120148 4140 dbSNP
rs1458181820 4144 dbSNP
rs774968072 4146 dbSNP
rs1157128467 4149 dbSNP
rs779957583 4151 dbSNP
rs1469833513 4152 dbSNP
rs762300538 4158 dbSNP
rs1299499923 4159 dbSNP
rs959710041 4170 dbSNP
rs987028260 4179 dbSNP
rs1018624797 4190 dbSNP
rs992416663 4192 dbSNP
rs1466145455 4193 dbSNP
rs965671026 4197 dbSNP
rs974400107 4209 dbSNP
rs144314283 4211 dbSNP
rs1270076796 4218 dbSNP
rs767946985 4222 dbSNP
rs983669090 4228 dbSNP
rs75460793 4235 dbSNP
rs942154001 4239 dbSNP
rs1247753317 4243 dbSNP
rs1489689994 4245 dbSNP
rs990417107 4248 dbSNP
rs913034680 4253 dbSNP
rs377711168 4255 dbSNP
rs199607559 4258 dbSNP
rs371388995 4258 dbSNP
rs149458015 4259 dbSNP
rs71154803 4259 dbSNP
rs945982739 4259 dbSNP
rs66822120 4260 dbSNP
rs1045583025 4263 dbSNP
rs1316834387 4265 dbSNP
rs1400559629 4269 dbSNP
rs1165761624 4270 dbSNP
rs1472708114 4270 dbSNP
rs1442958315 4272 dbSNP
rs386369451 4273 dbSNP
rs1384689837 4274 dbSNP
rs1319500542 4277 dbSNP
rs772932507 4283 dbSNP
rs937376193 4288 dbSNP
rs1055796159 4291 dbSNP
rs142447284 4297 dbSNP
rs528652091 4297 dbSNP
rs933311332 4303 dbSNP
rs1456193607 4304 dbSNP
rs368216308 4304 dbSNP
rs199809882 4305 dbSNP
rs1165585408 4306 dbSNP
rs1214941826 4308 dbSNP
rs898596961 4318 dbSNP
rs1452012825 4327 dbSNP
rs1351502646 4339 dbSNP
rs12083861 4340 dbSNP
rs562115965 4342 dbSNP
rs12079709 4343 dbSNP
rs1358204276 4348 dbSNP
rs1297717895 4356 dbSNP
rs887234811 4366 dbSNP
rs550984651 4373 dbSNP
rs1019914413 4380 dbSNP
rs904372062 4385 dbSNP
rs867459174 4386 dbSNP
rs996270068 4388 dbSNP
rs1430617317 4390 dbSNP
rs1350857479 4394 dbSNP
rs1001292925 4401 dbSNP
rs1410660461 4402 dbSNP
rs1422989264 4403 dbSNP
rs1365249777 4418 dbSNP
rs533507033 4420 dbSNP
rs957359609 4421 dbSNP
rs1417432943 4426 dbSNP
rs959947871 4427 dbSNP
rs754453547 4431 dbSNP
rs1270786806 4442 dbSNP
rs1227818802 4443 dbSNP
rs1196947534 4451 dbSNP
rs765186612 4460 dbSNP
rs570891871 4461 dbSNP
rs981232838 4466 dbSNP
rs1219904583 4467 dbSNP
rs928594579 4468 dbSNP
rs937240356 4469 dbSNP
rs1214535825 4471 dbSNP
rs1483549989 4478 dbSNP
rs1368845559 4481 dbSNP
rs1183911243 4484 dbSNP
rs984297080 4488 dbSNP
rs909605062 4495 dbSNP
rs12087244 4501 dbSNP
rs919915248 4503 dbSNP
rs1403521529 4510 dbSNP
rs1463675862 4512 dbSNP
rs1163890935 4537 dbSNP
rs931392643 4543 dbSNP
rs183196967 4545 dbSNP
rs1431433568 4560 dbSNP
rs1174178523 4571 dbSNP
rs752580171 4580 dbSNP
rs546787716 4584 dbSNP
rs1060286 4585 dbSNP
rs1252251197 4598 dbSNP
rs147358194 4602 dbSNP
rs1008441266 4609 dbSNP
rs555190455 4616 dbSNP
rs1051799705 4617 dbSNP
rs891771421 4639 dbSNP
rs1041217221 4640 dbSNP
rs867876131 4643 dbSNP
rs60785875 4649 dbSNP
rs1222197457 4654 dbSNP
rs1227113726 4657 dbSNP
rs1323300051 4658 dbSNP
rs760241438 4660 dbSNP
rs997078515 4669 dbSNP
rs1371388081 4671 dbSNP
rs1297810251 4672 dbSNP
rs187528909 4675 dbSNP
rs904580667 4677 dbSNP
rs1334676294 4682 dbSNP
rs557309796 4696 dbSNP
rs777367116 4702 dbSNP
rs1160938105 4711 dbSNP
rs1417065163 4715 dbSNP
rs1343342175 4717 dbSNP
rs1182048791 4726 dbSNP
rs1207686657 4726 dbSNP
rs1029093027 4727 dbSNP
rs577539094 4729 dbSNP
rs75079916 4732 dbSNP
rs1011747787 4739 dbSNP
rs1060287 4741 dbSNP
rs1025538748 4746 dbSNP
rs142733751 4747 dbSNP
rs549562092 4748 dbSNP
rs1471484659 4753 dbSNP
rs1315503066 4754 dbSNP
rs981263755 4771 dbSNP
rs1005185404 4774 dbSNP
rs1385119546 4779 dbSNP
rs1334744253 4784 dbSNP
rs1451832910 4789 dbSNP
rs749367877 4795 dbSNP
rs1385649945 4797 dbSNP
rs191886349 4803 dbSNP
rs535058802 4805 dbSNP
rs565824559 4806 dbSNP
rs868259737 4806 dbSNP
rs1165068511 4807 dbSNP
rs145648377 4807 dbSNP
rs1382857728 4810 dbSNP
rs569603794 4816 dbSNP
rs928457791 4827 dbSNP
rs562308999 4832 dbSNP
rs958634626 4835 dbSNP
rs1263131025 4837 dbSNP
rs1207378949 4839 dbSNP
rs1485125464 4849 dbSNP
rs1565 4855 dbSNP
rs1223546571 4857 dbSNP
rs1361781142 4857 dbSNP
rs1313030842 4870 dbSNP
rs1245419741 4879 dbSNP
rs544742944 4881 dbSNP
rs974941451 4882 dbSNP
rs1380404285 4883 dbSNP
rs922081235 4884 dbSNP
rs931364684 4902 dbSNP
rs1303461141 4903 dbSNP
rs1426175876 4904 dbSNP
rs1363392156 4915 dbSNP
rs1560 4916 dbSNP
rs748609059 4920 dbSNP
rs1335023833 4924 dbSNP
rs772700196 4936 dbSNP
rs1427224003 4942 dbSNP
rs1261481371 4943 dbSNP
rs944092016 4949 dbSNP
rs1041249268 4952 dbSNP
rs1200527325 4955 dbSNP
rs773504906 4957 dbSNP
rs1490940946 4975 dbSNP
rs899975966 4977 dbSNP
rs1450873399 4979 dbSNP
rs932897915 4987 dbSNP
rs988146499 4987 dbSNP
rs1054005556 4992 dbSNP
rs1340175386 4994 dbSNP
rs894039588 5013 dbSNP
rs1225157146 5017 dbSNP
rs1011280013 5034 dbSNP
rs946043807 5037 dbSNP
rs533323322 5038 dbSNP
rs546685459 5040 dbSNP
rs1302202185 5041 dbSNP
rs926075805 5069 dbSNP
rs566757777 5070 dbSNP
rs937415532 5070 dbSNP
rs1002548906 5083 dbSNP
rs1035491072 5085 dbSNP
rs1177740105 5092 dbSNP
rs1295842166 5097 dbSNP
rs1341103913 5098 dbSNP
rs1267146516 5108 dbSNP
rs761077569 5120 dbSNP
rs1438541251 5121 dbSNP
rs1280228649 5122 dbSNP
rs183069613 5123 dbSNP
rs1440228413 5136 dbSNP
rs1208780429 5142 dbSNP
rs958531746 5148 dbSNP
rs529215249 5151 dbSNP
rs1338819525 5155 dbSNP
rs1263723280 5156 dbSNP
rs1225248001 5157 dbSNP
rs991724188 5159 dbSNP
rs1282354535 5160 dbSNP
rs1239326883 5164 dbSNP
rs1466190474 5177 dbSNP
rs770529561 5180 dbSNP
rs1326432581 5184 dbSNP
rs952721849 5199 dbSNP
rs982811836 5200 dbSNP
rs1471217937 5210 dbSNP
rs781236593 5213 dbSNP
rs886991067 5215 dbSNP
rs1005670442 5218 dbSNP
rs548754678 5245 dbSNP
rs944121185 5247 dbSNP
rs559206876 5252 dbSNP
rs1437369705 5265 dbSNP
rs537672535 5279 dbSNP
rs1427475473 5284 dbSNP
rs1205518733 5290 dbSNP
rs557398119 5298 dbSNP
rs1262298636 5308 dbSNP
rs1205562918 5311 dbSNP
rs372201337 5321 dbSNP
rs571265702 5322 dbSNP
rs1382920816 5326 dbSNP
rs1316442771 5329 dbSNP
rs1054359302 5331 dbSNP
rs1029394459 5335 dbSNP
rs1334077101 5342 dbSNP
rs1401690632 5346 dbSNP
rs533736039 5351 dbSNP
rs1390092811 5364 dbSNP
rs954869593 5371 dbSNP
rs1157071185 5375 dbSNP
rs1437895774 5376 dbSNP
rs1439274448 5389 dbSNP
rs112930070 5399 dbSNP
rs1487271012 5400 dbSNP
rs746048111 5401 dbSNP
rs1364939239 5415 dbSNP
rs1236903448 5421 dbSNP
rs573471365 5422 dbSNP
rs1216374819 5429 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*