miRTarBase - #MIRT023266 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HHAT   
Synonyms MART2, SKI1, Skn
Description hedgehog acyltransferase
Transcript NM_001122834   
Other Transcripts NM_001170564 , NM_001170580 , NM_001170587 , NM_001170588 , NM_018194   
Expression
Putative miRNA Targets on HHAT
3'UTR of HHAT
(miRNA target sites are highlighted)
>HHAT|NM_001122834|3'UTR
   1 TGCTGTTGGGCCCAGGCCAGTCCTTGTTGCTGGCCTCCAAGGCAAATAGTGCTTCACCCTGACCTCTCACTCCAGGACAG
  81 CCTCTAAGGGATTTGATCTGCTCATCTTCAGTTGAATGCCCTCACTCCAAGACTGGATGCTGGATCTCATAGAAAATTCA
 161 CAGCCAGACAATCTTCTAATCTGGAGTCTTTGAGATCTTCTACCCCAACTCATCATTTTCCTATTGAGGAAACGGGTCCA
 241 GGGCAGTCGTGTGTCTTACCCAGCTACACAGGGTGACATTTTGGTCTAGAACCTAGTCTCATGAGCCCTTTGCATTCTTT
 321 CCCCTTAAGCAAGAATAGAATGTAGTGGAAATTTATTGATTGAGACACAGAAATCCTGATTAGTGATAGGCCTGTCTTCT
 401 GGGCAATATTTCTAAAATATTTGAGTGACATTGATGTTTAAGTGACCTCCTTCATCACATCCTGCAGTATCTCCAGAAGC
 481 AGCACTAGGGTTTGAGTTTCATGCTTCAGCCCCTCTGTAGGAATGAGACCAAGCCACAGCTGTCTTTTGAATTACGTAGT
 561 CGAAGAAGACGGTAGCAGCCCTGTAGCATTCTAAGGCATCTATACCCAAGGAGTCCTGTGATCTGAGCTTCAGCAGGGTG
 641 ATCTACATTTGGGTGCTTGTTTCTGAGATTTGCAGAGAAGTATAACATGGTAGTTCCTCTACCTTACAGTTAATCGTTTC
 721 TTAATAAAGAAGCAGAATTTAGAAACCACAGGATAGTGTACCCACAGATGGGTGTTATCAAGGCCAGTCATGAGGATGGT
 801 GTCCTGGAGTCTTGTCCACCCTCTCCATACAAGTCTCAAAAGTCATCCTCCTACTCAGTGATTCACGTTTAGTGGTTTAT
 881 ATTATTAAGGTTTGATTCAAACAGAGCCTTTTCTGTCCTGTAGATAATCTACATGTTTGTAGAATTATTTTGAATATGTT
 961 TGAGGAAAATGTTTAAAATCTAAATATACTCACATAACTTGATTATTCACTCCTCTGAAAAGATGCTGGATAGGCTACCA
1041 AAGTTCCCAAGTGGTAGATAATTCAGAAGACTTGTTTGAATTTGGATTTTTTTTTTTTTTGGAGTGGGGAAGGGTATAAA
1121 GGAGGCTTAAAATTTGAATCCATAATATATCTAATTACAGGAGAATTTACAACATCTCAAGTACGTAAATTAAGTTGTCA
1201 TTGAGTGAAAGGTTCACTTGGACCTAGTGCTGCCTCCTGTTTATTACATAGCATGGCCCTTATGTCTTGAGTTGAGGTTA
1281 TCATCTCAATGAGGCTTTAGCTCCTAGAGTACAGGACCATTTTGTTGATTGTCTTTCTTCATAGCTTCTCTGCTTGGCAA
1361 AGAGATGGGAGGGGGCCAGATACTGACTACCTGGGGTAGGCACATTATGTGTTAAAGCAAGACAGAGGCCAGAGAGGGGC
1441 AGGTAGACCTGCATAGCAGCAGCCTCAGCAGCTGTCTTGGTAAAGGAGAGAGAGAGACATGGGGCCAGTAATTCCGGGGT
1521 GCTCAGAAGTTTTAGGAGGGGATGAGCCTCAGGGAGGAGTGAGCACCTAAATGAACGCAGTAAACCTTCATGGACCAACA
1601 GTGATTGAGGATTTGTGGGCAGCCAGAGGGAGTCTGACTGAAGTTTACTTGGAAAGAAAGGGCTTGCTAAGAAAAAAGGG
1681 AGTAAAAATGATGATAGGGAAGTGTCTAATGTATGTGCACATATAAGTAATACAAAAGTTTTGAGCTCTTCCAAGTATAC
1761 CATTTATATACAAACAAATAGGTTTATTCATTCATTAAACTACTTTGGAAGCGTCAGTGGATATATTTGAAAGTGGTAAT
1841 CCTGAATCTCTTTTAAACTATTATATGATTCATAATGGTTCTCAGGAATTAATAAATGATTACTGTGTTTAGCTCTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||| : ||| |  |||||| 
Target 5' atAACTTGATTAT-TCACTCCt 3'
994 - 1014 127.00 -9.40
2
miRNA  3' guuuGUGGUAAC---AGUGUGAGGu 5'
              ||||  ||   || |||||| 
Target 5' gcttCACC-CTGACCTCTCACTCCa 3'
51 - 74 125.00 -16.10
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||::|| |     |||||| 
Target 5' tgAATGCCCT-----CACTCCa 3'
113 - 129 122.00 -11.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN15663018 20 COSMIC
COSN30110177 26 COSMIC
COSN31592259 36 COSMIC
COSN30625739 58 COSMIC
COSN30502722 70 COSMIC
COSN30115297 121 COSMIC
COSN30129908 138 COSMIC
COSN31575492 147 COSMIC
COSN20795103 207 COSMIC
COSN30614800 211 COSMIC
COSN28202124 244 COSMIC
COSN24485949 328 COSMIC
COSN8431401 530 COSMIC
COSN29849600 753 COSMIC
COSN4747506 916 COSMIC
COSN20095932 1101 COSMIC
COSN27312126 1101 COSMIC
COSN32064550 1104 COSMIC
COSN7200915 1300 COSMIC
COSN7200916 1577 COSMIC
COSN17854867 1643 COSMIC
COSN7200917 1735 COSMIC
COSN21403936 1738 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs761452174 1 dbSNP
rs201086519 4 dbSNP
rs1201975126 5 dbSNP
rs771614520 6 dbSNP
rs1189875805 7 dbSNP
rs772761598 10 dbSNP
rs760058152 14 dbSNP
rs1371948323 15 dbSNP
rs1001152004 17 dbSNP
rs766375128 18 dbSNP
rs775939647 19 dbSNP
rs4366378 20 dbSNP
rs370014934 21 dbSNP
rs191482026 22 dbSNP
rs1336455692 24 dbSNP
rs757529570 27 dbSNP
rs750545864 29 dbSNP
rs376887707 33 dbSNP
rs780625625 35 dbSNP
rs749783894 37 dbSNP
rs774610788 46 dbSNP
rs1483689313 48 dbSNP
rs779219266 50 dbSNP
rs1240995903 53 dbSNP
rs940475640 63 dbSNP
rs571481420 65 dbSNP
rs1028370138 67 dbSNP
rs953654906 68 dbSNP
rs898832421 69 dbSNP
rs1459827700 82 dbSNP
rs1242347330 87 dbSNP
rs985441626 92 dbSNP
rs930529060 99 dbSNP
rs1285460508 100 dbSNP
rs1354467910 113 dbSNP
rs1016472313 118 dbSNP
rs1356394618 127 dbSNP
rs1285621683 135 dbSNP
rs1050353354 136 dbSNP
rs889057040 145 dbSNP
rs1008735507 147 dbSNP
rs1243378406 151 dbSNP
rs1217991143 156 dbSNP
rs1245508198 163 dbSNP
rs1310539783 169 dbSNP
rs962187051 172 dbSNP
rs972204476 178 dbSNP
rs1353281492 179 dbSNP
rs12566226 182 dbSNP
rs182831221 188 dbSNP
rs949466476 197 dbSNP
rs980798592 205 dbSNP
rs926614184 206 dbSNP
rs1040265794 207 dbSNP
rs1441249106 209 dbSNP
rs1053617574 213 dbSNP
rs116274232 224 dbSNP
rs892322446 234 dbSNP
rs550651904 237 dbSNP
rs185965230 241 dbSNP
rs762976944 248 dbSNP
rs536645290 249 dbSNP
rs762086618 250 dbSNP
rs1286214051 252 dbSNP
rs773578380 252 dbSNP
rs1242771347 256 dbSNP
rs1160573556 259 dbSNP
rs536332932 259 dbSNP
rs903234482 262 dbSNP
rs900926863 263 dbSNP
rs140503607 274 dbSNP
rs998944077 275 dbSNP
rs190867834 285 dbSNP
rs1033404292 290 dbSNP
rs957405433 294 dbSNP
rs1013360953 309 dbSNP
rs1006502934 313 dbSNP
rs115501471 314 dbSNP
rs377483738 315 dbSNP
rs981565256 318 dbSNP
rs1308842717 333 dbSNP
rs1377864921 334 dbSNP
rs1196672362 347 dbSNP
rs1225552386 351 dbSNP
rs750529697 361 dbSNP
rs961729620 368 dbSNP
rs1218273744 369 dbSNP
rs1025524670 421 dbSNP
rs1284057642 426 dbSNP
rs1287736775 431 dbSNP
rs971855067 448 dbSNP
rs920368760 449 dbSNP
rs930310295 451 dbSNP
rs1456698211 455 dbSNP
rs926672745 460 dbSNP
rs1341157976 465 dbSNP
rs760622340 483 dbSNP
rs1237195471 494 dbSNP
rs10863850 504 dbSNP
rs1428940087 508 dbSNP
rs910463344 512 dbSNP
rs944613864 514 dbSNP
rs1344830761 520 dbSNP
rs1158183604 523 dbSNP
rs538772085 524 dbSNP
rs1404741724 530 dbSNP
rs903038431 537 dbSNP
rs1174127267 543 dbSNP
rs1479835056 544 dbSNP
rs1263328862 545 dbSNP
rs754880317 551 dbSNP
rs913832689 553 dbSNP
rs183421323 556 dbSNP
rs1241142207 557 dbSNP
rs1040856115 561 dbSNP
rs1054531997 562 dbSNP
rs766665762 563 dbSNP
rs893233647 571 dbSNP
rs544439457 572 dbSNP
rs932449638 578 dbSNP
rs1049927531 582 dbSNP
rs529840909 583 dbSNP
rs971584988 584 dbSNP
rs1407961474 587 dbSNP
rs1005237997 589 dbSNP
rs114983077 591 dbSNP
rs1015689713 598 dbSNP
rs961514090 606 dbSNP
rs189084414 607 dbSNP
rs1418391034 610 dbSNP
rs971291039 614 dbSNP
rs920356988 623 dbSNP
rs11119566 624 dbSNP
rs985781512 627 dbSNP
rs759705050 633 dbSNP
rs1458653513 672 dbSNP
rs910221969 683 dbSNP
rs958086119 684 dbSNP
rs989446360 685 dbSNP
rs1313727010 687 dbSNP
rs944584191 689 dbSNP
rs1380812092 691 dbSNP
rs1040329158 694 dbSNP
rs1312734990 697 dbSNP
rs777246407 713 dbSNP
rs966634923 716 dbSNP
rs924550801 717 dbSNP
rs1460048129 721 dbSNP
rs932498688 723 dbSNP
rs560504332 748 dbSNP
rs1259102344 751 dbSNP
rs144560290 753 dbSNP
rs1054735157 756 dbSNP
rs1206154426 756 dbSNP
rs370487395 759 dbSNP
rs879441610 765 dbSNP
rs1440634320 777 dbSNP
rs534049814 790 dbSNP
rs1187985480 797 dbSNP
rs1419957046 800 dbSNP
rs1480578026 802 dbSNP
rs770319287 808 dbSNP
rs879623534 820 dbSNP
rs1476762129 822 dbSNP
rs1036737833 829 dbSNP
rs1044363060 830 dbSNP
rs765299176 838 dbSNP
rs993778710 838 dbSNP
rs1047067493 840 dbSNP
rs906760401 842 dbSNP
rs1002796926 843 dbSNP
rs907229219 844 dbSNP
rs553771053 847 dbSNP
rs958117173 851 dbSNP
rs749779572 852 dbSNP
rs1363338638 855 dbSNP
rs758961700 857 dbSNP
rs1358766060 860 dbSNP
rs1162494283 863 dbSNP
rs1420716009 865 dbSNP
rs1020942753 867 dbSNP
rs1157332044 868 dbSNP
rs1419068651 871 dbSNP
rs1268650658 880 dbSNP
rs373895347 886 dbSNP
rs897453391 887 dbSNP
rs564984460 890 dbSNP
rs1217687344 892 dbSNP
rs1339175442 896 dbSNP
rs1027575673 903 dbSNP
rs1236596020 907 dbSNP
rs1316287432 908 dbSNP
rs778089079 911 dbSNP
rs532343680 914 dbSNP
rs1343043402 918 dbSNP
rs147839858 925 dbSNP
rs1017252665 932 dbSNP
rs1341870107 935 dbSNP
rs965687695 936 dbSNP
rs1386672639 940 dbSNP
rs1157248172 942 dbSNP
rs1217791796 951 dbSNP
rs376754175 953 dbSNP
rs975768215 967 dbSNP
rs1453420028 970 dbSNP
rs370862392 974 dbSNP
rs1179157251 983 dbSNP
rs1479731073 995 dbSNP
rs985701794 1002 dbSNP
rs748399806 1020 dbSNP
rs1194473552 1025 dbSNP
rs1441421572 1026 dbSNP
rs772361484 1033 dbSNP
rs924519703 1036 dbSNP
rs1259848766 1060 dbSNP
rs569027531 1070 dbSNP
rs192220299 1085 dbSNP
rs1282157719 1087 dbSNP
rs1321295145 1087 dbSNP
rs149711601 1087 dbSNP
rs202073058 1087 dbSNP
rs369810338 1087 dbSNP
rs879169047 1087 dbSNP
rs1227497389 1100 dbSNP
rs1327843434 1101 dbSNP
rs77574468 1101 dbSNP
rs1210984783 1102 dbSNP
rs1259001707 1104 dbSNP
rs1339071359 1106 dbSNP
rs1487302125 1124 dbSNP
rs1192829587 1139 dbSNP
rs1405977869 1141 dbSNP
rs941125000 1143 dbSNP
rs1036770444 1146 dbSNP
rs918279112 1157 dbSNP
rs1476290324 1162 dbSNP
rs1192686141 1169 dbSNP
rs949716487 1178 dbSNP
rs1243567576 1182 dbSNP
rs773265599 1185 dbSNP
rs1170549193 1186 dbSNP
rs1424725358 1190 dbSNP
rs914390651 1196 dbSNP
rs1175664986 1200 dbSNP
rs948807252 1202 dbSNP
rs547848760 1204 dbSNP
rs141131580 1219 dbSNP
rs776778246 1227 dbSNP
rs938682960 1231 dbSNP
rs1037029873 1239 dbSNP
rs1332589440 1249 dbSNP
rs1319588637 1250 dbSNP
rs533500187 1253 dbSNP
rs1394486505 1259 dbSNP
rs1167372516 1262 dbSNP
rs1010972132 1264 dbSNP
rs1387294966 1265 dbSNP
rs1021014707 1270 dbSNP
rs902579493 1271 dbSNP
rs1346786464 1272 dbSNP
rs745500942 1276 dbSNP
rs1182374510 1277 dbSNP
rs1439467852 1280 dbSNP
rs1029625587 1285 dbSNP
rs954138352 1286 dbSNP
rs1027131223 1290 dbSNP
rs7522025 1299 dbSNP
rs1215215314 1302 dbSNP
rs1293411978 1305 dbSNP
rs149868789 1308 dbSNP
rs1448607220 1316 dbSNP
rs1280484050 1321 dbSNP
rs1445045305 1326 dbSNP
rs765208750 1327 dbSNP
rs12727371 1333 dbSNP
rs1017346354 1334 dbSNP
rs1328338926 1335 dbSNP
rs12727379 1343 dbSNP
rs12740785 1345 dbSNP
rs1405567297 1346 dbSNP
rs965822184 1350 dbSNP
rs1161859834 1354 dbSNP
rs1422537879 1365 dbSNP
rs1158897102 1371 dbSNP
rs975738586 1371 dbSNP
rs1196560324 1376 dbSNP
rs1031348881 1388 dbSNP
rs955940972 1394 dbSNP
rs990489364 1409 dbSNP
rs914381973 1412 dbSNP
rs1219861653 1418 dbSNP
rs1358249742 1422 dbSNP
rs949795465 1424 dbSNP
rs752563556 1432 dbSNP
rs1378654988 1433 dbSNP
rs867220581 1441 dbSNP
rs1419196100 1443 dbSNP
rs1349172804 1447 dbSNP
rs1159160776 1448 dbSNP
rs1405659050 1449 dbSNP
rs1387783447 1452 dbSNP
rs1301345997 1455 dbSNP
rs979946213 1459 dbSNP
rs928717266 1466 dbSNP
rs938778313 1467 dbSNP
rs1055288660 1473 dbSNP
rs370116522 1486 dbSNP
rs758092132 1489 dbSNP
rs538527714 1504 dbSNP
rs1036954463 1507 dbSNP
rs918601519 1508 dbSNP
rs17041995 1516 dbSNP
rs115646131 1517 dbSNP
rs1430847836 1519 dbSNP
rs1260738248 1520 dbSNP
rs542358381 1523 dbSNP
rs1196650485 1535 dbSNP
rs17016653 1542 dbSNP
rs1207961469 1551 dbSNP
rs1272359948 1553 dbSNP
rs889781964 1556 dbSNP
rs1445595422 1560 dbSNP
rs768671247 1563 dbSNP
rs1284206689 1565 dbSNP
rs1224713501 1566 dbSNP
rs1007060647 1567 dbSNP
rs1195211432 1574 dbSNP
rs1041268226 1577 dbSNP
rs1362925802 1578 dbSNP
rs12746068 1597 dbSNP
rs565709180 1602 dbSNP
rs901559177 1610 dbSNP
rs144884382 1620 dbSNP
rs1343269039 1639 dbSNP
rs111332046 1641 dbSNP
rs1025443471 1646 dbSNP
rs774126010 1650 dbSNP
rs1011268570 1652 dbSNP
rs1432021799 1659 dbSNP
rs1419824201 1669 dbSNP
rs1187856236 1679 dbSNP
rs971592092 1680 dbSNP
rs1204705475 1690 dbSNP
rs1463368995 1693 dbSNP
rs546176371 1696 dbSNP
rs1397685649 1697 dbSNP
rs937002676 1698 dbSNP
rs1308103455 1705 dbSNP
rs1275182520 1707 dbSNP
rs989747666 1709 dbSNP
rs570741871 1712 dbSNP
rs915503396 1716 dbSNP
rs970035717 1718 dbSNP
rs1453020787 1722 dbSNP
rs979872605 1723 dbSNP
rs928475895 1724 dbSNP
rs960090641 1730 dbSNP
rs1354659344 1732 dbSNP
rs1042576948 1733 dbSNP
rs1389154350 1734 dbSNP
rs564494042 1734 dbSNP
rs902672811 1734 dbSNP
rs918709300 1735 dbSNP
rs1446782222 1744 dbSNP
rs1051170952 1749 dbSNP
rs1181842219 1750 dbSNP
rs1481229855 1753 dbSNP
rs931289596 1756 dbSNP
rs1202514582 1767 dbSNP
rs1336980806 1772 dbSNP
rs1307145641 1773 dbSNP
rs1292685598 1775 dbSNP
rs1048428299 1779 dbSNP
rs768471948 1783 dbSNP
rs1361267356 1784 dbSNP
rs1395422782 1797 dbSNP
rs527872590 1797 dbSNP
rs1292619584 1800 dbSNP
rs1299441073 1801 dbSNP
rs1038345424 1803 dbSNP
rs898417938 1803 dbSNP
rs994081313 1807 dbSNP
rs1163774098 1813 dbSNP
rs182919426 1814 dbSNP
rs750373266 1823 dbSNP
rs1383824435 1828 dbSNP
rs971240117 1834 dbSNP
rs942938729 1842 dbSNP
rs1041194352 1847 dbSNP
rs1034118425 1861 dbSNP
rs548017284 1865 dbSNP
rs1482744448 1868 dbSNP
rs1269894653 1875 dbSNP
rs1225062795 1890 dbSNP
rs1489911722 1893 dbSNP
rs1263524552 1908 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*