miRTarBase - #MIRT023263 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LUZP1   
Synonyms LUZP
Description leucine zipper protein 1
Transcript NM_001142546   
Other Transcripts NM_033631   
Expression
Putative miRNA Targets on LUZP1
3'UTR of LUZP1
(miRNA target sites are highlighted)
>LUZP1|NM_001142546|3'UTR
   1 GCCCGCTGGGTGTCTGTTGTCTGCCCTCTGCTCCTGCTTCTCAGCTCTTCCACCGTCCTGCCCCACGAAGGATCCAAGGC
  81 CAGTTAACCAGGCAAGACACAAGCCTTGGCTGGAAAACTGTGGTAGAGCCGGGCTGTGGCTCAGGTAATTTTTGCCATTT
 161 GGCCAGAGGGAATCAGAGACTACAAGCTGGACAGTCACCCAGGCCCAACCTTCCCCAATGCACGAGTCCTCTCTCTCTCC
 241 TTGTCCCTGTCCACCAAGTAGTTGGACCATTCTGGCCCCCAAACAAGGGAAGATAAAGTCCCCAGCACACAGCAGGAGTC
 321 AAAAATTCTTCTCGGCTCCTTGGTGGGTTGTTTCTGGATCCTAGGGCAGCCTCTGTCTGTGTGGTTAATGTTCTGGTTTC
 401 TCAGTCTCCTCACTATATCCACTTCACTCCTCATTTGCCCAATGGGCTCAAGTACCCCATAAGATTTACCAGCCATCAGC
 481 TCTATCTAGGGGGCTTTCATTTCTTTCCCCTTGGAGTTCTTTTCTTCAGACTTAAAGCAGAAAGGGGTCTGTGCTGCCTC
 561 TAAAGGATTATGAGACTACCCTTTAGGTTGAAGTTTGACCTGGCTCCTGGCTTACCAGTCTCCTGGAAGCAGAGCATGCA
 641 GATACTCATGCGGATACCCATTGGAATGACATCATCCCTCCCCAACCCCAGCTCTCTCTGCTCACCTTCCAAAGGCACCT
 721 GGAGGTGCAAGCCTCATGCATCTCCTTTCCTGAGCACCAGTAATGCTGCTGGCATCGCCTGCTTTCTCTCCAGTGGCTGG
 801 AGACTTCAAGCTGACTTCATTGTTTCCACCTTGGGAAAATCCCTAGGCTAAGCTGGGCCTGACCCAGCATCCTCTGCCTT
 881 CTAGGAAGTGCCCAGCAAGAGGGAAAGCAGACCCCTTTAGTCACTCCACAAGCAATAGCTCCATGAGAGGCATGGACTGT
 961 GAGACTACTCCCTCCTGTTCCTCCTTCTCCATCCCCCATGGAGGAGGCATCGCACTTTACCAAGCTGATGCATTCCTACA
1041 GAAGTGGGCCCCGGATTTCTGCAAGTCGACTATCATGATGACTTCGCTGGAGGAAAGGTGATACGTACATACGCATTGAG
1121 GGCCTCAGCTTTATATAGTTCAAAATGCAGCAAACTTTTCAGAAAGCCACGTAAATAAATTGGTTAGGTTCCTTATACCA
1201 GTCACATGGGGAAGTTGAAAAGAATTGTATATTCTTGGCAGTGCTTTTTCTTTAGCATTCTGTCAATTCAAAGAAGGGAT
1281 CCTCTTTCAAAGGCTACCTTTATGAAGTAGACACTATTGCCCTCAGAATGAGAGAACATTAAACTACCAGTCTGGTAAGC
1361 TGGATTTTTTTCCCCATGGCTTTACTTCCTTGCTGTGTGACCTTGGGTGAGTCATTGTCTTCTTGGAGCCTCAGTTTCCC
1441 TGTCTGTAAAATGAGTTCTTTGAAATGGATGATCTCTAAGGGCACCAAATCTGGTATTCTAAGGTTCTCCTGTTTTCACC
1521 ATCTATAATAGTATGGGATGATTTTTGCTTGTGGAAGGTATCATCCGTGTGGGTTCTTCCCTCCTGCCCTCAATTGTTTT
1601 TCTGGGCCTTGTTTTTTAGTTTCTGTATGTTTTAATCTCATGGGGATGAGCTCAGAGAAGCTCCGTGGGCCTGTTTCCCA
1681 ATCTGCAAAGTGTGAAGGGATTAGATGGGATGGTCTCTGAGGCTCTTTGTGGCATCAGCCTTGCCCAGTGCCACACAGTA
1761 TCTCCTGGCGTTCTAGGAGTCTAGGTATTATGGAAAGTACCCAAGTCTGTGTATCTCCTGTTCCTGTGCATCTCCTATGA
1841 ATTTCCTGGCAAGAGGAAGACTCAAGACTTCCTCCAGAGGAATTTGTCTTCTCTGCCTTCACTCAGCATGGGAACCAGTG
1921 TTCATCCTGACCTTGTCTGTATCAGATTTGGCAGTGAGGAGGCTTGGGGAGCACCTACCTTACTTTCAGGGACAGGAATC
2001 TATTGCTCATACTTCTGCTTCCCAGAGTTTTGCCAATCTAAAGGCATTGTCATGTGGCCTGCCTTTCCTGTCCACATCCC
2081 CACCTCTGATGCTCAAGATGCTATTTCCAAGATCTCTTACTGCTGCTTCTCCTGGCTTACTGGCCAGAAACTAGCTCACT
2161 CAAGGCTGCCATCCTTCACTTGCAGCCTCCCTGCCATTCTCCTTCACTGGTTGGCAACCTTGAGAGTTCAAAGAAAATCA
2241 ACCTCTGTGGTGGTCAACTAAAGGTATTAGGAAACTAAGTCTGTGGCTCTTCTCTGCTGATGGAAACAGAAGGGCGCCAA
2321 GCCATGCCTAAAAAGATCTCGCCAATAATTCTTGTCTTTGAGTGTTGGAGCCCTGGATTCTGGTGCTATAGCTCCTGGTG
2401 CCAAAGTCTGGATCTTTCCACATTTCAGCAGCACCAACATCTGCTGCTACTCAAAATGTCCTGTTGAAGAGGGACAGCTG
2481 TGATGCCCTTTTGCTGGGGCTGCCATCTTGAAATCTGAGTGCAATAGGATTTGCTTGTAACAGTTATTTCAGGATATTTT
2561 GTTTCTTTAATCTGCACACTTTCTAGATAGATTTTATTTTTAAGTGTCCTCAGCATTGCAGAAAATAACATTGTAATAGC
2641 AAGTAAAGGCTGGAGGCTGTTTCTCTGGGCTTCAAATGGCTGGCAAGGCTGGCTCTCAAATCCCAAAGTTGGGAGGCATG
2721 TTTCTGAAAAGCAACTGAGGTGTGACTGTTTGGACCCAGGCCTCATCATCAGGGGTCCTGGAGGAAGCCTCCAAGTAGAG
2801 GGGAGACCTGGTAGTTGAATAGTTGTTTAATCAAGCCAAATAGTCCCACTGCCCCCGGTCAACAAACCCACTTTTATGAC
2881 AGTTTTCTTCCGCAGCTTGGCTCTTAAATTTTACTGGCAGGTGTATGGTTGTTGGAGGGTTCCTAGTGAGTTGGGGGACC
2961 TGGCAATAGAGCTGCTTGGTTGGAGGAAGTGAAGCTGGCTTAGTACCAGCAGCTGATCTCTTCCACGTGCTGCTGCTTTT
3041 TTTGCCACTCTGATACTAAACCAGAGAAAGCTGCAGGTGGATAAAGAAGCTGTGGCTGTTTTTTGCTTTTGGGTGGCAAT
3121 GAGAAAGAGTCACAGTGTGGGTTAAAGGGATCTGCAGTGGGGCCAAGGATGCCACCCCACCCTCAGCTGTAGGCAAGCTT
3201 GCACATAAATAACCCCCGTCAGTGGAGTGTTCGGGATGCAGGGGGCACTATAGTGTTCTTGGACTTGTCGTCCTGGGGCA
3281 GTTTTAGTTCTTTATATTTAGTGGGTCAGTGCCAAGTGCTACCACTTCCCAATAAAGGAATGGGGACCCAGAGGCTGGGT
3361 CCCTGGCTACCTTGTTATGAGGTTTTGTTATTTCTCTGACAAGATTGCTTTGGAAAGAGCTGCTTTTAGGGATTATTTTT
3441 TGAATACCCCGAGTGGGGAGCAGGGTTCTCCTCAAAGCCTCACAACCATAGGATCATAGGAAAGGGGCCCTATTTTCCTG
3521 CTGCTTCCCAGCTCAGAACATATACTGAATGGAATGTATTTTTAAGAGAATAAAGTCTATTTTTTTGTATTTTAAAGATT
3601 GAGAGGGCTAAGAAAGTAGCCCTCAAATAAACTGTTATTGCATTATAGGCCCCTTTGTTGGGGGCAGCCTGTTGGTCCAC
3681 ACCTACTTGCTCAGGCAGGTGCTCTGGTCTCTCTCACCCCTGCCCCTTAGAGTCTAGGTGCAGCAGCTCCAAGCATGGGA
3761 CCAAGGAGGCCAGAACCTGTCGCTGGAAACCAGGGCAAAGCAGTGGCTCAGGGCTCCTTGGGTGCATGTGTATCATTGGA
3841 GCTGCCTGTCTGCATGTATCCTCTGGCGCGAATGCTCTCTGTTGGCTCTGCAGTACAATATGTAACCAATAAAGCTCCCT
3921 CGTTTCCGTATACTCTGTGCGAGTCTGTGATGCCAGTTTTGTCAATGTCATCCCTGTGTATCATCTGTCTTCTATGCGTT
4001 GGCGCAGCTCTAGTATATTTATTTATTTCATTGTGTAATACTTAAAATTGGGTATTTTACCTAACCAATTACTGATACTG
4081 CAAGGACTGGAAACATTAACTGCCCTGATCCTGGTGTGCAGATTCTTTCCATTACTGCCACGAATTCTAAGACTAGGGGG
4161 GGAAAAGCCTTCTCCGTTTTCATCTTCCAGTCAGATCACCAATATATATAATGATGTCCCTTAACTCACAGTAAGAAAGA
4241 ATAAAACCACATTTAAGGGACATTACTTGGATTTGCAGTAACAGTGTTTATCATCTATCTGTCAGTCAGTCAGGAGCCCC
4321 TGGGAAGGAACCAGCATGTAACATGTTTTTATCATCTTATATGGCAAAAGGGACTTTGCAGATAAGGATGCTGGGATGAG
4401 GCAGAACATCCTAGATGATCCAGGTGGGCCTTAAATGTAATCACAGGTAGTATCCTTTTAAGAGAGAGACAAAAGATTTG
4481 ACTACAGGAGAAGGCAATGTGATGATGGAAGCAGAAACTGGAGTTATGTGCTCTGAGGATGGAGGAAGGAGCCACGAGCC
4561 TTCCCACACCTAGAAGCTGAAAAGAGCAAGGAAATGAACTGATCCTCCCTGCTCTGAGAGCCTCTGTAATGAATGCAGCC
4641 CTGTGTACCCATTTTAGACTTTAAGCTTCCAGAACTTTCGAATAGATTTCTGTTTTTTTAAGAGCCACTAAGTTTGTGGC
4721 AATCTGTTAAACCAGCTGTTACCTAAGCCCTTGATCCTATGTAGTGCGCTTCCCAAAATGTACACCACCACCTTTAGTAG
4801 AATTGGGAAGTTTTAGCACATACCCATGGAGGGAATCAGGAATAAAGGCAGACTGGTCTCCCAAAGGCTCAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAAC-AGUGUGAGGu 5'
            ||: |:|||| |||:|||:| 
Target 5' ggAAT-CTATTGCTCATACTTCt 3'
1995 - 2016 139.00 -15.90
2
miRNA  3' guUUGUGGUAA-CAGUGUGAGGu 5'
            :|| || || ||  |||||| 
Target 5' caGACCCCTTTAGT--CACTCCa 3'
908 - 928 131.00 -16.22
3
miRNA  3' guuuGUGGU--AACAGUGUGAGGu 5'
              :||||   || ::||:||| 
Target 5' acttTACCAAGCTGATGCATTCCt 3'
1014 - 1037 124.00 -13.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30105043 5 COSMIC
COSN31582022 5 COSMIC
COSN30524889 21 COSMIC
COSN5865270 27 COSMIC
COSN5865545 28 COSMIC
COSN5865224 29 COSMIC
COSN5853777 36 COSMIC
COSN5865512 45 COSMIC
COSN30498034 53 COSMIC
COSN30473122 54 COSMIC
COSN30497913 64 COSMIC
COSN30150314 67 COSMIC
COSN30503422 97 COSMIC
COSN30109888 126 COSMIC
COSN30175900 130 COSMIC
COSN31960193 131 COSMIC
COSN31546253 166 COSMIC
COSN1099949 272 COSMIC
COSN31487477 673 COSMIC
COSN15912930 704 COSMIC
COSN31514719 873 COSMIC
COSN31513190 896 COSMIC
COSN31518324 1105 COSMIC
COSN31602783 1117 COSMIC
COSN6447922 1179 COSMIC
COSN30175661 1191 COSMIC
COSN31541953 1251 COSMIC
COSN28207547 1253 COSMIC
COSN20227745 1579 COSMIC
COSN8337005 1593 COSMIC
COSN16455913 1770 COSMIC
COSN20229928 1874 COSMIC
COSN30022680 2104 COSMIC
COSN1099945 2272 COSMIC
COSN31570365 2335 COSMIC
COSN22752156 2414 COSMIC
COSN26956135 2459 COSMIC
COSN26585458 3461 COSMIC
COSN31482762 3473 COSMIC
COSN30163252 3534 COSMIC
COSN31547955 3568 COSMIC
COSN23175247 3588 COSMIC
COSN31595147 3868 COSMIC
COSN31518325 3869 COSMIC
COSN1436251 3900 COSMIC
COSN16708523 3917 COSMIC
COSN31532959 3997 COSMIC
COSN31522176 4003 COSMIC
COSN20094505 4155 COSMIC
COSN1436248 4461 COSMIC
COSN2491585 4644 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1437587998 3 dbSNP
rs185275170 4 dbSNP
rs757117338 5 dbSNP
rs1166644737 8 dbSNP
rs1488603924 12 dbSNP
rs1290322815 13 dbSNP
rs780497322 15 dbSNP
rs758833907 16 dbSNP
rs1309865512 18 dbSNP
rs1422216483 18 dbSNP
rs199601042 19 dbSNP
rs201465047 20 dbSNP
rs1333729551 21 dbSNP
rs750459214 24 dbSNP
rs200540840 25 dbSNP
rs917776753 26 dbSNP
rs373655445 29 dbSNP
rs747014450 32 dbSNP
rs1382298885 46 dbSNP
rs1159602900 47 dbSNP
rs1470100621 49 dbSNP
rs753978057 50 dbSNP
rs1201477556 51 dbSNP
rs990548780 53 dbSNP
rs959383667 54 dbSNP
rs1289532176 55 dbSNP
rs539270426 56 dbSNP
rs1256192987 59 dbSNP
rs777647695 62 dbSNP
rs202173482 66 dbSNP
rs905238402 87 dbSNP
rs966391517 88 dbSNP
rs1385659157 95 dbSNP
rs1021216193 98 dbSNP
rs1045512751 106 dbSNP
rs946732613 109 dbSNP
rs547327278 114 dbSNP
rs528462646 116 dbSNP
rs112030773 122 dbSNP
rs1389970254 126 dbSNP
rs758285468 130 dbSNP
rs1373209965 131 dbSNP
rs1197993796 133 dbSNP
rs1431381603 136 dbSNP
rs1254594976 137 dbSNP
rs935211959 145 dbSNP
rs922442938 148 dbSNP
rs1194058817 150 dbSNP
rs1457184251 154 dbSNP
rs976575965 169 dbSNP
rs1236558764 174 dbSNP
rs1197839081 182 dbSNP
rs1340149443 200 dbSNP
rs964135601 203 dbSNP
rs1018019462 204 dbSNP
rs984225171 211 dbSNP
rs996916818 218 dbSNP
rs1350712742 222 dbSNP
rs116072608 223 dbSNP
rs1487299885 224 dbSNP
rs530892592 227 dbSNP
rs1222928564 229 dbSNP
rs150563959 230 dbSNP
rs544073299 237 dbSNP
rs1272253581 240 dbSNP
rs1326434898 240 dbSNP
rs1396518300 243 dbSNP
rs898051022 248 dbSNP
rs887147876 255 dbSNP
rs1035154436 256 dbSNP
rs1174238600 270 dbSNP
rs949335272 278 dbSNP
rs368873274 282 dbSNP
rs1184169846 284 dbSNP
rs683893 286 dbSNP
rs1055384408 287 dbSNP
rs1198834578 292 dbSNP
rs1486719452 295 dbSNP
rs1281646910 320 dbSNP
rs141767105 325 dbSNP
rs1305134595 333 dbSNP
rs946730262 333 dbSNP
rs779089175 334 dbSNP
rs753266249 339 dbSNP
rs1370268763 349 dbSNP
rs1376810385 367 dbSNP
rs1296822050 376 dbSNP
rs1463967566 379 dbSNP
rs893829820 383 dbSNP
rs1405448754 393 dbSNP
rs1160113634 406 dbSNP
rs979216714 411 dbSNP
rs945018716 417 dbSNP
rs913568274 423 dbSNP
rs1052406528 427 dbSNP
rs572475000 430 dbSNP
rs187947352 435 dbSNP
rs1028463022 439 dbSNP
rs183623577 442 dbSNP
rs536778314 443 dbSNP
rs1206054585 449 dbSNP
rs41268107 452 dbSNP
rs1283225312 454 dbSNP
rs1231147321 455 dbSNP
rs910987527 459 dbSNP
rs1293388983 475 dbSNP
rs1343400765 484 dbSNP
rs1399273656 484 dbSNP
rs1480898277 486 dbSNP
rs1401056214 494 dbSNP
rs983906538 502 dbSNP
rs1389826615 504 dbSNP
rs1255388221 507 dbSNP
rs557024792 508 dbSNP
rs750933485 532 dbSNP
rs918263353 547 dbSNP
rs1193079818 551 dbSNP
rs1024727930 553 dbSNP
rs1013477576 571 dbSNP
rs1194591389 578 dbSNP
rs1224294236 580 dbSNP
rs1288177083 581 dbSNP
rs1211374144 584 dbSNP
rs896405386 591 dbSNP
rs972333538 596 dbSNP
rs1217453173 609 dbSNP
rs1393543345 625 dbSNP
rs1271851059 627 dbSNP
rs1431392314 636 dbSNP
rs191428961 638 dbSNP
rs187757741 641 dbSNP
rs937826454 649 dbSNP
rs1035271541 651 dbSNP
rs553676564 652 dbSNP
rs763724800 654 dbSNP
rs986885511 654 dbSNP
rs1421823928 677 dbSNP
rs969564300 678 dbSNP
rs1176543572 681 dbSNP
rs1472055454 683 dbSNP
rs933701519 684 dbSNP
rs1024198743 685 dbSNP
rs1011007738 689 dbSNP
rs537440587 691 dbSNP
rs1469224503 703 dbSNP
rs535315334 705 dbSNP
rs1253219221 733 dbSNP
rs893861152 738 dbSNP
rs1305185976 740 dbSNP
rs1361741411 743 dbSNP
rs1215035175 744 dbSNP
rs1183690611 749 dbSNP
rs1301207871 755 dbSNP
rs975675490 760 dbSNP
rs1371532180 772 dbSNP
rs758041493 776 dbSNP
rs549004 777 dbSNP
rs1356295912 781 dbSNP
rs1171253079 783 dbSNP
rs1414363161 789 dbSNP
rs982790020 793 dbSNP
rs1201617168 799 dbSNP
rs1231416090 801 dbSNP
rs1462608257 802 dbSNP
rs1454974882 810 dbSNP
rs951562979 819 dbSNP
rs1176206207 830 dbSNP
rs1479465668 849 dbSNP
rs187732632 851 dbSNP
rs901122346 855 dbSNP
rs774590568 871 dbSNP
rs1485085816 874 dbSNP
rs1278085103 877 dbSNP
rs1236489953 883 dbSNP
rs1034007713 894 dbSNP
rs1241478896 898 dbSNP
rs1336689144 901 dbSNP
rs1375840028 906 dbSNP
rs1299004722 907 dbSNP
rs557681296 909 dbSNP
rs765105833 912 dbSNP
rs759366580 914 dbSNP
rs1319105064 915 dbSNP
rs1435893820 921 dbSNP
rs776715170 925 dbSNP
rs1336775445 932 dbSNP
rs533972417 935 dbSNP
rs1382166417 936 dbSNP
rs1043597945 938 dbSNP
rs1409675893 959 dbSNP
rs945080287 966 dbSNP
rs775415324 967 dbSNP
rs1474592183 972 dbSNP
rs1254779962 979 dbSNP
rs568863060 986 dbSNP
rs918335495 989 dbSNP
rs1259890838 993 dbSNP
rs1050888819 996 dbSNP
rs933648354 998 dbSNP
rs1181587632 999 dbSNP
rs972408743 1011 dbSNP
rs570005274 1012 dbSNP
rs1340415381 1014 dbSNP
rs1287681530 1021 dbSNP
rs367783198 1030 dbSNP
rs1039897802 1041 dbSNP
rs551859040 1045 dbSNP
rs1460608292 1051 dbSNP
rs143628885 1052 dbSNP
rs866786419 1053 dbSNP
rs1475272832 1063 dbSNP
rs1351694409 1065 dbSNP
rs1291492531 1067 dbSNP
rs1244281300 1069 dbSNP
rs746889737 1072 dbSNP
rs183222708 1075 dbSNP
rs1316282466 1076 dbSNP
rs540072866 1079 dbSNP
rs528363161 1083 dbSNP
rs561286203 1085 dbSNP
rs542214902 1086 dbSNP
rs1382422440 1088 dbSNP
rs575205854 1094 dbSNP
rs1325988564 1096 dbSNP
rs1384424460 1104 dbSNP
rs1389651402 1104 dbSNP
rs901193179 1105 dbSNP
rs1161408552 1112 dbSNP
rs1041416539 1113 dbSNP
rs1006816290 1118 dbSNP
rs1372069745 1133 dbSNP
rs992962829 1133 dbSNP
rs889662276 1135 dbSNP
rs1168156370 1138 dbSNP
rs1430254680 1141 dbSNP
rs1426370625 1161 dbSNP
rs1034356030 1170 dbSNP
rs550194244 1171 dbSNP
rs556747369 1174 dbSNP
rs1474389917 1177 dbSNP
rs17278869 1179 dbSNP
rs577841547 1181 dbSNP
rs1195496535 1195 dbSNP
rs148923644 1210 dbSNP
rs1232525063 1211 dbSNP
rs1268503652 1217 dbSNP
rs1327500197 1220 dbSNP
rs1387000578 1233 dbSNP
rs931142905 1234 dbSNP
rs771955491 1237 dbSNP
rs892339136 1241 dbSNP
rs1051278191 1244 dbSNP
rs1292963850 1250 dbSNP
rs1036723524 1254 dbSNP
rs1172995441 1271 dbSNP
rs997952290 1277 dbSNP
rs938408861 1281 dbSNP
rs1194440032 1286 dbSNP
rs1039362411 1290 dbSNP
rs191305246 1292 dbSNP
rs747923507 1296 dbSNP
rs1280229753 1298 dbSNP
rs1232831674 1302 dbSNP
rs910120940 1302 dbSNP
rs980139409 1305 dbSNP
rs755551817 1312 dbSNP
rs778819170 1316 dbSNP
rs77281526 1317 dbSNP
rs1334768887 1320 dbSNP
rs1365894500 1326 dbSNP
rs930131485 1331 dbSNP
rs917433387 1332 dbSNP
rs993284662 1333 dbSNP
rs556027910 1337 dbSNP
rs1432798813 1338 dbSNP
rs762042890 1343 dbSNP
rs1174063439 1348 dbSNP
rs958839408 1349 dbSNP
rs927250151 1371 dbSNP
rs1184324086 1372 dbSNP
rs1419745692 1373 dbSNP
rs989681387 1394 dbSNP
rs958178693 1395 dbSNP
rs1486956027 1403 dbSNP
rs537002213 1407 dbSNP
rs1022219224 1409 dbSNP
rs1031114148 1412 dbSNP
rs1204891495 1412 dbSNP
rs188557122 1413 dbSNP
rs1349052857 1415 dbSNP
rs1258577129 1419 dbSNP
rs1009520250 1422 dbSNP
rs1475752004 1428 dbSNP
rs978185786 1429 dbSNP
rs965809539 1442 dbSNP
rs551553676 1444 dbSNP
rs1357254865 1452 dbSNP
rs533228935 1454 dbSNP
rs1029499721 1455 dbSNP
rs565878591 1470 dbSNP
rs1428716403 1474 dbSNP
rs1382602910 1482 dbSNP
rs754575163 1483 dbSNP
rs753594536 1488 dbSNP
rs1417198619 1490 dbSNP
rs998319634 1496 dbSNP
rs1476254071 1501 dbSNP
rs182943312 1510 dbSNP
rs373979719 1519 dbSNP
rs1286796660 1520 dbSNP
rs1005155575 1521 dbSNP
rs1270030420 1525 dbSNP
rs888151522 1527 dbSNP
rs1329470397 1529 dbSNP
rs1272197966 1531 dbSNP
rs1230901498 1533 dbSNP
rs1336386153 1533 dbSNP
rs1284708159 1535 dbSNP
rs889746072 1542 dbSNP
rs1324415022 1543 dbSNP
rs190738165 1558 dbSNP
rs370585552 1566 dbSNP
rs995325562 1567 dbSNP
rs897010617 1572 dbSNP
rs1322127059 1581 dbSNP
rs1463071038 1588 dbSNP
rs750720927 1590 dbSNP
rs1280843538 1592 dbSNP
rs1047271081 1603 dbSNP
rs1167782071 1611 dbSNP
rs1345803818 1612 dbSNP
rs1244153492 1625 dbSNP
rs1189577318 1627 dbSNP
rs1036794643 1628 dbSNP
rs1468357821 1634 dbSNP
rs1251975854 1637 dbSNP
rs1211511879 1641 dbSNP
rs938450529 1664 dbSNP
rs1278700258 1665 dbSNP
rs1439831255 1676 dbSNP
rs592611 1681 dbSNP
rs1329384924 1706 dbSNP
rs1337408294 1708 dbSNP
rs1271902777 1709 dbSNP
rs111286208 1711 dbSNP
rs547590077 1717 dbSNP
rs1324132365 1720 dbSNP
rs916866524 1720 dbSNP
rs1443458007 1729 dbSNP
rs1350521464 1734 dbSNP
rs560986675 1737 dbSNP
rs1057315826 1749 dbSNP
rs1422210743 1756 dbSNP
rs937535846 1756 dbSNP
rs1169797772 1758 dbSNP
rs768800409 1760 dbSNP
rs532394687 1761 dbSNP
rs936879926 1769 dbSNP
rs924114374 1770 dbSNP
rs988424431 1771 dbSNP
rs755634083 1772 dbSNP
rs11810808 1773 dbSNP
rs1020111870 1779 dbSNP
rs1274950767 1786 dbSNP
rs1205871515 1787 dbSNP
rs1234964923 1791 dbSNP
rs34661815 1794 dbSNP
rs749502188 1794 dbSNP
rs1301043882 1814 dbSNP
rs1236734845 1819 dbSNP
rs954168223 1820 dbSNP
rs1279212452 1830 dbSNP
rs976597278 1832 dbSNP
rs1026921170 1834 dbSNP
rs1309168261 1835 dbSNP
rs1434703834 1836 dbSNP
rs186270324 1837 dbSNP
rs1175959300 1850 dbSNP
rs1425370890 1851 dbSNP
rs775523966 1851 dbSNP
rs1176276331 1856 dbSNP
rs897041811 1863 dbSNP
rs75982213 1873 dbSNP
rs1003114052 1879 dbSNP
rs1485327991 1882 dbSNP
rs906986096 1886 dbSNP
rs888076286 1888 dbSNP
rs1211915270 1890 dbSNP
rs1312570768 1892 dbSNP
rs1283744216 1909 dbSNP
rs1222347916 1923 dbSNP
rs1044524667 1927 dbSNP
rs580878 1930 dbSNP
rs1414670281 1931 dbSNP
rs892824160 1933 dbSNP
rs1451800919 1937 dbSNP
rs1054090723 1939 dbSNP
rs1315379363 1941 dbSNP
rs936911004 1945 dbSNP
rs1466814913 1954 dbSNP
rs924187839 1960 dbSNP
rs1157902644 1961 dbSNP
rs548688229 1962 dbSNP
rs1380547895 1963 dbSNP
rs994800283 1971 dbSNP
rs1474607447 1975 dbSNP
rs896056169 1977 dbSNP
rs1334783607 1979 dbSNP
rs1483451964 1980 dbSNP
rs1241362462 1992 dbSNP
rs139074089 1996 dbSNP
rs1269041231 1997 dbSNP
rs1232695796 1998 dbSNP
rs1359829220 1999 dbSNP
rs912673683 1999 dbSNP
rs1158570074 2001 dbSNP
rs1399205284 2002 dbSNP
rs937522626 2006 dbSNP
rs1361675140 2012 dbSNP
rs1410556451 2017 dbSNP
rs1178186460 2018 dbSNP
rs1433369936 2024 dbSNP
rs906065783 2027 dbSNP
rs553150568 2038 dbSNP
rs1460405929 2046 dbSNP
rs541591782 2049 dbSNP
rs146486844 2060 dbSNP
rs1043127889 2062 dbSNP
rs1166812874 2064 dbSNP
rs33999478 2067 dbSNP
rs1424375519 2068 dbSNP
rs35702179 2082 dbSNP
rs574186188 2089 dbSNP
rs985969669 2093 dbSNP
rs1184514360 2094 dbSNP
rs1184886764 2114 dbSNP
rs1466101810 2119 dbSNP
rs954127616 2121 dbSNP
rs746161317 2124 dbSNP
rs1213381329 2134 dbSNP
rs762344836 2137 dbSNP
rs1267357902 2147 dbSNP
rs142458071 2159 dbSNP
rs947454687 2182 dbSNP
rs1241052741 2185 dbSNP
rs147707200 2186 dbSNP
rs781090260 2187 dbSNP
rs945737186 2188 dbSNP
rs1366384516 2192 dbSNP
rs1320805274 2195 dbSNP
rs1213156493 2199 dbSNP
rs913211343 2206 dbSNP
rs576690105 2223 dbSNP
rs1284660444 2225 dbSNP
rs1294814361 2238 dbSNP
rs751845129 2241 dbSNP
rs1015457459 2242 dbSNP
rs1451023712 2252 dbSNP
rs1357177494 2255 dbSNP
rs531589674 2257 dbSNP
rs1193222167 2260 dbSNP
rs971618499 2260 dbSNP
rs1452855118 2268 dbSNP
rs1453291499 2271 dbSNP
rs1269780802 2276 dbSNP
rs532601637 2279 dbSNP
rs1022772831 2289 dbSNP
rs1250057709 2294 dbSNP
rs1208004176 2300 dbSNP
rs763077463 2315 dbSNP
rs1013089035 2316 dbSNP
rs892852511 2320 dbSNP
rs1328953552 2321 dbSNP
rs1302982501 2323 dbSNP
rs1018068004 2326 dbSNP
rs1054162448 2327 dbSNP
rs998513975 2330 dbSNP
rs902799163 2340 dbSNP
rs1025845053 2341 dbSNP
rs1431608690 2343 dbSNP
rs1159622056 2345 dbSNP
rs1172742959 2347 dbSNP
rs1432654572 2349 dbSNP
rs1379532393 2350 dbSNP
rs1199857529 2353 dbSNP
rs1418572786 2354 dbSNP
rs1456718153 2354 dbSNP
rs1248580178 2355 dbSNP
rs605775 2361 dbSNP
rs539497843 2367 dbSNP
rs769949075 2388 dbSNP
rs1165980467 2406 dbSNP
rs150038194 2409 dbSNP
rs879420982 2412 dbSNP
rs747891315 2413 dbSNP
rs1260408211 2417 dbSNP
rs1049885996 2421 dbSNP
rs1334642070 2427 dbSNP
rs932739014 2434 dbSNP
rs182031165 2437 dbSNP
rs545751419 2438 dbSNP
rs1394003319 2450 dbSNP
rs1404169069 2452 dbSNP
rs1043263768 2454 dbSNP
rs1011637028 2459 dbSNP
rs1362102103 2460 dbSNP
rs1161409572 2469 dbSNP
rs140571746 2486 dbSNP
rs1472970525 2492 dbSNP
rs567476548 2493 dbSNP
rs961346708 2496 dbSNP
rs151325020 2504 dbSNP
rs772114999 2507 dbSNP
rs933333429 2516 dbSNP
rs1200648233 2517 dbSNP
rs1349457039 2524 dbSNP
rs1265882685 2525 dbSNP
rs1306895452 2526 dbSNP
rs1294903068 2535 dbSNP
rs748175893 2536 dbSNP
rs751486938 2537 dbSNP
rs1298964886 2542 dbSNP
rs1342018815 2543 dbSNP
rs778569322 2543 dbSNP
rs1404605365 2570 dbSNP
rs1386664145 2577 dbSNP
rs1322819521 2582 dbSNP
rs1457773622 2584 dbSNP
rs1417322442 2593 dbSNP
rs1364056749 2603 dbSNP
rs530820416 2623 dbSNP
rs911026463 2624 dbSNP
rs190991205 2625 dbSNP
rs1032748963 2632 dbSNP
rs1445652668 2633 dbSNP
rs952570238 2646 dbSNP
rs1210283649 2649 dbSNP
rs1464946188 2657 dbSNP
rs1167690596 2660 dbSNP
rs1272046588 2663 dbSNP
rs1226505648 2698 dbSNP
rs1358327895 2699 dbSNP
rs1455059886 2703 dbSNP
rs998548063 2705 dbSNP
rs902871309 2709 dbSNP
rs972930456 2712 dbSNP
rs1198187918 2714 dbSNP
rs765866883 2715 dbSNP
rs1001761430 2716 dbSNP
rs1008905363 2740 dbSNP
rs1407179811 2744 dbSNP
rs1392013999 2747 dbSNP
rs891336320 2747 dbSNP
rs768501741 2748 dbSNP
rs1011733509 2752 dbSNP
rs1190088251 2760 dbSNP
rs1449740089 2767 dbSNP
rs1480264225 2772 dbSNP
rs1218678372 2774 dbSNP
rs551392081 2777 dbSNP
rs932812404 2780 dbSNP
rs1053200528 2791 dbSNP
rs1206549292 2795 dbSNP
rs1339786086 2797 dbSNP
rs1309295905 2798 dbSNP
rs1299606850 2800 dbSNP
rs1278945956 2807 dbSNP
rs1223114758 2808 dbSNP
rs898613942 2813 dbSNP
rs1228912381 2818 dbSNP
rs796614517 2820 dbSNP
rs1343918779 2823 dbSNP
rs1285580948 2828 dbSNP
rs1273315544 2832 dbSNP
rs142471126 2839 dbSNP
rs560347775 2846 dbSNP
rs1331820931 2848 dbSNP
rs540420719 2849 dbSNP
rs1328754845 2851 dbSNP
rs1428440499 2852 dbSNP
rs1372766785 2854 dbSNP
rs186087923 2856 dbSNP
rs1423958798 2857 dbSNP
rs1189101066 2868 dbSNP
rs981427593 2874 dbSNP
rs1246841402 2875 dbSNP
rs1464005566 2876 dbSNP
rs950049132 2880 dbSNP
rs1276719292 2882 dbSNP
rs1482011342 2882 dbSNP
rs541141040 2890 dbSNP
rs574122054 2891 dbSNP
rs957175848 2892 dbSNP
rs1479233406 2909 dbSNP
rs574733928 2911 dbSNP
rs1345783376 2912 dbSNP
rs918425282 2913 dbSNP
rs1199284246 2914 dbSNP
rs1352814025 2916 dbSNP
rs1054035232 2922 dbSNP
rs977183741 2925 dbSNP
rs1414474544 2926 dbSNP
rs1248150289 2928 dbSNP
rs960076084 2932 dbSNP
rs1178833830 2934 dbSNP
rs562284781 2937 dbSNP
rs936934639 2940 dbSNP
rs1019027924 2950 dbSNP
rs1425216807 2985 dbSNP
rs1008559335 2991 dbSNP
rs181214080 2998 dbSNP
rs377464363 3001 dbSNP
rs1471333035 3002 dbSNP
rs969732838 3006 dbSNP
rs755580760 3008 dbSNP
rs1182898131 3023 dbSNP
rs1021882353 3026 dbSNP
rs749901587 3027 dbSNP
rs956198540 3038 dbSNP
rs1032257753 3044 dbSNP
rs1267765785 3044 dbSNP
rs1331326353 3046 dbSNP
rs1289516320 3047 dbSNP
rs898685701 3051 dbSNP
rs1038471139 3052 dbSNP
rs576672722 3056 dbSNP
rs1449249095 3069 dbSNP
rs940115367 3071 dbSNP
rs1393622271 3072 dbSNP
rs558035750 3081 dbSNP
rs887196860 3085 dbSNP
rs997582837 3087 dbSNP
rs539409672 3088 dbSNP
rs1413608853 3098 dbSNP
rs1158132604 3099 dbSNP
rs138360916 3099 dbSNP
rs1335488602 3101 dbSNP
rs1467826042 3105 dbSNP
rs780728077 3110 dbSNP
rs901911852 3113 dbSNP
rs1017667644 3119 dbSNP
rs950067764 3124 dbSNP
rs1452640599 3127 dbSNP
rs1207133781 3129 dbSNP
rs887816181 3130 dbSNP
rs915838213 3131 dbSNP
rs1268897357 3136 dbSNP
rs757743713 3138 dbSNP
rs1221430741 3148 dbSNP
rs1161074174 3154 dbSNP
rs1320401785 3154 dbSNP
rs752172895 3155 dbSNP
rs112137541 3164 dbSNP
rs1296405117 3167 dbSNP
rs752428622 3168 dbSNP
rs1432513157 3177 dbSNP
rs1390162641 3182 dbSNP
rs896962288 3185 dbSNP
rs925785596 3186 dbSNP
rs1037283806 3189 dbSNP
rs1166835585 3199 dbSNP
rs1424171841 3201 dbSNP
rs1389384969 3202 dbSNP
rs977214753 3213 dbSNP
rs139076782 3217 dbSNP
rs1487550385 3218 dbSNP
rs967569766 3218 dbSNP
rs1201200810 3222 dbSNP
rs1350294109 3224 dbSNP
rs1259297849 3225 dbSNP
rs1241707463 3226 dbSNP
rs561831387 3232 dbSNP
rs911636845 3233 dbSNP
rs764732780 3240 dbSNP
rs1208972436 3246 dbSNP
rs928347622 3248 dbSNP
rs1272986166 3253 dbSNP
rs1451096825 3255 dbSNP
rs1231116788 3256 dbSNP
rs987569413 3257 dbSNP
rs1366857946 3267 dbSNP
rs764312251 3268 dbSNP
rs1417195308 3269 dbSNP
rs1384309059 3270 dbSNP
rs1364959338 3273 dbSNP
rs979887566 3273 dbSNP
rs1295204639 3277 dbSNP
rs1458388006 3285 dbSNP
rs1381278663 3286 dbSNP
rs1028591867 3288 dbSNP
rs1166437634 3296 dbSNP
rs1369678801 3296 dbSNP
rs1431420522 3301 dbSNP
rs146186530 3301 dbSNP
rs997066157 3305 dbSNP
rs1198510627 3309 dbSNP
rs914247333 3314 dbSNP
rs962898897 3330 dbSNP
rs1269626995 3332 dbSNP
rs749139360 3346 dbSNP
rs1017097223 3347 dbSNP
rs1420026051 3348 dbSNP
rs1004331713 3349 dbSNP
rs1161554880 3350 dbSNP
rs887219375 3352 dbSNP
rs1343321719 3355 dbSNP
rs1446396078 3355 dbSNP
rs868134335 3363 dbSNP
rs565547184 3365 dbSNP
rs1309910919 3369 dbSNP
rs758817186 3374 dbSNP
rs1446631595 3377 dbSNP
rs568497437 3378 dbSNP
rs753673144 3381 dbSNP
rs1014733753 3387 dbSNP
rs1306115344 3387 dbSNP
rs1172197024 3390 dbSNP
rs1411429649 3390 dbSNP
rs367589444 3390 dbSNP
rs780760288 3390 dbSNP
rs867223383 3394 dbSNP
rs549153655 3400 dbSNP
rs1176822375 3405 dbSNP
rs766492201 3415 dbSNP
rs1410310351 3417 dbSNP
rs897049372 3417 dbSNP
rs1036972814 3425 dbSNP
rs1483578605 3425 dbSNP
rs1055771492 3426 dbSNP
rs1482046078 3427 dbSNP
rs935907759 3428 dbSNP
rs1044133012 3429 dbSNP
rs925855816 3430 dbSNP
rs1327951051 3442 dbSNP
rs1041605965 3450 dbSNP
rs945885327 3451 dbSNP
rs911652671 3464 dbSNP
rs914216180 3464 dbSNP
rs1324186478 3470 dbSNP
rs536894053 3481 dbSNP
rs1337645559 3487 dbSNP
rs953219183 3489 dbSNP
rs1400259027 3499 dbSNP
rs1364678598 3500 dbSNP
rs1161974830 3501 dbSNP
rs1473228149 3511 dbSNP
rs921610100 3512 dbSNP
rs752824668 3526 dbSNP
rs1368425711 3533 dbSNP
rs569917422 3534 dbSNP
rs1425937439 3543 dbSNP
rs551708928 3552 dbSNP
rs1262318465 3557 dbSNP
rs878982709 3566 dbSNP
rs1203973266 3568 dbSNP
rs765528153 3568 dbSNP
rs976395979 3572 dbSNP
rs1163895461 3577 dbSNP
rs780392787 3579 dbSNP
rs962966194 3579 dbSNP
rs1371408939 3580 dbSNP
rs1196060987 3581 dbSNP
rs986156736 3587 dbSNP
rs1017129724 3596 dbSNP
rs1434706858 3599 dbSNP
rs1004812500 3604 dbSNP
rs952141578 3605 dbSNP
rs951597366 3612 dbSNP
rs1401377973 3616 dbSNP
rs1024867392 3618 dbSNP
rs1161979245 3623 dbSNP
rs1027721543 3626 dbSNP
rs1386305208 3632 dbSNP
rs542068830 3633 dbSNP
rs1183793764 3637 dbSNP
rs993885575 3637 dbSNP
rs1014351905 3638 dbSNP
rs962105551 3639 dbSNP
rs1015918716 3642 dbSNP
rs894513988 3645 dbSNP
rs760658679 3652 dbSNP
rs11553178 3663 dbSNP
rs1195740127 3665 dbSNP
rs1002799442 3666 dbSNP
rs774342890 3667 dbSNP
rs573132556 3675 dbSNP
rs1055845148 3676 dbSNP
rs1363226199 3676 dbSNP
rs1300106783 3688 dbSNP
rs1044267925 3696 dbSNP
rs1000188178 3709 dbSNP
rs904467677 3711 dbSNP
rs1218839060 3713 dbSNP
rs553305415 3716 dbSNP
rs1322124557 3718 dbSNP
rs1041635633 3719 dbSNP
rs945930262 3724 dbSNP
rs143822551 3728 dbSNP
rs371287361 3728 dbSNP
rs1350264384 3733 dbSNP
rs1353342015 3734 dbSNP
rs559377682 3749 dbSNP
rs117560651 3757 dbSNP
rs924311059 3766 dbSNP
rs931752237 3767 dbSNP
rs547441503 3774 dbSNP
rs1428929485 3777 dbSNP
rs986248137 3781 dbSNP
rs116706030 3782 dbSNP
rs528965655 3784 dbSNP
rs1204106496 3794 dbSNP
rs759888136 3799 dbSNP
rs1236602466 3800 dbSNP
rs920671183 3801 dbSNP
rs1215432531 3802 dbSNP
rs1479172710 3810 dbSNP
rs561670418 3812 dbSNP
rs907525276 3813 dbSNP
rs983069359 3814 dbSNP
rs972206755 3817 dbSNP
rs1307969706 3827 dbSNP
rs962320108 3830 dbSNP
rs1003179165 3832 dbSNP
rs558873914 3832 dbSNP
rs570862072 3832 dbSNP
rs1181661113 3836 dbSNP
rs1410220800 3836 dbSNP
rs971316121 3842 dbSNP
rs776839880 3847 dbSNP
rs1436629431 3851 dbSNP
rs1181449242 3855 dbSNP
rs1012752951 3858 dbSNP
rs1301224243 3863 dbSNP
rs951684674 3868 dbSNP
rs893009717 3869 dbSNP
rs1024481174 3870 dbSNP
rs998619872 3873 dbSNP
rs1220599868 3876 dbSNP
rs1367986851 3877 dbSNP
rs1278760367 3880 dbSNP
rs1491320508 3880 dbSNP
rs1439901649 3881 dbSNP
rs1491341921 3881 dbSNP
rs1299057546 3892 dbSNP
rs371165342 3896 dbSNP
rs958810417 3898 dbSNP
rs1358156889 3899 dbSNP
rs1331795845 3900 dbSNP
rs1470666921 3909 dbSNP
rs1406245661 3910 dbSNP
rs1158296744 3911 dbSNP
rs1040054444 3916 dbSNP
rs543951252 3921 dbSNP
rs1034419885 3922 dbSNP
rs1405449986 3926 dbSNP
rs910784222 3927 dbSNP
rs1000217848 3928 dbSNP
rs904541020 3934 dbSNP
rs1050672712 3935 dbSNP
rs1205881832 3936 dbSNP
rs61077571 3940 dbSNP
rs775782717 3941 dbSNP
rs1010161597 3953 dbSNP
rs1319197518 3955 dbSNP
rs564408461 3956 dbSNP
rs769942091 3962 dbSNP
rs554346932 3965 dbSNP
rs1228040392 3967 dbSNP
rs1377521023 3967 dbSNP
rs769266504 3968 dbSNP
rs1282051093 3973 dbSNP
rs774358149 3974 dbSNP
rs931795333 3984 dbSNP
rs1158393458 3985 dbSNP
rs1491484489 3986 dbSNP
rs1491578720 3987 dbSNP
rs1240633095 3991 dbSNP
rs1319244580 3991 dbSNP
rs1179827929 3994 dbSNP
rs55873288 3996 dbSNP
rs1240756467 3997 dbSNP
rs544328595 3998 dbSNP
rs1312456044 3999 dbSNP
rs941756141 4003 dbSNP
rs907556741 4004 dbSNP
rs1221923005 4005 dbSNP
rs983484754 4009 dbSNP
rs1186683467 4012 dbSNP
rs1309810815 4023 dbSNP
rs575099327 4024 dbSNP
rs1221552191 4025 dbSNP
rs1320265818 4026 dbSNP
rs374625808 4029 dbSNP
rs553735033 4029 dbSNP
rs969418006 4029 dbSNP
rs982091301 4029 dbSNP
rs1296424002 4033 dbSNP
rs1432263922 4041 dbSNP
rs930284133 4041 dbSNP
rs917483648 4042 dbSNP
rs541899730 4048 dbSNP
rs1022881498 4052 dbSNP
rs1289863109 4057 dbSNP
rs993038129 4059 dbSNP
rs1435726298 4060 dbSNP
rs1348080814 4063 dbSNP
rs1165183935 4069 dbSNP
rs1245191419 4078 dbSNP
rs1389707116 4078 dbSNP
rs1167020900 4102 dbSNP
rs1430369139 4109 dbSNP
rs1262575111 4114 dbSNP
rs1191090863 4117 dbSNP
rs1487764848 4125 dbSNP
rs1382063778 4126 dbSNP
rs958839376 4129 dbSNP
rs1450431506 4130 dbSNP
rs376122287 4138 dbSNP
rs1318056139 4141 dbSNP
rs1308719148 4142 dbSNP
rs1034492008 4149 dbSNP
rs1295624040 4150 dbSNP
rs574871073 4155 dbSNP
rs998983779 4156 dbSNP
rs1019131208 4157 dbSNP
rs367624757 4157 dbSNP
rs888813701 4158 dbSNP
rs1050601831 4159 dbSNP
rs1020286214 4161 dbSNP
rs930899387 4161 dbSNP
rs1200856211 4162 dbSNP
rs556384846 4163 dbSNP
rs55980984 4163 dbSNP
rs76504312 4163 dbSNP
rs1251540457 4164 dbSNP
rs1382826919 4164 dbSNP
rs899305865 4167 dbSNP
rs1183132682 4168 dbSNP
rs890408452 4170 dbSNP
rs1030645658 4171 dbSNP
rs1224099871 4174 dbSNP
rs376849961 4175 dbSNP
rs1241102676 4176 dbSNP
rs749137723 4183 dbSNP
rs780987820 4195 dbSNP
rs1213225800 4199 dbSNP
rs1397399988 4203 dbSNP
rs200524833 4207 dbSNP
rs769410890 4209 dbSNP
rs1245126129 4211 dbSNP
rs1177748673 4213 dbSNP
rs1472529663 4214 dbSNP
rs928068898 4215 dbSNP
rs941788845 4218 dbSNP
rs1420050064 4219 dbSNP
rs948001952 4227 dbSNP
rs1199579831 4235 dbSNP
rs1310658762 4242 dbSNP
rs1459573874 4242 dbSNP
rs745575229 4242 dbSNP
rs1230154944 4253 dbSNP
rs1258899718 4256 dbSNP
rs1379997554 4260 dbSNP
rs558548800 4266 dbSNP
rs1398419394 4271 dbSNP
rs1312255918 4278 dbSNP
rs1362788194 4282 dbSNP
rs1337417805 4284 dbSNP
rs540542560 4284 dbSNP
rs991383549 4285 dbSNP
rs1383350318 4294 dbSNP
rs878932664 4295 dbSNP
rs1160867187 4297 dbSNP
rs1454615029 4299 dbSNP
rs1186361095 4300 dbSNP
rs1299242237 4300 dbSNP
rs1424546527 4301 dbSNP
rs957325606 4301 dbSNP
rs746285709 4304 dbSNP
rs773007771 4314 dbSNP
rs977266507 4314 dbSNP
rs1167546716 4316 dbSNP
rs143237889 4318 dbSNP
rs1264599112 4321 dbSNP
rs1018639155 4332 dbSNP
rs568419118 4333 dbSNP
rs1361783072 4346 dbSNP
rs1315996612 4347 dbSNP
rs1434453926 4354 dbSNP
rs1324816969 4356 dbSNP
rs1320822486 4359 dbSNP
rs917529703 4360 dbSNP
rs569881081 4377 dbSNP
rs888743373 4377 dbSNP
rs1426952557 4378 dbSNP
rs189664800 4379 dbSNP
rs747428976 4382 dbSNP
rs1263593510 4384 dbSNP
rs1028634209 4394 dbSNP
rs1239905449 4396 dbSNP
rs995468342 4398 dbSNP
rs927452872 4402 dbSNP
rs978884342 4404 dbSNP
rs968829334 4408 dbSNP
rs80026050 4409 dbSNP
rs184393194 4411 dbSNP
rs1228002106 4414 dbSNP
rs1337496027 4416 dbSNP
rs139871782 4417 dbSNP
rs988851390 4441 dbSNP
rs1301910616 4444 dbSNP
rs375989372 4444 dbSNP
rs537040752 4444 dbSNP
rs528886990 4451 dbSNP
rs181621614 4456 dbSNP
rs1186949301 4458 dbSNP
rs1303349656 4460 dbSNP
rs549628975 4465 dbSNP
rs1416978634 4466 dbSNP
rs771479891 4468 dbSNP
rs1169086052 4470 dbSNP
rs1428507720 4470 dbSNP
rs1475456707 4470 dbSNP
rs1365938333 4477 dbSNP
rs1481281111 4478 dbSNP
rs996057825 4480 dbSNP
rs1269381362 4482 dbSNP
rs1053775522 4484 dbSNP
rs936692406 4485 dbSNP
rs1196452727 4493 dbSNP
rs964561233 4497 dbSNP
rs977774903 4504 dbSNP
rs1353392226 4506 dbSNP
rs1225934090 4508 dbSNP
rs1016091206 4510 dbSNP
rs1346734210 4515 dbSNP
rs1167967843 4516 dbSNP
rs1466861510 4518 dbSNP
rs1423970841 4521 dbSNP
rs1440489317 4526 dbSNP
rs531908159 4527 dbSNP
rs569762727 4527 dbSNP
rs1198254260 4528 dbSNP
rs1431166366 4537 dbSNP
rs886221471 4539 dbSNP
rs1481353756 4545 dbSNP
rs1429931014 4546 dbSNP
rs1047914272 4556 dbSNP
rs987157907 4557 dbSNP
rs1013310637 4559 dbSNP
rs143978099 4561 dbSNP
rs1250796728 4565 dbSNP
rs546022836 4567 dbSNP
rs866096287 4570 dbSNP
rs927527457 4574 dbSNP
rs1261295469 4577 dbSNP
rs1205677175 4584 dbSNP
rs527970747 4585 dbSNP
rs947518966 4586 dbSNP
rs1258884311 4594 dbSNP
rs971190375 4596 dbSNP
rs1268060378 4599 dbSNP
rs1222415600 4604 dbSNP
rs963409785 4607 dbSNP
rs753084850 4609 dbSNP
rs749610094 4611 dbSNP
rs1442534405 4614 dbSNP
rs1381625052 4616 dbSNP
rs1334060083 4619 dbSNP
rs1470677562 4634 dbSNP
rs1005548011 4636 dbSNP
rs1158371085 4645 dbSNP
rs506004 4646 dbSNP
rs1409944258 4657 dbSNP
rs1158964129 4659 dbSNP
rs1444188937 4660 dbSNP
rs1303929346 4662 dbSNP
rs1012452768 4663 dbSNP
rs1046616332 4663 dbSNP
rs505938 4667 dbSNP
rs954784217 4675 dbSNP
rs1214335099 4678 dbSNP
rs1348718037 4678 dbSNP
rs1319071630 4679 dbSNP
rs754118108 4679 dbSNP
rs574748617 4680 dbSNP
rs964634788 4683 dbSNP
rs1312470102 4684 dbSNP
rs766508663 4685 dbSNP
rs189270640 4686 dbSNP
rs1454114356 4688 dbSNP
rs1400395375 4689 dbSNP
rs781312763 4692 dbSNP
rs184890417 4693 dbSNP
rs1346918461 4695 dbSNP
rs950624061 4695 dbSNP
rs1159495969 4696 dbSNP
rs192634190 4697 dbSNP
rs1041593490 4700 dbSNP
rs1423774779 4700 dbSNP
rs1379126713 4704 dbSNP
rs1176569807 4708 dbSNP
rs1418424421 4712 dbSNP
rs1236341870 4714 dbSNP
rs1184886263 4716 dbSNP
rs945971800 4723 dbSNP
rs1243211274 4724 dbSNP
rs752152227 4726 dbSNP
rs987251184 4727 dbSNP
rs1289112530 4729 dbSNP
rs1026117856 4735 dbSNP
rs1321983942 4738 dbSNP
rs953235661 4749 dbSNP
rs577442151 4750 dbSNP
rs868449931 4751 dbSNP
rs187790123 4755 dbSNP
rs1404099591 4757 dbSNP
rs1363533927 4765 dbSNP
rs116637066 4767 dbSNP
rs1200073349 4769 dbSNP
rs1354183542 4771 dbSNP
rs1168340303 4783 dbSNP
rs574212284 4786 dbSNP
rs1045403 4787 dbSNP
rs973569676 4788 dbSNP
rs1420843143 4790 dbSNP
rs376444667 4798 dbSNP
rs1271448188 4805 dbSNP
rs1223719884 4807 dbSNP
rs1488571001 4809 dbSNP
rs565975675 4809 dbSNP
rs1234496613 4811 dbSNP
rs1201822018 4813 dbSNP
rs1308812545 4813 dbSNP
rs553793418 4814 dbSNP
rs1278735913 4815 dbSNP
rs1005108441 4816 dbSNP
rs376532485 4821 dbSNP
rs1284905090 4823 dbSNP
rs1387147696 4824 dbSNP
rs1395957042 4827 dbSNP
rs906142727 4831 dbSNP
rs970957097 4839 dbSNP
rs1463578360 4844 dbSNP
rs1043347319 4847 dbSNP
rs1355229318 4850 dbSNP
rs1242987255 4852 dbSNP
rs1175836875 4855 dbSNP
rs1468655669 4856 dbSNP
rs1025256383 4866 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like