miRTarBase - #MIRT023256 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RABGEF1   
Synonyms RABEX5, RAP1, rabex-5
Description RAB guanine nucleotide exchange factor 1
Transcript NM_014504   
Expression
Putative miRNA Targets on RABGEF1
3'UTR of RABGEF1
(miRNA target sites are highlighted)
>RABGEF1|NM_014504|3'UTR
   1 TCACAATTTAGTGGAGAGTATTTATTTGAGCCTAAATTGTAGGTAGCCCTTACTACACTCAACTGATTGGGATCTAGAAT
  81 GTAACTAAATTGCTTATAAATGTCAGAGCATTTTTTAAAGGTACAGTATATGGGGATTGTTTCGTTTTTCCTAGCAGGGG
 161 AACCTTAGTTAATAATAAAATACTACTTATTTGAGTTACTGATACAGATTCATTTAAGGCTTGTGTGCAAATTTTGTCTC
 241 AATCTTTTTTCCCTCCATGATTTTCCTATGTGCTTCCTCTGGCATTCACTGTGGTTTTGGTAAATAATTGCCTTTTAAAG
 321 GATTAAACAAATGAATGCTACAAAGTGTATGTTCAAGAAAATTAAATGGTACCACTCTTCCACAGTTTGGAATAATTTTA
 401 TAATTGTAAAGATAGAAATTATATTGATAAGTAAATATGTAAAATTGTAAATATGTAAAAAAAAGAATGGTGTCTGCTGT
 481 GCATGGCATTTTATATGTTAATTTTTTAGTTTAAAATGAAGTATATTGAATGTTTGCCTTTAGCACCATTTTATTTGGTT
 561 TGTCCCACTAAAATGACTCGAGAAGTGTTTAGACAAACTCCCCTTAAGATGTGCACTCCATCTTTAAGAACGTGTTAGCC
 641 TTAACTTTGAGGTTCTATATAGTCAGAGACTATGACACCACTAAGGTTCAGAATAAAGTTTAGGCCACATAAAATTGCTG
 721 TTTAATGTAGTCGATGGAAGACTTTAAACTATGCTTCTAGCTTATTTTTCCCTCATTCATTCAGCAAATCTCTATTGAGT
 801 TCTTCAGTGAGAAGGAGCAGGCACTGGGCCTGGAATGGAAGGCGGGAATGAATGGGCCTCTGATGGTGAGAGGTGACGGG
 881 GTCCCTCAGCTGTGAGATGCAAGGGGCGCCTTGCAGCCTCCATAATATACATTTGACTTTGCAAACGTCTAGACATGTTT
 961 TCTGAACCTTTTTCAGGACATTTCAACCTCGGGACTATTCATATTAGTGGCCTGAGAGGTGTTTGTTGTGGGGCCACCCT
1041 GTGCATGGTAGAATGTTCAGCAGCATTCCTGCCATCCATATCCATTAGGTGCCAGTAGCACCCCCGCTAGAGCTGTGAAA
1121 AATTCTCTCCAGACATAGTCAGATGTCTCCTGGGGCCATATCACCCCTCCGTTAAGAACCACTGATGTCTTTTACAAACC
1201 AGGAGTTATCCTCCTGGTGGTTAATATGGTGTAACCAAAGAATCTTGCACTCAATGCACAGTGTGATGTTAACTAAAACG
1281 AGTTAAATATTTAGGAGGCTTGACAGCTACCTGCATTGTAGAACCTTTTCTTATCTCAGTGGAACCTTCTATAACCTAAA
1361 TATACCATTGATGATTCTTCTTCCATTCAGTGACATCCACAGATTATGCAGCTATACTTGTGAAATCGTGCATGAGGCCC
1441 CAGGGCACCGTTCTAGAACAACGTCACTTCACACAGGCAGCTGAGAAAGGTTCTCTTGCTTTTCCAGTATCTTCCTAAGG
1521 ATGGAGCCCAAAATTGCAGAGCAGTAACTTTGGAATAAAACCAGGGTGGGTATAAAACTTCTTATTCTTAAATTTACATA
1601 TAAGATCTATTAAGCTTGACACATCTGTGTCATCACGCACTGAAGACAGGAAGCAGTTCACTGAGTCAGCTGGTTCCCAA
1681 GCTCGCACAGAAGGTGATAAGTTACTATCAAATGCCAGTGAGAATCTTCTTATAGAATAACCTGGGCCCAAGTGATTTTA
1761 GTACAAAACTTGCCCTTCTTTGGTTTAATTTTCTATGTGCTTTTAGGTGTGAATCCAGATATGCGGTCTTAATTCCTTTG
1841 GAAATACACAGTTCGTTTAGTTACTGTACACTCTGTTTGTTCAATAAACTGCATATCAACTTCCCACAAAAGCTGACTTT
1921 TTTGGGTCTCTTACATATAAAGTAGGTTATTGAGTTGATTTTTTTGGAGGTATCTCATATTGGTCGAATTCTTCTGGTAT
2001 GGACTCTTGCCTTATATAGAGGCTTCTATTTCTCTTAAGTCAGCATCAATACAACGGCCGGAGTTTCTGTTTTTGCAATA
2081 AGAAGATGTTGGTATTTTATGTAGGGTAAATGTGACTGGAATACACCTTTGGAACGGAATTCTTTATCAATAAAGTTTCA
2161 CAATCCGTCCCTCTTCCAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuugUGGUAACAGUGUGAGGu 5'
               :::| ||| ||||||: 
Target 5' gtttaGTTACTGT-ACACTCTg 3'
1855 - 1875 136.00 -9.10
2
miRNA  3' guuugUGGUAACAGUGUGAGgu 5'
               :|| ||  :||||||  
Target 5' aggtaGCCCTTACTACACTCaa 3'
41 - 62 133.00 -11.30
3
miRNA  3' guUUGUGG------UAACAGUGUGAGGu 5'
            ||| ||      : ||| :|||||| 
Target 5' caAACTCCCCTTAAGATGT-GCACTCCa 3'
594 - 620 133.00 -15.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30147863 3 COSMIC
COSN28866614 22 COSMIC
COSN8034162 25 COSMIC
COSN30461251 49 COSMIC
COSN30460969 50 COSMIC
COSN30131937 58 COSMIC
COSN30104345 89 COSMIC
COSN20104306 107 COSMIC
COSN27638675 383 COSMIC
COSN26555155 446 COSMIC
COSN31552135 463 COSMIC
COSN16128225 527 COSMIC
COSN26551506 586 COSMIC
COSN31569033 604 COSMIC
COSN30540475 630 COSMIC
COSN4922145 683 COSMIC
COSN2231942 754 COSMIC
COSN31962792 843 COSMIC
COSN16148068 1462 COSMIC
COSN6889015 1828 COSMIC
COSN26216936 1984 COSMIC
COSN8305821 2075 COSMIC
COSN8517484 2120 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs556811828 7 dbSNP
rs1362787829 9 dbSNP
rs367574940 14 dbSNP
rs776176843 15 dbSNP
rs1184154470 17 dbSNP
rs761256606 19 dbSNP
rs146288300 23 dbSNP
rs1300215807 39 dbSNP
rs1177698341 40 dbSNP
rs1408789284 41 dbSNP
rs773094696 44 dbSNP
rs1297935040 45 dbSNP
rs762923163 49 dbSNP
rs1391601857 52 dbSNP
rs1469463368 56 dbSNP
rs556276307 58 dbSNP
rs746966622 66 dbSNP
rs1214904854 72 dbSNP
rs542556114 75 dbSNP
rs1288207492 77 dbSNP
rs770257583 81 dbSNP
rs555373818 82 dbSNP
rs1440011429 97 dbSNP
rs1351691776 103 dbSNP
rs56400761 105 dbSNP
rs371472510 106 dbSNP
rs397817016 107 dbSNP
rs147038500 108 dbSNP
rs1304229358 109 dbSNP
rs144768966 109 dbSNP
rs1440105517 123 dbSNP
rs1348005792 124 dbSNP
rs1459107226 130 dbSNP
rs868510655 130 dbSNP
rs1383954264 136 dbSNP
rs1156513122 141 dbSNP
rs1455280963 142 dbSNP
rs572073813 143 dbSNP
rs1192419270 154 dbSNP
rs1454226235 161 dbSNP
rs1245431410 164 dbSNP
rs892337313 174 dbSNP
rs1448007993 175 dbSNP
rs541082357 180 dbSNP
rs1395096999 182 dbSNP
rs1350267470 185 dbSNP
rs1304289565 196 dbSNP
rs1233568532 206 dbSNP
rs865778001 210 dbSNP
rs1445251395 213 dbSNP
rs1333891502 214 dbSNP
rs1378118293 215 dbSNP
rs1245786910 222 dbSNP
rs564068800 225 dbSNP
rs1323784047 229 dbSNP
rs1325680358 230 dbSNP
rs1296092127 241 dbSNP
rs1436223400 242 dbSNP
rs1024917847 245 dbSNP
rs1172492067 252 dbSNP
rs969730901 256 dbSNP
rs544892091 258 dbSNP
rs897301543 267 dbSNP
rs1204880146 288 dbSNP
rs1486777063 290 dbSNP
rs768538831 303 dbSNP
rs35526468 307 dbSNP
rs1210421331 310 dbSNP
rs370106458 316 dbSNP
rs116386978 320 dbSNP
rs1275167260 323 dbSNP
rs1215137753 325 dbSNP
rs1338612335 327 dbSNP
rs541276541 327 dbSNP
rs1458151674 331 dbSNP
rs1006886567 348 dbSNP
rs878993841 354 dbSNP
rs11552461 374 dbSNP
rs1020001713 399 dbSNP
rs1253788118 410 dbSNP
rs1445318903 412 dbSNP
rs919317285 414 dbSNP
rs796556666 420 dbSNP
rs1422311886 422 dbSNP
rs563229309 424 dbSNP
rs988058341 426 dbSNP
rs1168996449 429 dbSNP
rs1476422776 433 dbSNP
rs910697002 446 dbSNP
rs1172187415 449 dbSNP
rs943626103 452 dbSNP
rs988696636 453 dbSNP
rs1043253658 455 dbSNP
rs1452522234 456 dbSNP
rs1020156513 463 dbSNP
rs1381744145 464 dbSNP
rs1256144509 466 dbSNP
rs903562150 481 dbSNP
rs529116200 482 dbSNP
rs978544086 483 dbSNP
rs1295050669 490 dbSNP
rs927055683 491 dbSNP
rs1375010566 492 dbSNP
rs1298252088 494 dbSNP
rs1440763395 511 dbSNP
rs1316146246 537 dbSNP
rs1397488242 556 dbSNP
rs180683961 572 dbSNP
rs1258776333 578 dbSNP
rs892194341 578 dbSNP
rs1463449429 579 dbSNP
rs1419096757 586 dbSNP
rs185076386 589 dbSNP
rs1422317012 590 dbSNP
rs527693692 595 dbSNP
rs916876858 601 dbSNP
rs547859687 602 dbSNP
rs1037233720 614 dbSNP
rs1245458055 616 dbSNP
rs1236397127 619 dbSNP
rs1409037448 630 dbSNP
rs904992962 631 dbSNP
rs1182094738 635 dbSNP
rs1318373362 639 dbSNP
rs1002158696 642 dbSNP
rs373320816 650 dbSNP
rs1307340584 652 dbSNP
rs1222848566 654 dbSNP
rs1374071579 658 dbSNP
rs1304965121 661 dbSNP
rs897353665 665 dbSNP
rs931479807 667 dbSNP
rs567205703 670 dbSNP
rs1456763478 677 dbSNP
rs1048993410 680 dbSNP
rs1064795 685 dbSNP
rs1007348412 696 dbSNP
rs1378568020 708 dbSNP
rs1414429395 714 dbSNP
rs987532989 721 dbSNP
rs910719026 727 dbSNP
rs1174513500 728 dbSNP
rs550141265 731 dbSNP
rs1466811194 732 dbSNP
rs1261064599 736 dbSNP
rs1215510937 746 dbSNP
rs1350992146 756 dbSNP
rs1281883061 757 dbSNP
rs1234296478 758 dbSNP
rs964840812 760 dbSNP
rs1301264803 761 dbSNP
rs1288647554 767 dbSNP
rs553132756 769 dbSNP
rs1364583320 770 dbSNP
rs1289765347 771 dbSNP
rs901159915 777 dbSNP
rs151285636 781 dbSNP
rs936368668 783 dbSNP
rs556104336 791 dbSNP
rs1052542617 794 dbSNP
rs865920741 822 dbSNP
rs1196722528 823 dbSNP
rs1020208411 826 dbSNP
rs572059500 828 dbSNP
rs1299026479 835 dbSNP
rs1262200680 842 dbSNP
rs913531026 854 dbSNP
rs1192619053 857 dbSNP
rs968574452 860 dbSNP
rs949167611 865 dbSNP
rs534365582 867 dbSNP
rs749602838 872 dbSNP
rs978599523 875 dbSNP
rs1253718069 876 dbSNP
rs1034557366 877 dbSNP
rs958498960 879 dbSNP
rs1218288451 882 dbSNP
rs1263298454 888 dbSNP
rs1399716519 889 dbSNP
rs992960396 899 dbSNP
rs1315092976 901 dbSNP
rs564673169 901 dbSNP
rs1189985959 904 dbSNP
rs916951909 904 dbSNP
rs188324334 906 dbSNP
rs972998823 908 dbSNP
rs918833392 913 dbSNP
rs1158469488 929 dbSNP
rs748004020 930 dbSNP
rs1048560593 938 dbSNP
rs1188274054 940 dbSNP
rs1358985868 941 dbSNP
rs572031454 945 dbSNP
rs1253498219 946 dbSNP
rs1421780463 948 dbSNP
rs1481912516 949 dbSNP
rs942826452 950 dbSNP
rs1298970886 951 dbSNP
rs1041505929 971 dbSNP
rs1295480029 974 dbSNP
rs577695871 975 dbSNP
rs1340057312 979 dbSNP
rs1434491052 980 dbSNP
rs1393155109 987 dbSNP
rs1276676613 989 dbSNP
rs75039203 996 dbSNP
rs1219707756 1003 dbSNP
rs1010231508 1004 dbSNP
rs1419785504 1006 dbSNP
rs1041705937 1010 dbSNP
rs1472261894 1016 dbSNP
rs1366289194 1018 dbSNP
rs1308302767 1023 dbSNP
rs1351171731 1027 dbSNP
rs904442958 1030 dbSNP
rs62465660 1031 dbSNP
rs1450681591 1038 dbSNP
rs373149667 1063 dbSNP
rs1456789508 1074 dbSNP
rs1275479339 1075 dbSNP
rs1218811307 1091 dbSNP
rs1355929553 1099 dbSNP
rs1282702200 1101 dbSNP
rs1241415323 1102 dbSNP
rs563117888 1104 dbSNP
rs1396507119 1108 dbSNP
rs958773308 1109 dbSNP
rs112908224 1112 dbSNP
rs1489115232 1116 dbSNP
rs1388300032 1121 dbSNP
rs1024007065 1128 dbSNP
rs1453980625 1132 dbSNP
rs1379182967 1134 dbSNP
rs961721417 1148 dbSNP
rs773815765 1152 dbSNP
rs1438391014 1156 dbSNP
rs1441860802 1157 dbSNP
rs775793835 1158 dbSNP
rs1200184284 1159 dbSNP
rs1451462885 1166 dbSNP
rs140498015 1169 dbSNP
rs116038845 1170 dbSNP
rs1354630661 1171 dbSNP
rs1285400721 1172 dbSNP
rs181147939 1179 dbSNP
rs1325657994 1180 dbSNP
rs1435630258 1185 dbSNP
rs1329186579 1186 dbSNP
rs1319989235 1188 dbSNP
rs185592345 1194 dbSNP
rs1359430252 1198 dbSNP
rs984752253 1201 dbSNP
rs1350503859 1215 dbSNP
rs761244789 1216 dbSNP
rs547502779 1218 dbSNP
rs1395157065 1223 dbSNP
rs558250257 1225 dbSNP
rs1041167632 1228 dbSNP
rs922687936 1230 dbSNP
rs1441578153 1234 dbSNP
rs1195695917 1249 dbSNP
rs926093637 1253 dbSNP
rs1262809921 1260 dbSNP
rs1214714764 1261 dbSNP
rs764646351 1278 dbSNP
rs1279400285 1279 dbSNP
rs1218603909 1288 dbSNP
rs1342739942 1297 dbSNP
rs754182124 1314 dbSNP
rs956307152 1317 dbSNP
rs533240276 1334 dbSNP
rs1448804826 1340 dbSNP
rs989044835 1344 dbSNP
rs191714111 1345 dbSNP
rs570221432 1350 dbSNP
rs536094839 1361 dbSNP
rs1359258790 1364 dbSNP
rs1279903978 1367 dbSNP
rs560731904 1373 dbSNP
rs1226225180 1375 dbSNP
rs1291438693 1376 dbSNP
rs1478390603 1379 dbSNP
rs1423313820 1381 dbSNP
rs1321740100 1383 dbSNP
rs1198579476 1390 dbSNP
rs767094176 1403 dbSNP
rs926347883 1405 dbSNP
rs1238158651 1406 dbSNP
rs549694693 1410 dbSNP
rs1000146758 1427 dbSNP
rs1275104007 1432 dbSNP
rs1219166416 1448 dbSNP
rs150148487 1449 dbSNP
rs1276014764 1455 dbSNP
rs1237233704 1458 dbSNP
rs929221177 1460 dbSNP
rs775107000 1461 dbSNP
rs1165171312 1462 dbSNP
rs762207761 1471 dbSNP
rs1465106798 1491 dbSNP
rs1014496631 1503 dbSNP
rs1398099118 1506 dbSNP
rs534592980 1508 dbSNP
rs775563784 1512 dbSNP
rs557431518 1514 dbSNP
rs1355766089 1521 dbSNP
rs577592251 1525 dbSNP
rs1018132654 1526 dbSNP
rs536703324 1527 dbSNP
rs1168937116 1529 dbSNP
rs1425788691 1532 dbSNP
rs1445383917 1537 dbSNP
rs993185851 1544 dbSNP
rs1414732688 1555 dbSNP
rs760740556 1564 dbSNP
rs1000211645 1566 dbSNP
rs1240068431 1567 dbSNP
rs1199247504 1568 dbSNP
rs1457232832 1569 dbSNP
rs1033150397 1571 dbSNP
rs556649590 1580 dbSNP
rs956200884 1583 dbSNP
rs1027292141 1595 dbSNP
rs1311646936 1598 dbSNP
rs989509256 1601 dbSNP
rs951781616 1604 dbSNP
rs1217548939 1608 dbSNP
rs758339585 1616 dbSNP
rs573494058 1619 dbSNP
rs1255584413 1620 dbSNP
rs1374941596 1622 dbSNP
rs984426803 1623 dbSNP
rs377595658 1624 dbSNP
rs1199776752 1626 dbSNP
rs1329750232 1630 dbSNP
rs559201553 1635 dbSNP
rs573089960 1636 dbSNP
rs1164398184 1637 dbSNP
rs977327012 1643 dbSNP
rs1238334519 1644 dbSNP
rs1477610542 1654 dbSNP
rs926254599 1659 dbSNP
rs1179260395 1660 dbSNP
rs751648730 1671 dbSNP
rs946126208 1672 dbSNP
rs937747710 1678 dbSNP
rs1192842279 1682 dbSNP
rs977489447 1683 dbSNP
rs183491561 1684 dbSNP
rs1168374686 1685 dbSNP
rs935998288 1686 dbSNP
rs1318311481 1694 dbSNP
rs1286119056 1700 dbSNP
rs1412613035 1708 dbSNP
rs781317612 1711 dbSNP
rs929151674 1713 dbSNP
rs1055749344 1714 dbSNP
rs28619031 1716 dbSNP
rs1293254732 1717 dbSNP
rs1434584770 1722 dbSNP
rs1398974147 1723 dbSNP
rs949961016 1723 dbSNP
rs1419248128 1726 dbSNP
rs868549956 1730 dbSNP
rs1378515066 1731 dbSNP
rs1178198198 1732 dbSNP
rs1433650189 1735 dbSNP
rs1275792674 1736 dbSNP
rs111823104 1740 dbSNP
rs1189179322 1749 dbSNP
rs944589982 1754 dbSNP
rs1263531907 1757 dbSNP
rs1215441619 1758 dbSNP
rs1341785229 1769 dbSNP
rs897635951 1771 dbSNP
rs993238101 1772 dbSNP
rs1039027715 1773 dbSNP
rs1236101579 1779 dbSNP
rs550287276 1794 dbSNP
rs1217892747 1799 dbSNP
rs887484108 1808 dbSNP
rs1274709123 1813 dbSNP
rs563817917 1815 dbSNP
rs187212173 1822 dbSNP
rs1007642445 1848 dbSNP
rs112627693 1852 dbSNP
rs964662912 1854 dbSNP
rs751685722 1863 dbSNP
rs1173858319 1869 dbSNP
rs1424034057 1872 dbSNP
rs3837081 1872 dbSNP
rs397841220 1872 dbSNP
rs3778911 1883 dbSNP
rs1265451355 1888 dbSNP
rs967521617 1888 dbSNP
rs1024865724 1889 dbSNP
rs1257699249 1892 dbSNP
rs1200470820 1898 dbSNP
rs1482635209 1902 dbSNP
rs1255993747 1903 dbSNP
rs199632155 1904 dbSNP
rs200751177 1905 dbSNP
rs1064801 1906 dbSNP
rs1222188229 1914 dbSNP
rs1320502275 1916 dbSNP
rs762600300 1916 dbSNP
rs1218282761 1921 dbSNP
rs1338617302 1924 dbSNP
rs1314961428 1936 dbSNP
rs1396738839 1939 dbSNP
rs1198247015 1941 dbSNP
rs971691630 1942 dbSNP
rs1377061579 1943 dbSNP
rs1400793372 1943 dbSNP
rs11028 1947 dbSNP
rs1174149911 1951 dbSNP
rs926022433 1957 dbSNP
rs1375796368 1968 dbSNP
rs528749441 1972 dbSNP
rs1187809216 1977 dbSNP
rs1422770001 1978 dbSNP
rs1253430869 1982 dbSNP
rs145563422 1984 dbSNP
rs571118070 1985 dbSNP
rs991903656 1986 dbSNP
rs1295901773 1990 dbSNP
rs1259112021 2012 dbSNP
rs915893289 2017 dbSNP
rs1198347582 2027 dbSNP
rs1060527 2042 dbSNP
rs1267531386 2048 dbSNP
rs556637181 2051 dbSNP
rs567051666 2054 dbSNP
rs1448950553 2055 dbSNP
rs117778448 2058 dbSNP
rs552716267 2059 dbSNP
rs1304663869 2067 dbSNP
rs1048844940 2073 dbSNP
rs1463929136 2077 dbSNP
rs887524328 2092 dbSNP
rs191967044 2096 dbSNP
rs944640474 2108 dbSNP
rs1353374027 2109 dbSNP
rs1007287181 2111 dbSNP
rs1224464281 2121 dbSNP
rs1017701593 2130 dbSNP
rs921976886 2132 dbSNP
rs1060528 2134 dbSNP
rs1265325226 2135 dbSNP
rs998461466 2137 dbSNP
rs891892809 2138 dbSNP
rs1029917750 2144 dbSNP
rs1436475185 2145 dbSNP
rs1269891230 2149 dbSNP
rs1200851018 2151 dbSNP
rs1210684901 2162 dbSNP
rs1289691453 2165 dbSNP
rs1395473956 2166 dbSNP
rs1438781930 2167 dbSNP
rs1354495130 2171 dbSNP
rs1308495361 2178 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*