miRTarBase - #MIRT023246 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TBL1XR1   
Synonyms C21, DC42, IRA1, MRD41, TBLR1
Description transducin beta like 1 X-linked receptor 1
Transcript NM_024665   
Expression
Putative miRNA Targets on TBL1XR1
3'UTR of TBL1XR1
(miRNA target sites are highlighted)
>TBL1XR1|NM_024665|3'UTR
   1 CGCTACTAGTTGGAAGCCATGGACCGACTATGAATGTGTACATAGCCAAAATGACTGTCCCTGACCCATGTACTGCTATA
  81 GTCCCACTTGAACCATGGCCAGTCCACTACAGCCAAATCTAAAAGAAATATATACATACAGTGTATATAAACAAAATTGC
 161 ACCCTGAAGATGACAGAGTTTTGTCACAGCTTGTGAATTCTGTTCACCAAGTGCTGGAATCTAATCTGCTGTGCCCCTAA
 241 AATAGCATTTAGAAGTTTTGGATATGAAAAACAGAAGAGAGAAAAATATACATTATAAAAGCAGAACATACATGTACCAG
 321 TTTTTGGATACTAAATGACAGCCTTGTTTCTCCCCTTTGAATCAGCAGACACCATGGATTATATTCTTTTTTTCCCTTCA
 401 GTAGTGAGCAGTTTGTATGTACAGAGAAAATGGACTTACAAAAACTTGCAGCAGTAGTTTGTTCTTGCTTTAAAATTTCG
 481 TTTTTGGTTTAGATTATGGATGCATGAAGTAAGGGAGTGAATCAGTTTCTTGTTTATATTTTTTTCACCTTTTAAACAAA
 561 AAATTCTTTAAAATATTTTAATGCATTCTTTTGAAGAGGTAGATGTTTGGTACATTTTATGGCTCCCAGAGCATATATTC
 641 AGTTGGTGCATGTTGTGGAAGGGGGAATTGGAAATTAAATGAAAACCTATGACTTTGGTCATGTCAATCTGTAAGACACA
 721 TCAGTAAAAGGGTATTATGCTCTGTTGGTTTTGTTTTTTTGTTTTGCTTTTTTTTTTTTTTTTTCTTTTTTGTTTTTTGG
 801 TGATGTGGCTTAAATGCAATAGTTTCTTTTTTGGGACATATTTCTGCCAATTAAAGACTAGAAGGGCACAACTTTTTTTT
 881 TAATTACCATAGAGAAGATACATTAAAAAAAATCTTCTGATGTTTTGTAGCCATAACTAAATTATGGTAAAAATGTGCAC
 961 TATTGTGAAAAGGAGCAACGTAGTTTTGGGTTTTTTGTTGTTTGTTTGTTTTGCTTTGTTTTTTAAGAGATTAAAATGTT
1041 TCTGGATAAGGATTAGCTTCTCGAAGTGTCCATCATTCTGTGTAGAAGCTTAAATATGTAATGTAACCAAACTCCAGTAT
1121 TAAAAATCTCTCATGTTGTTTTCTTTATACAAAGCAAGATAACGGCATATAACACTGCCATTACATGGCAAAATGTTTGC
1201 TACCTTAGTTTAAAAAACAATCTCAAACAAAAGACTTGCTTCAAGGTGTTTTTAAATAGCAGTGATTCAGAATTTTTTTT
1281 AATGAAAGTATAATTGCACTAACCTTCTTCCTGCTGCTCTGATTCTGCATTTGTGGTACTTGTGACTACGTTTTTTCAAA
1361 TATAGATAGATTTAAGCTGCTAATTTTTTTTTTTTTAGTAATCACTACTATATCATGTCTTTTACTCTGTTTATAATATC
1441 AAGTATTTTCTTAAAGATATAGATATTAAACCTTGTGCTCATGCAACTTAGAGTAACATATACAGACAAATGATTGCATG
1521 AGGCCATGTTTATATGTGTGACTAATAAGGCTTGTCATGATTAACATAATCCAGGTATGTCATTTCTGAAGAGAATAGTC
1601 ATCAAATTTATATCTCGAAGATTTTAATTAAGGAATTGCTTATTGTTGAGCTTAGCAAATTAATAACACTATTTCTGTCA
1681 CTAATTATTTTGAGGCCTTTTAGTACTAAAATTTTAACCTGTGTTCTAAGTAGAAACTGATTTAACCCAAGTAATGCAGC
1761 TTTGATTGATTTCAGCATTCGTTGCTTTGCTATTTTTACAAAACAGCATTGATTGAAGCAAGTCTTGGTTTTACTAAGGT
1841 AGGGTAGCATTTGCTATTGGTAAAGAGAATAAATACACTTAATTTCACAATACATTGTTATATGTACCCCAGTTGTTGTT
1921 AGTGGGGACTATGATACTGTAATAATATTTTTAAAAATTTACATCAAGAGAGGCAGTCATTCACGATGGTTTTGTGCCAG
2001 CTCTTTTTAGGGTTTTGGATCACATTAGAGATATTTAGAACATATTACCCTGTGACTTACGTAGGAAACCTAATATGCTG
2081 AGTATCTGGCACTTGAATTCCTGCTTTTATTGCTGGAGGTCCACATCTGTGGTTGACCTCTGTTATTGTTTAAAAAAAAT
2161 AAATAAAAATTAAAAAAATCTGTGCAATAATTTTAAAATGTGCTCCCAGGAATAGACACAAATGTTTTGAGTATCTTTTA
2241 AGCTGCATTTTCCTTTAGTGATGCATTTGTCAATTGCACTGAATTTAAATCTGAAAGTCAGAGGTGATTATTGATAGTAC
2321 TTTTGTATTTTGATATGGACAGTTTATTCATTTGCATACAGTTATTGACTTTTTCCCAGCTGATTAAAAGATAGTCAAGA
2401 AATTCTGCAATATAGCTGCCAAAATAGACAGCTACATTTTTATGATATTGTCATCTTTTCTGTTTTTTTTTTCTTTTTTT
2481 TCTTTAGCTATTTTACTTAAGCATAATAGCCACAATAGGACATATAAAAGATTATAAATACAGAGCTTTATTATCCTGAC
2561 GTCTTGGGTCTTTTAAGTATATACTTTTCTGAAAGGTATCCATTTTGTAGGCTTGGGTTCTTCATGAGCATACGATTGTT
2641 TATTTTTGCTGCTGTTCTCAACATCATCATTGCCTGCTGATGTGCCACGATGCTGCTCCAATAGACAGCAATAAGATTGT
2721 CTCTAATTTGAGCAGTAACATGATTGCAAGAGACCAAGTTTCACAGCTTGTAAAGTTCTGTATTTGGGATTCTTGCTTAT
2801 TTTTCCGCCTGTGTTTTTCTGAGAACTTATTCCTGATGATCAATTGAATCCAGTAGTTTTTCTATGCTATTTGTTGTTGT
2881 ATAAGCTACTGTAAGAAACTTATCATAAGGAAAAATAGAAAGGAAAACTTGAATCAATACTCATTGATTAAAATGGAATA
2961 AAGAAAGAGCAGCTGCCACTTTTAAACAACATAAAGGAATATCTTTTTTTGTCTCCGTGTAGGAAATCCCATAAGTTCTT
3041 ATATTTGTTCCAGTTCCCATTTCCTGCCATTGACCAGATAACATCATTGACTTTCAAATGACTTTTAGAAGTGATAACTC
3121 TTAATTTCCTAATAGATACTAGATTGTATTGAATTCTGTTTTAATTATTCTCTAGGTAAGTATGTTTTAGGATTAAATAC
3201 CTTTTACAGATACTGAAAGTGCCTCCTTTTGTGGTGTAAAAAACAAATTATGGTGCAAAAAGTAATCACTAGATTGAAAT
3281 ACATGAAGGTTTTTTGCTTTTTGACATACGAAAATGTCAAGAGAAAGGCCAAAGATTTGTACTTTTTCACTTACAAAGCA
3361 CTCCTTTTTCCCTTAAACTTCTTTCTGTCAAATTAGATTTAATGAGAGAGTACTATTTTTAAGGAGCTATCTGTTTATGT
3441 AGAATGATTTTGTTAAGAGTAATGTAAACTATTATTGAGTAGAGGCCTAAAGAGGACTGTGCATTTTTGCTATTTAAAGG
3521 AATCACAAATGATCATACTTAAGTGAGCAAAAATGACAAGTTTTACTAGCTAAGTAGAGAAATAAATCTCAAATGCAGCG
3601 CTACAATTTTCATTATCTTAAGTACATTGTACATTTCTACAGAACCTGTGATTATTCTCGCATGATAAGGATGGTACTTG
3681 CATATGGTGAATTACTACTGTTGACAGTTTCCGCAGAAATCCTATTTCAGTGGACCAACATTGTGGCATGGCAGCAAATG
3761 CCAACATTTTGTGGAATAGCAGCAAATCTACAAGAGACCCTGGTTGGTTTTTCGTTTTGTTTTCTTTGTTTTTTCCCCCT
3841 TCTCCTGAATCAGCAGGGATGGAAGGAGGGTAGGGAAGTTATGAATTACTCCTTCCAGTAGTAGCTCTGAAGTGTCACAT
3921 TTAATATCAGTTTTTTTTAAACATGATTCTAGTTAAATGTAGAAGAGAGAAGAAAGAGGAAGTGTTCACTTTTTTAATAC
4001 ACTGATTTAGAAATTTGATGTCTTATATCAGTAGTTCTGAGGTATTGATAGCTTGCTTTATTTCTGCCTTTACGTTGACA
4081 GTGTTGAAGCAGGGTGAATAACTAGGGCATATATTTTTTTTTTTTTTGTAAGCTGTTTCATGATGTTTTCTTTGGAATTT
4161 CCGGATAAGTTCAGGAAAACATTCTGCATGTTGTATCTAGTCTGATGTACTTATCCATCTCATTACAAACAAAAACACAC
4241 AGACTGCATTTGTAGCTCTGTAATCCTTGAATACGGAAGTAAATTTTCTTCTTTCCTGACTTTGACATTGTAGCTATACT
4321 GTTTCCATTTTTGTTTTTACAAATCCTTTGGGTCTAATTCTGTGAGCCTACCTATAGCACTGGATTAAAATGTCTGCATC
4401 ATTTCTTTAGTTATCCAGTTAACTTTAAAACTGTTGTAAAAGTGTAAACCAGCCCATGACAGGTTTTTGTACATGTTAAA
4481 GAACTTCATTGTTCAGTTTTCATGATTATTGTGTAAGGAAGACTGATGTAGATGTTCTGTGCTGTCCTGGACCATGTTAA
4561 TTACACTTACGACGTATTTTAGTTCCACATCACAATGATTTGTCCCCAGTGACCCTTTTATCCTTTCTAGGCACATTTCT
4641 TGTTGTTGTTGTTGTTGCAGTTCCCCTTTGCATTGTATTGCTTTGACAACTGTAATTTGAATCAGATCTGAAAGAGGTCC
4721 AGAATAAAATATATTTTGATATTATGTTGGCTGTGTACATATATAAAACCTTTGATGTCTATGTAGTTTATATAGACTAT
4801 TTACTAGTCAGGTAAAGAGAGAGGGATGGTATTTCTTGTTTACAGTTTGTTTACATTTTAATTGCTTTTACTTCTCCAGT
4881 GTTCTATTGTAGAATAAACCTTTTTTTCCAAGTTAGCCTTCATAACCTATAACACATTCATTCTCTCCCATACTGGTGTT
4961 ACTGATTAATAACTGCCATCAGAACCCAAACCACTGTTTTTCATAAACGTATTGTTTCCCAAGATATATACTTTAAGCCC
5041 ATAATAAAATTACAAATTTTACTATTTTTATTACTTCTTGCAGGAGATAAGATTTTTTTAAATGAAGGGGTTATTTACTA
5121 TTTTTATTAAAGTATAATAGAGCATCTAATCAGCTAAGGGATTGTAATTTTTAATTCTTTTGAAAAATAAATATTGTATT
5201 TAAAAGACGTTATTTCACAGAAGCTGAAAAAGAGACCTTAGATAACATTTGTTTGGTTAGCCACACGGTTGAGCACAAAA
5281 CAATGTGTAGATGTGTTGAAGATTAGGGCAGGAGGCTCAACTTCTCGGTGACCTTTTTTTGCTTCACAACAAGCCAATTA
5361 TAGTTGAATCATTTTCTCTCTTAGCTAGTTGTTACTACAAACTTTATAAGAAAAACAACTAGACACCTTCTAGTTTTAAT
5441 TAATACCAACTCCTTTAGAGTTAGAGACTTTTTAAAAAGAATCATTGAGCATATTTTCTTTTTTTTTTTTTTAAGAATTT
5521 ACACTCTCTAGGTCTTCTATTTTTCCTGTTTATTTCCTTAAACAGAAATAAATTCAAGCATAGTTTTATGTTTTATTAGA
5601 AATAAGCCACTGCAGTTGCTAGAACTGACATGCTTTCATTTTCAAGGGGTTAACTTTTATTGCATGGCATAGATTATTAG
5681 TAATATCCTGCATTGTATACTTTTCCAAAAAGGGTTGGACTCCTAAGGATTAGAATCCTTATAAGCTTGAGGGAAAGCTG
5761 AAACTAATTTGAACAGTAATAGAAGGGATTATTTTTAATTTCATAGTTAACACTTTACAATGGATTAGATTTATTACCTA
5841 GTATAATCCGTAGCAGATCAGATCAAAGTTTACTGTTTTACCAATATATTCATTTGAAAAAATACAGTGGAGGAAAAGAC
5921 ACTTTAGATGGTAGTTTTATGGTGCTTTTCTCTGCTGTACCAAAGTGCTTTGTCATCAATGAAATGTTAACCCTATGCTA
6001 CTTTTTCTGCATGCTTCTTAAATGTCATCTTAATGCTTAATTGTCCTAACTTGTAATATTTTTGTATTAAATTTTTTTAG
6081 GAGTTCCTTGTAATTTCTTTACAATTTAAAATATATTAAACACAAAGTGTTTAGTAAAGTACAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |::| |||||| |||:|:| 
Target 5' taAGTA-CATTGT-ACATTTCt 3'
3619 - 3638 134.00 -13.00
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            || |  ||  |:||||||: 
Target 5' ttAAGA--AT--TTACACTCTc 3'
5511 - 5528 132.00 -8.90
3
miRNA  3' guUUGUGGUAACAG-UGUGAGGu 5'
            ||: :||| ||: |||||:: 
Target 5' ttAATTTCATAGTTAACACTTTa 3'
5795 - 5817 132.00 -11.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN14047925 1 COSMIC
COSN31537208 2 COSMIC
COSN18728078 11 COSMIC
COSN30500692 39 COSMIC
COSN30113352 51 COSMIC
COSN30516641 78 COSMIC
COSN30517987 110 COSMIC
COSN14047923 116 COSMIC
COSN31514129 125 COSMIC
COSN30127807 141 COSMIC
COSN30115472 154 COSMIC
COSN31584585 200 COSMIC
COSN15661291 380 COSMIC
COSN31490198 399 COSMIC
COSN30174668 424 COSMIC
COSN26549728 523 COSMIC
COSN31607183 654 COSMIC
COSN31542964 724 COSMIC
COSN20090951 761 COSMIC
COSN28719507 766 COSMIC
COSN28709250 767 COSMIC
COSN19662214 785 COSMIC
COSN20099412 872 COSMIC
COSN23710792 894 COSMIC
COSN7837226 954 COSMIC
COSN31602613 971 COSMIC
COSN31596100 998 COSMIC
COSN15140785 1010 COSMIC
COSN32064005 1042 COSMIC
COSN31569666 1117 COSMIC
COSN26463584 1135 COSMIC
COSN29873409 1164 COSMIC
COSN31549455 1222 COSMIC
COSN30543362 1228 COSMIC
COSN28201084 1276 COSMIC
COSN22340578 1280 COSMIC
COSN28201086 1323 COSMIC
COSN31535996 1333 COSMIC
COSN30335352 1350 COSMIC
COSN31959897 1461 COSMIC
COSN7627395 1951 COSMIC
COSN1933060 1963 COSMIC
COSN31544663 1985 COSMIC
COSN20687228 2003 COSMIC
COSN31561834 2040 COSMIC
COSN31549040 2065 COSMIC
COSN1933059 2084 COSMIC
COSN31594012 2114 COSMIC
COSN31523891 2143 COSMIC
COSN31523873 2147 COSMIC
COSN31607685 2151 COSMIC
COSN31568130 2156 COSMIC
COSN5528909 2267 COSMIC
COSN31520404 2282 COSMIC
COSN28725368 2338 COSMIC
COSN26677352 2340 COSMIC
COSN31521876 2462 COSMIC
COSN31535995 2673 COSMIC
COSN31485223 2762 COSMIC
COSN30173907 2829 COSMIC
COSN15407948 2922 COSMIC
COSN31550762 2928 COSMIC
COSN31584991 3038 COSMIC
COSN31549450 3126 COSMIC
COSN31568982 3190 COSMIC
COSN26646799 3222 COSMIC
COSN26645167 3228 COSMIC
COSN31547812 3381 COSMIC
COSN31528287 3599 COSMIC
COSN28675159 3623 COSMIC
COSN31584799 3660 COSMIC
COSN31485741 3807 COSMIC
COSN15662493 3814 COSMIC
COSN31553390 4073 COSMIC
COSN20099408 4114 COSMIC
COSN6755228 4574 COSMIC
COSN17676982 5140 COSMIC
COSN17215128 5206 COSMIC
COSN25512469 5285 COSMIC
COSN9535655 5466 COSMIC
COSN7627393 5522 COSMIC
COSN21291200 5809 COSMIC
COSN6572968 5820 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs772530865 1 dbSNP
rs746182305 2 dbSNP
rs1425608924 4 dbSNP
rs757648589 8 dbSNP
rs1161462045 9 dbSNP
rs1441249261 17 dbSNP
rs367636842 18 dbSNP
rs1485736268 19 dbSNP
rs777331745 20 dbSNP
rs1417198146 26 dbSNP
rs547301798 36 dbSNP
rs1268921704 40 dbSNP
rs1199488594 41 dbSNP
rs1333932445 42 dbSNP
rs1490087638 47 dbSNP
rs375368882 48 dbSNP
rs1212576741 59 dbSNP
rs1013682864 64 dbSNP
rs895377507 74 dbSNP
rs1422883069 76 dbSNP
rs1187230677 77 dbSNP
rs1364760898 78 dbSNP
rs1327569353 84 dbSNP
rs371995470 86 dbSNP
rs1287915738 92 dbSNP
rs1443248858 93 dbSNP
rs1157422267 94 dbSNP
rs748543955 103 dbSNP
rs1359970222 106 dbSNP
rs1435477054 116 dbSNP
rs188090374 119 dbSNP
rs942164013 125 dbSNP
rs887977940 130 dbSNP
rs781609302 131 dbSNP
rs1329246927 139 dbSNP
rs556540273 141 dbSNP
rs1386346228 142 dbSNP
rs1047838509 148 dbSNP
rs1347959836 150 dbSNP
rs1393638553 154 dbSNP
rs929365753 157 dbSNP
rs1253768726 159 dbSNP
rs923355883 170 dbSNP
rs1196064933 173 dbSNP
rs1165614406 176 dbSNP
rs1462800293 185 dbSNP
rs183432695 200 dbSNP
rs1380160223 201 dbSNP
rs1455091199 231 dbSNP
rs1178279132 250 dbSNP
rs1376023170 262 dbSNP
rs943382946 273 dbSNP
rs1157590985 274 dbSNP
rs1444378553 279 dbSNP
rs1371589359 281 dbSNP
rs1388468739 282 dbSNP
rs1298532973 285 dbSNP
rs1470310270 287 dbSNP
rs1311145371 288 dbSNP
rs1227693340 289 dbSNP
rs1259649563 291 dbSNP
rs1315693904 308 dbSNP
rs911119339 314 dbSNP
rs577677315 316 dbSNP
rs1237990339 320 dbSNP
rs1489066228 328 dbSNP
rs751107861 333 dbSNP
rs1268570406 334 dbSNP
rs1212005043 337 dbSNP
rs1193479901 343 dbSNP
rs985371722 347 dbSNP
rs1196113037 350 dbSNP
rs760490162 351 dbSNP
rs752420789 352 dbSNP
rs767501359 353 dbSNP
rs957865209 354 dbSNP
rs1032097850 363 dbSNP
rs1169635879 366 dbSNP
rs1395005790 367 dbSNP
rs1459351668 370 dbSNP
rs978337604 374 dbSNP
rs1366268562 387 dbSNP
rs1467690625 389 dbSNP
rs1382237778 393 dbSNP
rs966457290 394 dbSNP
rs765835070 395 dbSNP
rs1217662614 397 dbSNP
rs759377593 402 dbSNP
rs1257803006 414 dbSNP
rs1322744753 415 dbSNP
rs1224424756 424 dbSNP
rs1264261513 438 dbSNP
rs773407015 439 dbSNP
rs1025165526 449 dbSNP
rs149609432 450 dbSNP
rs1216145797 454 dbSNP
rs7616373 464 dbSNP
rs1284017743 467 dbSNP
rs1406930591 470 dbSNP
rs1162443342 479 dbSNP
rs1224488925 480 dbSNP
rs867422131 481 dbSNP
rs894843167 484 dbSNP
rs1299448471 495 dbSNP
rs1358133060 497 dbSNP
rs750016079 499 dbSNP
rs1380335835 510 dbSNP
rs1033922229 513 dbSNP
rs1311038426 525 dbSNP
rs1321601680 529 dbSNP
rs1006515820 530 dbSNP
rs765017169 537 dbSNP
rs1288212989 538 dbSNP
rs1487387718 540 dbSNP
rs191817390 542 dbSNP
rs1216146734 546 dbSNP
rs1232583537 551 dbSNP
rs1397622657 557 dbSNP
rs1179859357 561 dbSNP
rs1412833128 564 dbSNP
rs1440214517 565 dbSNP
rs1377948159 566 dbSNP
rs796968918 569 dbSNP
rs1312974666 580 dbSNP
rs1047855309 582 dbSNP
rs1445402600 583 dbSNP
rs1326441364 585 dbSNP
rs1443053271 591 dbSNP
rs144236885 603 dbSNP
rs1317390610 616 dbSNP
rs1241501683 626 dbSNP
rs1401130021 643 dbSNP
rs1312172098 658 dbSNP
rs549340350 663 dbSNP
rs1352163653 674 dbSNP
rs1239427952 676 dbSNP
rs901903158 684 dbSNP
rs1040881858 686 dbSNP
rs1386675136 689 dbSNP
rs943369623 697 dbSNP
rs776470736 703 dbSNP
rs1054389679 707 dbSNP
rs936558587 718 dbSNP
rs1172616021 720 dbSNP
rs1426694461 722 dbSNP
rs78093177 732 dbSNP
rs567618807 738 dbSNP
rs1447905453 739 dbSNP
rs977930902 739 dbSNP
rs1448221664 747 dbSNP
rs371283137 748 dbSNP
rs1216952963 749 dbSNP
rs1333787759 750 dbSNP
rs1375271308 751 dbSNP
rs1018513693 753 dbSNP
rs1275487631 754 dbSNP
rs1347272822 755 dbSNP
rs1217688328 760 dbSNP
rs372185635 761 dbSNP
rs1330654284 765 dbSNP
rs1200224683 766 dbSNP
rs891259501 767 dbSNP
rs372049900 768 dbSNP
rs551017392 774 dbSNP
rs1457228278 778 dbSNP
rs1199539377 779 dbSNP
rs1247942650 785 dbSNP
rs1423807657 785 dbSNP
rs1467009853 785 dbSNP
rs1476788700 785 dbSNP
rs148659524 785 dbSNP
rs1491076346 785 dbSNP
rs201627324 785 dbSNP
rs879217781 785 dbSNP
rs966971453 785 dbSNP
rs780581150 790 dbSNP
rs1434328200 791 dbSNP
rs1258577255 792 dbSNP
rs866583640 792 dbSNP
rs1348632448 793 dbSNP
rs1220721591 799 dbSNP
rs1491283415 799 dbSNP
rs1236329476 800 dbSNP
rs1255897212 800 dbSNP
rs1491390992 800 dbSNP
rs1362925075 809 dbSNP
rs917663267 816 dbSNP
rs1263294718 819 dbSNP
rs1478583805 821 dbSNP
rs1421932332 826 dbSNP
rs1431152119 827 dbSNP
rs1346793857 830 dbSNP
rs1164216498 833 dbSNP
rs537140179 833 dbSNP
rs1404129818 836 dbSNP
rs992353112 838 dbSNP
rs959022530 844 dbSNP
rs1326087726 850 dbSNP
rs138323555 859 dbSNP
rs1285761320 867 dbSNP
rs1174964463 871 dbSNP
rs1427341190 873 dbSNP
rs1419389663 880 dbSNP
rs1187667751 881 dbSNP
rs1005896605 882 dbSNP
rs1213992410 882 dbSNP
rs777025983 882 dbSNP
rs1476566366 887 dbSNP
rs952243199 905 dbSNP
rs187377834 910 dbSNP
rs1370587506 913 dbSNP
rs993662573 913 dbSNP
rs368052605 914 dbSNP
rs1163554770 918 dbSNP
rs1161386886 927 dbSNP
rs1380984188 947 dbSNP
rs1421528409 953 dbSNP
rs1296423720 955 dbSNP
rs867197714 962 dbSNP
rs1040451115 979 dbSNP
rs1282803960 980 dbSNP
rs1007560623 981 dbSNP
rs1338523327 988 dbSNP
rs889207392 988 dbSNP
rs551947063 990 dbSNP
rs1355786741 997 dbSNP
rs1054357120 1003 dbSNP
rs528718994 1007 dbSNP
rs774598072 1011 dbSNP
rs771154419 1012 dbSNP
rs1201875434 1033 dbSNP
rs1258670283 1036 dbSNP
rs1203102146 1038 dbSNP
rs936022252 1060 dbSNP
rs183314004 1062 dbSNP
rs542864511 1064 dbSNP
rs552329726 1066 dbSNP
rs1042728146 1081 dbSNP
rs749527496 1086 dbSNP
rs773637241 1087 dbSNP
rs1156877910 1092 dbSNP
rs1363735124 1096 dbSNP
rs1291228881 1097 dbSNP
rs1414005114 1098 dbSNP
rs1355695081 1108 dbSNP
rs1466715485 1109 dbSNP
rs917781549 1114 dbSNP
rs992005964 1116 dbSNP
rs1314376092 1125 dbSNP
rs529562958 1126 dbSNP
rs199871601 1127 dbSNP
rs754249310 1127 dbSNP
rs1378972448 1131 dbSNP
rs13065166 1139 dbSNP
rs926370823 1144 dbSNP
rs1312309007 1150 dbSNP
rs1234958400 1154 dbSNP
rs1253822988 1155 dbSNP
rs984432066 1158 dbSNP
rs951715561 1159 dbSNP
rs1026553266 1163 dbSNP
rs994187879 1169 dbSNP
rs1459465201 1170 dbSNP
rs13087748 1172 dbSNP
rs13087746 1174 dbSNP
rs966322444 1178 dbSNP
rs1249904126 1183 dbSNP
rs1433901432 1185 dbSNP
rs777790334 1186 dbSNP
rs1412135461 1194 dbSNP
rs1457809407 1198 dbSNP
rs13065151 1199 dbSNP
rs200310539 1202 dbSNP
rs562907033 1202 dbSNP
rs543052179 1218 dbSNP
rs1171069669 1219 dbSNP
rs770045515 1220 dbSNP
rs1402260645 1221 dbSNP
rs1463975216 1232 dbSNP
rs1297609623 1239 dbSNP
rs1368228385 1253 dbSNP
rs1387933518 1256 dbSNP
rs1019497903 1259 dbSNP
rs1298593934 1281 dbSNP
rs1344418809 1282 dbSNP
rs1218917619 1284 dbSNP
rs1007695814 1290 dbSNP
rs1320526784 1296 dbSNP
rs897219156 1303 dbSNP
rs1251189845 1304 dbSNP
rs544155554 1311 dbSNP
rs13064969 1316 dbSNP
rs1211674498 1318 dbSNP
rs1265388463 1321 dbSNP
rs1475776312 1339 dbSNP
rs150495562 1349 dbSNP
rs1425504935 1350 dbSNP
rs1476753259 1364 dbSNP
rs141728077 1369 dbSNP
rs1350355366 1372 dbSNP
rs1180348901 1376 dbSNP
rs1480319800 1378 dbSNP
rs1000141004 1382 dbSNP
rs867826041 1383 dbSNP
rs1042306313 1390 dbSNP
rs759713367 1397 dbSNP
rs879743255 1397 dbSNP
rs1295352541 1407 dbSNP
rs532229947 1408 dbSNP
rs748508381 1410 dbSNP
rs1247689379 1414 dbSNP
rs896409222 1415 dbSNP
rs1490227121 1420 dbSNP
rs541211542 1424 dbSNP
rs1265523313 1427 dbSNP
rs1056279827 1429 dbSNP
rs1232423834 1431 dbSNP
rs200017305 1435 dbSNP
rs1185662704 1439 dbSNP
rs937842970 1440 dbSNP
rs1425453776 1442 dbSNP
rs926342779 1445 dbSNP
rs542666412 1450 dbSNP
rs1299504720 1453 dbSNP
rs1419710970 1453 dbSNP
rs1294693953 1459 dbSNP
rs781587918 1460 dbSNP
rs930287573 1460 dbSNP
rs1398305763 1463 dbSNP
rs1313633332 1465 dbSNP
rs918956384 1466 dbSNP
rs1240911556 1467 dbSNP
rs1288276572 1471 dbSNP
rs1315324265 1490 dbSNP
rs1215382450 1491 dbSNP
rs971765271 1497 dbSNP
rs1484145571 1503 dbSNP
rs1181537783 1504 dbSNP
rs560431359 1518 dbSNP
rs1440274104 1522 dbSNP
rs1019212518 1526 dbSNP
rs1405226512 1534 dbSNP
rs1399726100 1536 dbSNP
rs986244913 1549 dbSNP
rs1360099258 1555 dbSNP
rs10222515 1556 dbSNP
rs1335175617 1559 dbSNP
rs189956649 1563 dbSNP
rs1448225582 1571 dbSNP
rs779549745 1577 dbSNP
rs1311510797 1582 dbSNP
rs1033052087 1586 dbSNP
rs1371364538 1595 dbSNP
rs185395801 1596 dbSNP
rs1279525313 1597 dbSNP
rs1157160466 1603 dbSNP
rs1000278502 1605 dbSNP
rs903268390 1607 dbSNP
rs1179025226 1609 dbSNP
rs1458141742 1610 dbSNP
rs1180476923 1612 dbSNP
rs34664728 1615 dbSNP
rs1020668597 1616 dbSNP
rs1014268378 1617 dbSNP
rs796600655 1617 dbSNP
rs1191283323 1627 dbSNP
rs1056418151 1632 dbSNP
rs1467923162 1635 dbSNP
rs139278484 1640 dbSNP
rs368271126 1642 dbSNP
rs375118784 1644 dbSNP
rs180734304 1645 dbSNP
rs1466594974 1649 dbSNP
rs546928700 1651 dbSNP
rs867812340 1659 dbSNP
rs1334017764 1663 dbSNP
rs1353283035 1664 dbSNP
rs1468719715 1668 dbSNP
rs571703787 1669 dbSNP
rs1221968952 1688 dbSNP
rs1282364294 1696 dbSNP
rs1318418140 1703 dbSNP
rs1200445104 1706 dbSNP
rs1270732365 1708 dbSNP
rs1437172739 1716 dbSNP
rs749928194 1718 dbSNP
rs1315950124 1719 dbSNP
rs1247996766 1720 dbSNP
rs1307344248 1721 dbSNP
rs561036757 1726 dbSNP
rs1429011095 1738 dbSNP
rs1478320243 1746 dbSNP
rs1170010358 1748 dbSNP
rs919027548 1750 dbSNP
rs1409921324 1755 dbSNP
rs1438092537 1769 dbSNP
rs551543003 1775 dbSNP
rs1403333077 1777 dbSNP
rs1302840112 1780 dbSNP
rs1341381948 1781 dbSNP
rs1268234413 1790 dbSNP
rs1338639716 1792 dbSNP
rs1228857288 1799 dbSNP
rs944411408 1801 dbSNP
rs1489669470 1802 dbSNP
rs912119934 1803 dbSNP
rs1263370785 1809 dbSNP
rs1397051055 1813 dbSNP
rs1489083784 1838 dbSNP
rs1195716612 1841 dbSNP
rs986382516 1842 dbSNP
rs1475357412 1844 dbSNP
rs35755694 1845 dbSNP
rs1164409474 1855 dbSNP
rs1287475870 1858 dbSNP
rs528587590 1859 dbSNP
rs1422762600 1883 dbSNP
rs1163016893 1894 dbSNP
rs1361370950 1902 dbSNP
rs1384180902 1903 dbSNP
rs953545701 1905 dbSNP
rs1325704697 1918 dbSNP
rs1033103066 1921 dbSNP
rs978905978 1926 dbSNP
rs1244548236 1931 dbSNP
rs1161620929 1934 dbSNP
rs1286133619 1940 dbSNP
rs1355379320 1948 dbSNP
rs1203052490 1952 dbSNP
rs1260081784 1963 dbSNP
rs1431463276 1973 dbSNP
rs1188701856 1975 dbSNP
rs967836346 1984 dbSNP
rs1443364046 1988 dbSNP
rs1183015270 1996 dbSNP
rs544464192 1998 dbSNP
rs1381040874 2005 dbSNP
rs1455533715 2012 dbSNP
rs1157102875 2018 dbSNP
rs1394589644 2021 dbSNP
rs1020384128 2024 dbSNP
rs1014650593 2028 dbSNP
rs1192860073 2032 dbSNP
rs1338493557 2034 dbSNP
rs764853650 2036 dbSNP
rs960096389 2045 dbSNP
rs1034927508 2048 dbSNP
rs1309315992 2048 dbSNP
rs1337084570 2054 dbSNP
rs189610545 2060 dbSNP
rs186314847 2061 dbSNP
rs538437164 2061 dbSNP
rs1201351072 2068 dbSNP
rs146948186 2069 dbSNP
rs897552026 2076 dbSNP
rs1238848805 2079 dbSNP
rs1260920831 2084 dbSNP
rs1179754580 2110 dbSNP
rs1363397539 2111 dbSNP
rs1036142819 2115 dbSNP
rs1217521448 2116 dbSNP
rs1178296504 2126 dbSNP
rs944364831 2129 dbSNP
rs1469225259 2133 dbSNP
rs1278994638 2134 dbSNP
rs1332027859 2137 dbSNP
rs181909036 2142 dbSNP
rs1398564909 2145 dbSNP
rs911599690 2146 dbSNP
rs1373828249 2149 dbSNP
rs1331281110 2156 dbSNP
rs1050054150 2160 dbSNP
rs145768104 2160 dbSNP
rs537775094 2160 dbSNP
rs1294112167 2161 dbSNP
rs926219130 2163 dbSNP
rs1381990180 2165 dbSNP
rs1481924083 2165 dbSNP
rs575691520 2168 dbSNP
rs1249968830 2170 dbSNP
rs979313663 2170 dbSNP
rs1201950148 2171 dbSNP
rs529524759 2172 dbSNP
rs1479956303 2178 dbSNP
rs1171131301 2179 dbSNP
rs1290814570 2179 dbSNP
rs1374687525 2179 dbSNP
rs967593728 2180 dbSNP
rs992961169 2198 dbSNP
rs563670559 2201 dbSNP
rs1300834895 2207 dbSNP
rs1344477064 2219 dbSNP
rs960309579 2221 dbSNP
rs796434825 2231 dbSNP
rs1296767117 2233 dbSNP
rs1309757265 2238 dbSNP
rs1225927044 2243 dbSNP
rs1174326707 2256 dbSNP
rs1250827030 2261 dbSNP
rs1490550803 2264 dbSNP
rs1224835582 2265 dbSNP
rs1252885737 2268 dbSNP
rs1266960232 2269 dbSNP
rs1034310514 2271 dbSNP
rs1001550123 2273 dbSNP
rs1263651010 2299 dbSNP
rs543404725 2309 dbSNP
rs1427648713 2314 dbSNP
rs772706480 2316 dbSNP
rs1368996766 2320 dbSNP
rs1425930631 2322 dbSNP
rs765386837 2323 dbSNP
rs1364514293 2324 dbSNP
rs1400277619 2326 dbSNP
rs1289785902 2327 dbSNP
rs1364606327 2332 dbSNP
rs1381010759 2344 dbSNP
rs995066403 2345 dbSNP
rs897694053 2356 dbSNP
rs1036521116 2361 dbSNP
rs1216831129 2362 dbSNP
rs1008609969 2365 dbSNP
rs1484735791 2367 dbSNP
rs890213735 2372 dbSNP
rs1210945989 2375 dbSNP
rs1446393326 2377 dbSNP
rs1181188249 2380 dbSNP
rs1050019356 2381 dbSNP
rs1349485980 2389 dbSNP
rs532831876 2410 dbSNP
rs926187709 2411 dbSNP
rs141248893 2418 dbSNP
rs1343087034 2432 dbSNP
rs540723420 2432 dbSNP
rs1288689151 2434 dbSNP
rs1179703144 2435 dbSNP
rs1455102173 2436 dbSNP
rs372240486 2436 dbSNP
rs1308383572 2447 dbSNP
rs1382216462 2447 dbSNP
rs1286517600 2448 dbSNP
rs1315383501 2450 dbSNP
rs1214743577 2462 dbSNP
rs1298207000 2463 dbSNP
rs1413384091 2471 dbSNP
rs1178437471 2473 dbSNP
rs1201769390 2473 dbSNP
rs1462571262 2473 dbSNP
rs373608516 2473 dbSNP
rs557431139 2473 dbSNP
rs58640664 2473 dbSNP
rs946198860 2474 dbSNP
rs1313758422 2475 dbSNP
rs1407352998 2482 dbSNP
rs1418173461 2482 dbSNP
rs913439445 2482 dbSNP
rs993405948 2486 dbSNP
rs763904227 2488 dbSNP
rs527300162 2495 dbSNP
rs1405993533 2501 dbSNP
rs960075751 2503 dbSNP
rs1371424116 2505 dbSNP
rs1223469676 2506 dbSNP
rs556119857 2507 dbSNP
rs150233522 2509 dbSNP
rs1166045068 2521 dbSNP
rs927380952 2522 dbSNP
rs1221477489 2525 dbSNP
rs1373373068 2530 dbSNP
rs1438359185 2533 dbSNP
rs1172553650 2540 dbSNP
rs1205951250 2555 dbSNP
rs980081595 2560 dbSNP
rs1480090979 2561 dbSNP
rs1199786159 2569 dbSNP
rs952719182 2576 dbSNP
rs1027977489 2577 dbSNP
rs1174762722 2579 dbSNP
rs1425019249 2581 dbSNP
rs1411062874 2582 dbSNP
rs973386108 2602 dbSNP
rs962274719 2609 dbSNP
rs1014727106 2610 dbSNP
rs977300001 2615 dbSNP
rs1486345192 2617 dbSNP
rs1402830923 2620 dbSNP
rs775501857 2624 dbSNP
rs1339970820 2625 dbSNP
rs190208334 2633 dbSNP
rs767558456 2634 dbSNP
rs1195673355 2635 dbSNP
rs1481238948 2637 dbSNP
rs1222608396 2638 dbSNP
rs1258985967 2640 dbSNP
rs1270538352 2642 dbSNP
rs748265937 2650 dbSNP
rs1204042228 2654 dbSNP
rs995782999 2657 dbSNP
rs879878606 2658 dbSNP
rs1476023979 2659 dbSNP
rs781491137 2661 dbSNP
rs1334665752 2663 dbSNP
rs555567373 2666 dbSNP
rs1367630471 2668 dbSNP
rs1403391002 2688 dbSNP
rs1043698940 2689 dbSNP
rs1294079700 2704 dbSNP
rs542080841 2706 dbSNP
rs946279614 2709 dbSNP
rs576401302 2711 dbSNP
rs1361219131 2712 dbSNP
rs763185055 2715 dbSNP
rs1246005813 2730 dbSNP
rs536695389 2739 dbSNP
rs1333984343 2746 dbSNP
rs556538516 2747 dbSNP
rs1289597052 2753 dbSNP
rs1328282120 2754 dbSNP
rs1195788643 2755 dbSNP
rs199962230 2757 dbSNP
rs1392090604 2764 dbSNP
rs1184264441 2767 dbSNP
rs1387206757 2780 dbSNP
rs1397091737 2785 dbSNP
rs1162952201 2796 dbSNP
rs184826393 2800 dbSNP
rs1231777784 2806 dbSNP
rs938856549 2807 dbSNP
rs571503293 2811 dbSNP
rs980217181 2813 dbSNP
rs1416939994 2815 dbSNP
rs748384498 2820 dbSNP
rs558153296 2830 dbSNP
rs534772261 2832 dbSNP
rs973154100 2833 dbSNP
rs1346937527 2835 dbSNP
rs1207213783 2842 dbSNP
rs1282659143 2843 dbSNP
rs769946914 2851 dbSNP
rs961961040 2852 dbSNP
rs565867153 2854 dbSNP
rs1204936478 2862 dbSNP
rs1015271976 2864 dbSNP
rs1442801549 2869 dbSNP
rs1186944055 2873 dbSNP
rs1364546314 2896 dbSNP
rs1471306097 2899 dbSNP
rs1212391121 2903 dbSNP
rs987246117 2904 dbSNP
rs1470251808 2923 dbSNP
rs1468283901 2928 dbSNP
rs1274198873 2934 dbSNP
rs1338548704 2935 dbSNP
rs1403835513 2936 dbSNP
rs1394896505 2937 dbSNP
rs116306318 2944 dbSNP
rs1348789535 2966 dbSNP
rs995921842 2968 dbSNP
rs1279235643 2969 dbSNP
rs904284181 2971 dbSNP
rs1224511035 2978 dbSNP
rs1021256173 2982 dbSNP
rs1460385469 2984 dbSNP
rs746331546 2988 dbSNP
rs1251401597 2989 dbSNP
rs1439766323 2991 dbSNP
rs1337637509 2996 dbSNP
rs529494912 3000 dbSNP
rs1311320933 3013 dbSNP
rs868447490 3016 dbSNP
rs545930483 3017 dbSNP
rs1178349767 3020 dbSNP
rs892030605 3026 dbSNP
rs1393383265 3031 dbSNP
rs1167965379 3033 dbSNP
rs1398079672 3036 dbSNP
rs1389315140 3038 dbSNP
rs576921080 3040 dbSNP
rs370149197 3042 dbSNP
rs1382284834 3049 dbSNP
rs192416387 3055 dbSNP
rs1470155033 3057 dbSNP
rs1310939587 3063 dbSNP
rs1233236984 3069 dbSNP
rs550169563 3072 dbSNP
rs938824463 3074 dbSNP
rs1341482159 3082 dbSNP
rs906070701 3085 dbSNP
rs1490583819 3089 dbSNP
rs151130404 3097 dbSNP
rs1266570938 3101 dbSNP
rs75953400 3105 dbSNP
rs1044588647 3107 dbSNP
rs1454229281 3111 dbSNP
rs183680976 3114 dbSNP
rs920020068 3133 dbSNP
rs762054166 3136 dbSNP
rs1283770841 3140 dbSNP
rs1426219791 3144 dbSNP
rs192516198 3148 dbSNP
rs1355866255 3150 dbSNP
rs1278301684 3151 dbSNP
rs907771286 3154 dbSNP
rs1233736982 3158 dbSNP
rs1328732569 3159 dbSNP
rs987380603 3160 dbSNP
rs1274064611 3162 dbSNP
rs1360409915 3164 dbSNP
rs1370153583 3173 dbSNP
rs1304123044 3179 dbSNP
rs561812629 3182 dbSNP
rs1438319030 3185 dbSNP
rs1487995717 3210 dbSNP
rs1324490087 3213 dbSNP
rs1186899721 3215 dbSNP
rs1317146962 3227 dbSNP
rs1263698524 3238 dbSNP
rs1400932725 3244 dbSNP
rs534138862 3247 dbSNP
rs1361828030 3248 dbSNP
rs1187369213 3249 dbSNP
rs954542120 3253 dbSNP
rs1437267541 3258 dbSNP
rs1446079972 3262 dbSNP
rs921730128 3264 dbSNP
rs1433629131 3269 dbSNP
rs1289850939 3272 dbSNP
rs1387739301 3274 dbSNP
rs974555059 3275 dbSNP
rs1193451449 3276 dbSNP
rs1383704110 3284 dbSNP
rs1474610736 3296 dbSNP
rs1241900704 3298 dbSNP
rs1194098639 3305 dbSNP
rs1310772705 3308 dbSNP
rs968467446 3309 dbSNP
rs1021816756 3310 dbSNP
rs1463482421 3315 dbSNP
rs1009892720 3324 dbSNP
rs1243683553 3339 dbSNP
rs955932132 3347 dbSNP
rs1445862993 3348 dbSNP
rs1179632586 3349 dbSNP
rs1412573657 3352 dbSNP
rs1348750802 3354 dbSNP
rs1035942200 3355 dbSNP
rs1003089958 3363 dbSNP
rs1279177422 3387 dbSNP
rs1456106471 3391 dbSNP
rs1220904345 3399 dbSNP
rs1320389293 3400 dbSNP
rs1337125261 3411 dbSNP
rs376592349 3412 dbSNP
rs1431272415 3415 dbSNP
rs1301197271 3425 dbSNP
rs542036087 3432 dbSNP
rs1378675379 3433 dbSNP
rs1224605470 3455 dbSNP
rs1044557092 3468 dbSNP
rs1326737689 3475 dbSNP
rs1310735414 3477 dbSNP
rs995694663 3479 dbSNP
rs1462623978 3487 dbSNP
rs1207377136 3494 dbSNP
rs1236438767 3494 dbSNP
rs1480746774 3500 dbSNP
rs754728314 3502 dbSNP
rs769006576 3512 dbSNP
rs1471781242 3520 dbSNP
rs1158917674 3522 dbSNP
rs898559524 3527 dbSNP
rs576263622 3530 dbSNP
rs1178791606 3532 dbSNP
rs1037548933 3533 dbSNP
rs1358725789 3538 dbSNP
rs1443031746 3542 dbSNP
rs1300057664 3568 dbSNP
rs1348891954 3585 dbSNP
rs766249015 3588 dbSNP
rs574940054 3590 dbSNP
rs73881945 3592 dbSNP
rs1325563581 3597 dbSNP
rs1217463587 3599 dbSNP
rs545749435 3600 dbSNP
rs143031151 3603 dbSNP
rs780601491 3604 dbSNP
rs1051047925 3605 dbSNP
rs1482540812 3605 dbSNP
rs1270108601 3615 dbSNP
rs1479289394 3619 dbSNP
rs1130272 3623 dbSNP
rs1425101512 3627 dbSNP
rs1486016965 3660 dbSNP
rs561665425 3665 dbSNP
rs1170601060 3666 dbSNP
rs1368916616 3670 dbSNP
rs1429407242 3674 dbSNP
rs535043523 3681 dbSNP
rs974524010 3684 dbSNP
rs868413180 3693 dbSNP
rs1212075336 3695 dbSNP
rs1434035262 3697 dbSNP
rs1435990340 3698 dbSNP
rs1274115080 3703 dbSNP
rs149043128 3706 dbSNP
rs1218977468 3707 dbSNP
rs552193149 3712 dbSNP
rs1291017624 3713 dbSNP
rs1340987475 3713 dbSNP
rs1232310959 3714 dbSNP
rs1293502505 3719 dbSNP
rs1379193615 3728 dbSNP
rs1453630678 3732 dbSNP
rs1304066439 3738 dbSNP
rs914319936 3741 dbSNP
rs1246600411 3742 dbSNP
rs1476051001 3747 dbSNP
rs1190572059 3752 dbSNP
rs1388461959 3760 dbSNP
rs989007526 3764 dbSNP
rs1164378101 3771 dbSNP
rs955819148 3774 dbSNP
rs1439477284 3777 dbSNP
rs1403340116 3785 dbSNP
rs1354433712 3788 dbSNP
rs1330207188 3790 dbSNP
rs1345678751 3793 dbSNP
rs1437244913 3798 dbSNP
rs1035322831 3801 dbSNP
rs1392778428 3803 dbSNP
rs535565188 3805 dbSNP
rs1246098698 3807 dbSNP
rs1353861682 3808 dbSNP
rs1226935619 3813 dbSNP
rs1289679078 3814 dbSNP
rs1448069294 3818 dbSNP
rs1211196143 3824 dbSNP
rs1246730636 3825 dbSNP
rs1464452660 3827 dbSNP
rs1002554595 3828 dbSNP
rs1370376771 3835 dbSNP
rs1471954411 3835 dbSNP
rs755626207 3840 dbSNP
rs1164400294 3842 dbSNP
rs767039456 3847 dbSNP
rs1475665558 3848 dbSNP
rs1318396649 3858 dbSNP
rs1387851636 3865 dbSNP
rs1452682009 3867 dbSNP
rs1335673060 3870 dbSNP
rs1338315824 3870 dbSNP
rs1243691801 3871 dbSNP
rs1416299216 3875 dbSNP
rs3188952 3882 dbSNP
rs1266729233 3883 dbSNP
rs898691202 3887 dbSNP
rs1204348934 3889 dbSNP
rs1258407943 3889 dbSNP
rs1469725326 3892 dbSNP
rs3188954 3898 dbSNP
rs1004665234 3905 dbSNP
rs1199231906 3907 dbSNP
rs1473423920 3909 dbSNP
rs891218339 3921 dbSNP
rs1051016908 3922 dbSNP
rs932673224 3924 dbSNP
rs1399522048 3931 dbSNP
rs546636888 3933 dbSNP
rs1212903491 3938 dbSNP
rs1329044951 3939 dbSNP
rs878939279 3939 dbSNP
rs1412021137 3941 dbSNP
rs1321944576 3942 dbSNP
rs149790366 3942 dbSNP
rs1314480277 3948 dbSNP
rs1221552576 3952 dbSNP
rs1038962538 3955 dbSNP
rs1372011008 3958 dbSNP
rs947239863 3960 dbSNP
rs1199968189 3962 dbSNP
rs1273930918 3964 dbSNP
rs1449654698 3967 dbSNP
rs1179728001 3969 dbSNP
rs1250877355 3971 dbSNP
rs1433241195 3971 dbSNP
rs377029800 3971 dbSNP
rs529866238 3972 dbSNP
rs1200833116 3975 dbSNP
rs1375873439 3975 dbSNP
rs1465063987 3979 dbSNP
rs1392664563 3982 dbSNP
rs539711185 3987 dbSNP
rs914351586 3988 dbSNP
rs988671326 3995 dbSNP
rs56024362 3996 dbSNP
rs1350323152 4000 dbSNP
rs1387712168 4007 dbSNP
rs1303992685 4008 dbSNP
rs370013083 4009 dbSNP
rs1462351947 4010 dbSNP
rs934379216 4025 dbSNP
rs1351800274 4031 dbSNP
rs928389917 4041 dbSNP
rs767210016 4042 dbSNP
rs969737944 4044 dbSNP
rs1400153662 4049 dbSNP
rs1023212271 4051 dbSNP
rs571157072 4073 dbSNP
rs974768553 4074 dbSNP
rs754982358 4075 dbSNP
rs1488652851 4079 dbSNP
rs1211438522 4090 dbSNP
rs1265130064 4101 dbSNP
rs1432562194 4105 dbSNP
rs1193247875 4107 dbSNP
rs1391538962 4111 dbSNP
rs1447273582 4113 dbSNP
rs1179119473 4114 dbSNP
rs1295697559 4115 dbSNP
rs1365821003 4115 dbSNP
rs145085702 4115 dbSNP
rs1441457336 4117 dbSNP
rs1386768398 4118 dbSNP
rs1321295888 4127 dbSNP
rs1246675042 4128 dbSNP
rs1367363793 4128 dbSNP
rs200443411 4128 dbSNP
rs55865199 4128 dbSNP
rs796256841 4128 dbSNP
rs1251137509 4129 dbSNP
rs1488109242 4129 dbSNP
rs1192743114 4130 dbSNP
rs1209349077 4130 dbSNP
rs1488714168 4133 dbSNP
rs1266797924 4139 dbSNP
rs1463114878 4140 dbSNP
rs1187424821 4145 dbSNP
rs1213248990 4146 dbSNP
rs1425243378 4147 dbSNP
rs966596558 4150 dbSNP
rs1016142466 4159 dbSNP
rs1286125169 4162 dbSNP
rs75290429 4163 dbSNP
rs1265544494 4165 dbSNP
rs1391501205 4169 dbSNP
rs1004396478 4186 dbSNP
rs561676735 4190 dbSNP
rs891186813 4195 dbSNP
rs548259848 4207 dbSNP
rs752527999 4210 dbSNP
rs767613638 4214 dbSNP
rs996795907 4219 dbSNP
rs531455724 4221 dbSNP
rs1228791136 4225 dbSNP
rs1269884733 4226 dbSNP
rs1287266821 4227 dbSNP
rs899883804 4235 dbSNP
rs1237611412 4252 dbSNP
rs1043737053 4255 dbSNP
rs1179682811 4274 dbSNP
rs1361481088 4277 dbSNP
rs562508501 4304 dbSNP
rs1432983772 4306 dbSNP
rs750498208 4307 dbSNP
rs751429498 4316 dbSNP
rs1158503217 4324 dbSNP
rs934537716 4327 dbSNP
rs1467649249 4343 dbSNP
rs1433516650 4349 dbSNP
rs765310549 4383 dbSNP
rs1301253424 4397 dbSNP
rs928357421 4399 dbSNP
rs188152558 4401 dbSNP
rs577037683 4410 dbSNP
rs1184343254 4413 dbSNP
rs1290039098 4414 dbSNP
rs948363462 4415 dbSNP
rs1485332587 4418 dbSNP
rs1279251171 4430 dbSNP
rs1313382486 4432 dbSNP
rs776842504 4433 dbSNP
rs1255014091 4436 dbSNP
rs1483200929 4442 dbSNP
rs1218122441 4453 dbSNP
rs560440989 4455 dbSNP
rs1254488473 4456 dbSNP
rs915539292 4459 dbSNP
rs541020172 4461 dbSNP
rs1345176607 4464 dbSNP
rs768858581 4467 dbSNP
rs572070083 4471 dbSNP
rs1280180054 4473 dbSNP
rs973770725 4478 dbSNP
rs1358781388 4484 dbSNP
rs1309622237 4487 dbSNP
rs6983 4488 dbSNP
rs1409003323 4495 dbSNP
rs1015865200 4496 dbSNP
rs1369681190 4502 dbSNP
rs983335940 4507 dbSNP
rs1300051085 4510 dbSNP
rs1342415798 4511 dbSNP
rs955572578 4520 dbSNP
rs183229943 4524 dbSNP
rs1482242684 4530 dbSNP
rs111244638 4533 dbSNP
rs1293867471 4539 dbSNP
rs1191784935 4543 dbSNP
rs775806992 4546 dbSNP
rs1247757357 4549 dbSNP
rs1374257377 4554 dbSNP
rs576145360 4558 dbSNP
rs996848849 4566 dbSNP
rs1450178154 4568 dbSNP
rs1170655588 4569 dbSNP
rs1388575709 4570 dbSNP
rs1409115725 4570 dbSNP
rs1324014455 4571 dbSNP
rs1341327362 4572 dbSNP
rs530703891 4573 dbSNP
rs1434288150 4574 dbSNP
rs746328601 4588 dbSNP
rs778303590 4589 dbSNP
rs1365202287 4604 dbSNP
rs1412961977 4607 dbSNP
rs1374960930 4620 dbSNP
rs1302122885 4624 dbSNP
rs1214316835 4635 dbSNP
rs1291115184 4637 dbSNP
rs577652402 4639 dbSNP
rs144163781 4642 dbSNP
rs1465364905 4646 dbSNP
rs192967816 4656 dbSNP
rs1053073473 4658 dbSNP
rs1415777536 4658 dbSNP
rs761989797 4658 dbSNP
rs564700156 4680 dbSNP
rs890025337 4681 dbSNP
rs1168055516 4692 dbSNP
rs1028601767 4695 dbSNP
rs1045591788 4697 dbSNP
rs948415133 4706 dbSNP
rs751192056 4717 dbSNP
rs1259142908 4720 dbSNP
rs1423863462 4721 dbSNP
rs995891922 4730 dbSNP
rs915675763 4738 dbSNP
rs866786820 4739 dbSNP
rs1195423312 4742 dbSNP
rs1448392232 4747 dbSNP
rs1285602398 4752 dbSNP
rs1358845239 4754 dbSNP
rs1038419278 4759 dbSNP
rs79515006 4762 dbSNP
rs770411784 4777 dbSNP
rs1484525345 4781 dbSNP
rs1246323913 4783 dbSNP
rs571047437 4785 dbSNP
rs866304650 4792 dbSNP
rs1188425943 4797 dbSNP
rs1239444672 4801 dbSNP
rs188569010 4806 dbSNP
rs534498598 4809 dbSNP
rs1412578512 4811 dbSNP
rs1056223478 4817 dbSNP
rs937888958 4818 dbSNP
rs1231693257 4819 dbSNP
rs182932919 4823 dbSNP
rs1313515730 4824 dbSNP
rs1335732119 4824 dbSNP
rs979350138 4825 dbSNP
rs548221731 4826 dbSNP
rs1351630249 4828 dbSNP
rs1230841194 4835 dbSNP
rs1296427786 4839 dbSNP
rs534158338 4841 dbSNP
rs1011314555 4845 dbSNP
rs1280946152 4848 dbSNP
rs1464861523 4849 dbSNP
rs1209859816 4852 dbSNP
rs913538120 4855 dbSNP
rs1473454055 4857 dbSNP
rs1400801471 4872 dbSNP
rs71304039 4874 dbSNP
rs1173865453 4875 dbSNP
rs1399586023 4878 dbSNP
rs907125660 4879 dbSNP
rs1312646368 4881 dbSNP
rs1045560152 4886 dbSNP
rs114381197 4889 dbSNP
rs894198328 4890 dbSNP
rs1038151156 4892 dbSNP
rs1234018687 4899 dbSNP
rs552081202 4902 dbSNP
rs1345973192 4908 dbSNP
rs908162634 4910 dbSNP
rs113656630 4929 dbSNP
rs1483886244 4933 dbSNP
rs1202800262 4935 dbSNP
rs554783438 4935 dbSNP
rs375290913 4936 dbSNP
rs186302962 4943 dbSNP
rs1260409811 4947 dbSNP
rs1375496169 4950 dbSNP
rs1028925206 4951 dbSNP
rs964211073 4962 dbSNP
rs545794720 4967 dbSNP
rs963296562 4973 dbSNP
rs1285047459 4978 dbSNP
rs1015508238 4979 dbSNP
rs182310051 5008 dbSNP
rs896562806 5009 dbSNP
rs1030966580 5010 dbSNP
rs1056497913 5011 dbSNP
rs759926978 5014 dbSNP
rs1233690952 5018 dbSNP
rs561714452 5027 dbSNP
rs971278687 5027 dbSNP
rs1002717861 5029 dbSNP
rs1247050949 5030 dbSNP
rs904996512 5033 dbSNP
rs1356961283 5035 dbSNP
rs1043960735 5037 dbSNP
rs946617873 5042 dbSNP
rs913861687 5051 dbSNP
rs1052094655 5055 dbSNP
rs944380766 5058 dbSNP
rs1377632283 5061 dbSNP
rs1447334732 5068 dbSNP
rs1168758337 5073 dbSNP
rs1372932291 5078 dbSNP
rs541857211 5082 dbSNP
rs1333115156 5084 dbSNP
rs781092656 5086 dbSNP
rs1440223630 5093 dbSNP
rs911624577 5097 dbSNP
rs142754892 5100 dbSNP
rs1017182843 5102 dbSNP
rs985872518 5104 dbSNP
rs1380814376 5109 dbSNP
rs953259996 5110 dbSNP
rs886872082 5117 dbSNP
rs1271148521 5129 dbSNP
rs576437668 5132 dbSNP
rs921408595 5133 dbSNP
rs1208785920 5134 dbSNP
rs1269536273 5135 dbSNP
rs974649238 5142 dbSNP
rs1185506127 5148 dbSNP
rs1256451649 5152 dbSNP
rs962989215 5154 dbSNP
rs1190098013 5166 dbSNP
rs556666303 5177 dbSNP
rs1361568099 5186 dbSNP
rs1178508228 5194 dbSNP
rs1461434705 5194 dbSNP
rs139271313 5208 dbSNP
rs1046691242 5209 dbSNP
rs1451734067 5212 dbSNP
rs1004151663 5216 dbSNP
rs7645116 5226 dbSNP
rs201427251 5227 dbSNP
rs7612699 5228 dbSNP
rs201371242 5229 dbSNP
rs386668601 5229 dbSNP
rs765236429 5249 dbSNP
rs186523378 5251 dbSNP
rs915371299 5262 dbSNP
rs1228999724 5264 dbSNP
rs990060959 5265 dbSNP
rs762015597 5266 dbSNP
rs924039083 5267 dbSNP
rs146733855 5273 dbSNP
rs1484058223 5278 dbSNP
rs1043566187 5284 dbSNP
rs1255935134 5285 dbSNP
rs57897181 5290 dbSNP
rs1475089442 5296 dbSNP
rs200064365 5298 dbSNP
rs554581594 5304 dbSNP
rs1354292377 5309 dbSNP
rs1410826330 5312 dbSNP
rs1417353630 5316 dbSNP
rs1158522673 5317 dbSNP
rs1311434350 5322 dbSNP
rs892377033 5324 dbSNP
rs143647731 5326 dbSNP
rs764345832 5327 dbSNP
rs944621912 5338 dbSNP
rs1374551549 5339 dbSNP
rs368563954 5341 dbSNP
rs1388167760 5348 dbSNP
rs568847306 5349 dbSNP
rs1290096634 5360 dbSNP
rs958881665 5362 dbSNP
rs1050520884 5366 dbSNP
rs1419817991 5368 dbSNP
rs1301430982 5371 dbSNP
rs1313589978 5375 dbSNP
rs1231543860 5380 dbSNP
rs1279181793 5383 dbSNP
rs1382675040 5389 dbSNP
rs1172340611 5396 dbSNP
rs931709872 5400 dbSNP
rs1206352156 5406 dbSNP
rs1235068871 5417 dbSNP
rs1005817775 5422 dbSNP
rs1176676248 5424 dbSNP
rs920378500 5426 dbSNP
rs1455643232 5430 dbSNP
rs1171944972 5432 dbSNP
rs974259815 5436 dbSNP
rs73185571 5439 dbSNP
rs1201200502 5442 dbSNP
rs908733899 5446 dbSNP
rs982968205 5452 dbSNP
rs960953436 5453 dbSNP
rs868027293 5454 dbSNP
rs1025377950 5464 dbSNP
rs775857939 5465 dbSNP
rs1217405264 5467 dbSNP
rs1438109867 5468 dbSNP
rs997801969 5468 dbSNP
rs1302184023 5473 dbSNP
rs1288030547 5474 dbSNP
rs900888560 5475 dbSNP
rs1217413888 5480 dbSNP
rs1275618384 5482 dbSNP
rs1034990518 5483 dbSNP
rs7644827 5487 dbSNP
rs1191874082 5488 dbSNP
rs1235225231 5491 dbSNP
rs1407045914 5498 dbSNP
rs1169425592 5501 dbSNP
rs566633487 5501 dbSNP
rs1297247140 5502 dbSNP
rs1165338392 5503 dbSNP
rs1396635768 5503 dbSNP
rs1438036514 5503 dbSNP
rs1053933993 5504 dbSNP
rs1365453273 5505 dbSNP
rs1436915822 5508 dbSNP
rs969494451 5512 dbSNP
rs11443749 5513 dbSNP
rs1211884619 5513 dbSNP
rs1214371486 5513 dbSNP
rs1272698267 5513 dbSNP
rs1291180813 5513 dbSNP
rs1337649911 5513 dbSNP
rs1401950963 5513 dbSNP
rs1491080933 5513 dbSNP
rs527322560 5513 dbSNP
rs59310692 5513 dbSNP
rs879011163 5513 dbSNP
rs1315726723 5514 dbSNP
rs1311521459 5515 dbSNP
rs1430436009 5516 dbSNP
rs1294354915 5522 dbSNP
rs1357913861 5525 dbSNP
rs1231926822 5526 dbSNP
rs1217036076 5527 dbSNP
rs1293232853 5529 dbSNP
rs1329883830 5530 dbSNP
rs577391463 5530 dbSNP
rs1282383748 5532 dbSNP
rs1414412158 5539 dbSNP
rs546406459 5545 dbSNP
rs1174646860 5552 dbSNP
rs935521184 5558 dbSNP
rs1474104966 5567 dbSNP
rs1474659824 5577 dbSNP
rs1187066160 5578 dbSNP
rs1423124040 5579 dbSNP
rs759968645 5581 dbSNP
rs1156355174 5583 dbSNP
rs1406778125 5586 dbSNP
rs529923866 5590 dbSNP
rs982226873 5594 dbSNP
rs1489275966 5595 dbSNP
rs1413351963 5597 dbSNP
rs949362175 5606 dbSNP
rs1010719291 5610 dbSNP
rs1241241297 5613 dbSNP
rs991241871 5629 dbSNP
rs892277487 5630 dbSNP
rs1441763102 5638 dbSNP
rs1030851053 5644 dbSNP
rs1201937224 5646 dbSNP
rs774993521 5649 dbSNP
rs1017289497 5654 dbSNP
rs1209926771 5658 dbSNP
rs1315856871 5662 dbSNP
rs1008783102 5663 dbSNP
rs983958825 5664 dbSNP
rs1362647654 5675 dbSNP
rs1478077880 5683 dbSNP
rs1175078284 5687 dbSNP
rs560876319 5700 dbSNP
rs890380012 5703 dbSNP
rs1433217496 5707 dbSNP
rs1025347189 5711 dbSNP
rs1397815189 5712 dbSNP
rs1341770222 5717 dbSNP
rs181206895 5718 dbSNP
rs997854455 5729 dbSNP
rs1305852437 5738 dbSNP
rs965105108 5741 dbSNP
rs552190279 5742 dbSNP
rs1050091557 5756 dbSNP
rs531689512 5759 dbSNP
rs894037795 5763 dbSNP
rs1336745832 5773 dbSNP
rs562742306 5774 dbSNP
rs1451639754 5775 dbSNP
rs1408533900 5776 dbSNP
rs1195005319 5786 dbSNP
rs931674336 5798 dbSNP
rs1054473314 5805 dbSNP
rs1171584486 5810 dbSNP
rs1193392369 5811 dbSNP
rs1373926192 5815 dbSNP
rs114610034 5817 dbSNP
rs1037833180 5818 dbSNP
rs771329141 5820 dbSNP
rs908683836 5822 dbSNP
rs902722272 5825 dbSNP
rs982915935 5827 dbSNP
rs1440361376 5837 dbSNP
rs1296579519 5840 dbSNP
rs939605367 5846 dbSNP
rs928240752 5849 dbSNP
rs748879333 5850 dbSNP
rs1335448691 5858 dbSNP
rs772568458 5864 dbSNP
rs1215008214 5866 dbSNP
rs1270793562 5868 dbSNP
rs1467641938 5874 dbSNP
rs577282091 5884 dbSNP
rs554389405 5886 dbSNP
rs1055116809 5887 dbSNP
rs1022311548 5888 dbSNP
rs1191537426 5889 dbSNP
rs942057319 5892 dbSNP
rs1475859068 5898 dbSNP
rs1167743210 5906 dbSNP
rs909794794 5913 dbSNP
rs1461009025 5918 dbSNP
rs989532784 5925 dbSNP
rs1257204165 5927 dbSNP
rs190116740 5928 dbSNP
rs1030799072 5939 dbSNP
rs868155444 5944 dbSNP
rs1319524071 5954 dbSNP
rs1356001428 5956 dbSNP
rs575204467 5957 dbSNP
rs555340749 5971 dbSNP
rs746199360 5975 dbSNP
rs1234985844 5977 dbSNP
rs890369356 5979 dbSNP
rs1029352986 5997 dbSNP
rs996127270 5998 dbSNP
rs1484717141 6000 dbSNP
rs918382982 6003 dbSNP
rs1262837401 6006 dbSNP
rs1486211560 6007 dbSNP
rs898797675 6009 dbSNP
rs747752119 6011 dbSNP
rs1037380366 6016 dbSNP
rs139788111 6022 dbSNP
rs1159990623 6036 dbSNP
rs886230874 6042 dbSNP
rs965073585 6048 dbSNP
rs1047212861 6071 dbSNP
rs1375771172 6079 dbSNP
rs1416411586 6086 dbSNP
rs568791516 6087 dbSNP
rs1223831121 6088 dbSNP
rs774748477 6088 dbSNP
rs1032592177 6093 dbSNP
rs1376890505 6094 dbSNP
rs570680876 6094 dbSNP
rs1237809285 6103 dbSNP
rs1280630669 6104 dbSNP
rs1332456236 6114 dbSNP
rs1000146850 6121 dbSNP
rs771398907 6131 dbSNP
rs1467546894 6132 dbSNP
rs1256002278 6138 dbSNP
rs142523556 6144 dbSNP
rs1164371219 6147 dbSNP
rs902781185 6148 dbSNP
rs928222118 6151 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis: