miRTarBase - #MIRT023243 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ATP11A   
Synonyms ATPIH, ATPIS
Description ATPase phospholipid transporting 11A
Transcript NM_015205   
Other Transcripts NM_032189   
Expression
Putative miRNA Targets on ATP11A
3'UTR of ATP11A
(miRNA target sites are highlighted)
>ATP11A|NM_015205|3'UTR
   1 TGGAACAAGAGCCCAGGCTACCAGAGCACCTGTCCCTCGGCCGCCTGGTACAGCTCCCACTCTCAGCAGGTGACACTCGC
  81 GGCCTGGAAGGAGAAGGTGTCCACGGAGCCCCCACCCATCCTCGGCGGTTCCCATCACCACTGCAGTTCCATCCCAAGTC
 161 ACAGCTGCCCTAGGTCCCGTGTGGGAATGCTCGTGTGATGGATGGTCCTAAGCCTGTGGAGACTGTGCACGTGCCTCTTC
 241 CTGGCCCCCAGCAGGCAAGGAGGGGGGTCACAGGCCTTGCCCTCGAGCATGGCACCCTGGCCGCCTGGACCCAGCACTGT
 321 GGTTGTTGAGCCACACCAGTGGCCTCTGGGCATTCGGCTCAACGCAGGAGGGACATTCTGCTGGCCCACCCTGCGCGCTG
 401 TCATGCAGAGGCCATTCCCCCAGGCCTGTGTCTTCACCCACCTGCCATCATTGGCCTTTGCTGTCACTGGGAGAGAAGAG
 481 CCGTCCAGGGACCCATGGTGGCCCACATGTGGATGCCACATGCTGCTGTTTCCTGCTTGCCCGGCCACCACCCATGCCCT
 561 CCATAGGGTGAGGTGGAGCCATGGTGGTGCGTCCTTTACTCAACAACCCTCCAATCCGGATGCTGTGGGAAGGGCCGGGT
 641 CACTCGGATACCATCATCCCTGCGGATGCACCGCCGTACCCTGCTCATCTGGGAGTGGTTTCCCTGCGGTTACGTCCAAG
 721 CCCGCCTGCCCTGTGTGTTGGGGCTGGCTGAGTTTCGGTCTCCCCATCACCGGCCGCCTCGTGGAGAAGGCAGTGCCACG
 801 TGGGAGGACAAGGCCACGCCGGCAGCTTCCAGCCCTGCCGCAGAAGTGCCAGGATGTCCATCAGCCACTCGCCAGGGCAC
 881 GGAGCCGTCAGTCCACTGTTACGGGAGAATGTTGATTTCGCGGGTGCGAGGGCCGGGAGACAGATACTTGGCTGTGATGA
 961 GCAGACATCCTCTGTCCCCGTGGAGGGGTCAACACCAAGGTGGTGTTCGTGCACCAGAACCTGTCTCGGGCTGACGGGGG
1041 TGGCACACAGGACACGGGTGGATCCCAACAGGCAGCACCGCACCTCTGCCCGCCTCCCGCACTGCAGCTCCGCCCGCCGG
1121 GCTCTGCGTCCCCACGTCCCCTCGTCCCATCCCCACGTCCCCTCATCCCGTCACCTCGTCCCCACATCCCCTTGCCCCGT
1201 CACCTCGTCCTCATGTCCCCTTGTCCTGTCACCTCGTCCCCACGTCCCCTCGTCTCCTCATCCCCACGTCCTCTCGTCCC
1281 CTTGTCCCGTCCCCACATACCCTCGTCCCCATGTCCCCACGCAGGGCTCTCCTTCGTCTTAGGATCTGTCCAGCGCTGCT
1361 CTGGGTGGGTTAGCAACCCCAGGGCTGCTGTGATAGGAAGTCCCTGTTGTTCTCCGTACTGGCATTTCTATTTCTAGAAA
1441 TAATATTTGACATAGCCTTAATGGTCCTTAAAGAAGACATTTCAGTGTGAGATTCAGACTTCAGACGCTGAAACTGCTGC
1521 CTTTCAGGAAAGCACCACCAACGCTGGAGGAGGAGCCGGCCCTCACGCCCGCCCCGCGCCACGCTGTGGAACGGGGCTCC
1601 GGCAAGTGAAACCCAGAGGGTGTTTCCGAGGTGCTCGACAGTAGGTATTTTTGGAAGCTCAGATTTCACCATTTGATTGT
1681 ATAATCTTTTACCTATAAAATATTTATTTGAAGTAGAGGGTAAATCAGCGGTAAGAACAGTGAACACAGTGGTTGGGATA
1761 AAATAAGGTGACAAACATCACACCAAAGATGAGGGTAGCGAGCAACTGGCTTGAGCAGACAGAACGGGGAAGACTCCACT
1841 CTGTCCCGAGGGGCCAGCCGCAGGCGTCCCCAGGGCCACCCTGCCCTGAGGTCCTTGTGTGGCCGCCCTGGCTTGGCAGC
1921 CCTGCCCACGCTGCCCCCGCAAACAATGGTGTGTGCGTTTTTACAGCCCTTTTTAGGAACCCAATATGGGCATAAATGTA
2001 ACACCTGTAGCGGGGGCAGATTCTCTGTATGTTCAGTTAACAAATTATTTGTAATGTATTTTTTTAGAAATCTTAAAATT
2081 GCCTTTGCACTGAAGTATTTTCATAGCTGTTTATATCTCTTTTATTCATTTATTTAACATACTGTCTAATTTTAAAAATA
2161 GGTTTTTAAAGCTTTCATTTTTAAGTTTATGAAATTTTGGCCACTTTACATTTAGATTCTGGTGAGAGTTTTGACTGAAT
2241 GTTCCAATCTCTGATGAATGCGAATTTTCAGATTTGATTTTATTCTCTACACACACCTCTTCTTTTCTTGGTATTTCTGG
2321 TGGCAGTGATTAGTTGAACAGCACATTTAAGGCACGATAATTTGCTACACTTTTTCTTTACAATTTGTTGCAATTTCATC
2401 TGCTTTCTATGTTTCATTGTTAATTGCCATCCTTCAGCCTTAAAAATAGAAGATTCTCACGTGAAGGTTTAGTAAGTTGG
2481 GTCCCAGCTCTGCCTGTGTGGAGATAGTCACCATGTACCTCTGACAACAAGTTTTAGTGTGAAAGTCACTAAACTTTTAC
2561 ACACTCCCAAACGTCTTTTTAAAAATTGCTTGGGAAATTATTAAATGAATGTGCCTGATGATTTGAAATAGACAAGGGGC
2641 ACGAGATAAAAAAGAAAAGGATGAGAAGATCCTCAGTGAATGACGTTGCAGGGTCTTCATGCAATTTTCCACCTCGCAGT
2721 AGTTAGTATTTACTTGCCTTAAACTAACTTTGAAGCAAGTAATGTCAACTTTGAGCACTTTGTTGAGTTTTGAAAAATCT
2801 TATTTGTTGCTGCACAGGTTAATAAATTATCAATTTGTAATTCAGCATGTTGGTCAGAGACACGGTCACTGATTCACACC
2881 CAGTCCCTGCCACAGACCGTCTCAGACACGCACAGTGGGCCTGCTGCATGATTCACACCCAGTCCCTGCCACAGACCGTC
2961 TCAGACACGCACAGTGGGCCTGCTGCATGATTCACACCCAGTCCCTGCCACAGACCGTCTCAGACACGCACAGTGGGCCT
3041 GCTGCATGCGTGTTACCTGGCTTTTGGCTCCACGCTCACTCATAGCCATGTCCACATGGGGGCTTGCACACAGGATCACT
3121 CACATATGTACATGTACCCACCACAAACGTGCAAGCTCCTGCACACATGCATGCACACAAACGTGTACACAAGTGTGAGC
3201 TCCTACACGCATACACACACACACGTGTACATGCACCAAAGCATGTGTGACCTACAGACATGCAGAACATGCACGTGTAC
3281 ACATACCACAGACACGCGTGTGCATGCTCCTACACAATACATATGCACATATCATGAACAGCGTAAGTTCCTACACACGG
3361 ACGTGTGATACACACATGCATGTACAGGTAAGCACACATGTACAAGCTCCTACAGGCTTGCTCTCACACACGTGTATGCA
3441 CAGCAGAGAGACGTATGAGCTTCTACTGCACACATGCACACACACACGCACACGTACATTCACTACAAACGTGCAGCCTC
3521 CTGCACACGTGCACATTCATGTGTACACCACAAATGAGTTCCCAGACGTGTAAACACACGTGCACACATCGTACACATGT
3601 GAGCTCCCACACGTACACACAGATGCACATGGACACACCCCAAACACGCACAGGCTCCTACACACATGCACACACGTGTA
3681 CACCACAAACGAGCTCCCAGACATGTAAACACACGTCTCCCACACGTGAGCTCCCACACGTACACATGCACATGTACGCA
3761 CCACAAACACATGCGCAGGCTCCTGCAGGCGTGAATACACACATGCACACACATATACACACATGTGCCACAAACAAGTG
3841 CACACTGTCCTGGTGTCCTGCACTGCATCCTGCCTCCTTGCTGAGGGGCCCCTGTGAGAGGCCTCTGGATGGGCATGGGA
3921 AGATGGGCTCCCTGGCCCCCAGCCCATGCCTCCCTGGGATGAAGAGTCCCCCTCCTGGCAGAATGTCTGGGCTTTGCAGA
4001 GCAGGCCCCGGGGGTGAAGTCGCAGCTTCACTTACACCAGCTGCTCTGTGAGCAAGGCTTGGTGCCCTGGACAAGGCCCT
4081 TCCCCTTTAGGGAGGTCCAGCCTCGCAAGCTGAAACCTCCCCTCGGCTCAGCCCTATACCAGGCGGCCACAGCAGGACTG
4161 GCCACACCCACGCCGCACCTCATCCGTGCACGCGTCGGAGCACGGCCAGCCTTCCGCCACGAGCCAGCTGGGAAGGGCCG
4241 CGGCCGCCTAAAGCCCCAGTCAACCCAGCCTGTGTCTGAGCAGACAGGGCGAACAAGCAGGCCACACCGTCTCGAGGGAG
4321 GAGGCCAGATGCGGCCAGCGTCTCCAACAGGGTGACCATCCGCTCGGCTTGCTGAGCGTTTAAACAAATGTTTAGACAGG
4401 CTGTGGGGACTCCCCTGAGTTGAGCCTTGGCCAGGGGTCCGGTGCTGTCGCGGGAAACCTCCAGCCTTGTTCTTCAAACC
4481 ACTCAGCTCATGTGTTTTGCACTGACTAGTACTGAATAATACAACCACTCTTATTTAATGTTAGTATTATTTATTTGACA
4561 ACTCAGTGTCTAACAGCTTGATATGCAGGTCCTTGCATCCTACATTTCTTTAGGAAGTTACCCATTTGTAACTTTAAAAA
4641 CAGGAAAAATATCAGTTGGCAAATGCAATCTTTTTTTTTTTTAAGCTAAAGGTGGGTGAACTGGAATGAAAATCTTTCTG
4721 ATGTTGTGTCTATAAGCAGCCTTGATGGGATATGTTAGAAGTGTCATGAAAGTGTGATTCTACTTTTGCAGAAAAATCTA
4801 AAGATCAATTTATATAGCTTTATTTTTTACTTTATCAAAGTATACAGAATTTTAATATGCATATATTGTGTCTGACTTAA
4881 AATTATAATGTCTGCGTCACCATTTAAAATGTCTGTTCATTATGTAATGTAATAAAAGAAGGTCTTCAAAAATGTATTTA
4961 ACATGAATGGTATCCATAGTTGTCATCATCATAAATACTGGAGTTTATTTTTAAATTATTAAACATAGTAGGTGCATTAA
5041 CATAAATCAGTCTCCACACAGTAACATTTAACTGATAATTCATTAATCAGCTTTGAAAAATTAAATTGTTAATTAAACCA
5121 ATCTAACATTTCAGTAAAGTTTATTTTGTATGCTTCTGTTTTTAACTTTTATTTCTGTAGATAAACTGACTGGATAATAT
5201 TATATTGGACTTTTCTCTAGATTATCTAAGCAGGAGACCTGAATCTGCTTGCAATAAAGAATAAAAGTCTGCTTCAGTTT
5281 CTTTATAAAGAAACTCACACAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuGUGGU---AACA-GUGUGAGGu 5'
              |||:|   || | |||||||| 
Target 5' aagtCACTAAACTTTTACACACTCCc 3'
2543 - 2568 158.00 -14.00
2
miRNA  3' guuuGUGGUAACAGUGUGAGgu 5'
              || ||  || ||||||  
Target 5' ctctCAGCA-GGTGACACTCgc 3'
60 - 80 133.00 -13.60
3
miRNA  3' guUUGUGGUAACA-GUGUGAGGu 5'
            :||||   ||| ||::|||| 
Target 5' caGACACGCGTGTGCATGCTCCt 3'
3289 - 3311 132.00 -19.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
787109 3563 ClinVar
768635 3678 ClinVar
COSN18187881 65 COSMIC
COSN6222709 94 COSMIC
COSN28884205 109 COSMIC
COSN32076540 207 COSMIC
COSN26272128 292 COSMIC
COSN7393973 292 COSMIC
COSN6222710 551 COSMIC
COSN18419828 807 COSMIC
COSN8775343 1580 COSMIC
COSN16395961 1653 COSMIC
COSN25168552 1999 COSMIC
COSN1155895 2088 COSMIC
COSN1601888 2194 COSMIC
COSN8587174 2257 COSMIC
COSN18287964 2298 COSMIC
COSN30616429 2300 COSMIC
COSN6538553 2300 COSMIC
COSN30657701 2326 COSMIC
COSN31974546 2337 COSMIC
COSN18158963 2352 COSMIC
COSN28612837 2377 COSMIC
COSN8587175 2378 COSMIC
COSN30550934 2432 COSMIC
COSN1155896 2589 COSMIC
COSN1601889 2675 COSMIC
COSN4734804 2726 COSMIC
COSN22574050 3277 COSMIC
COSM6353208 3525 COSMIC
COSM8542166 3526 COSMIC
COSM2263799 3533 COSMIC
COSM8955737 3537 COSMIC
COSM7283585 3541 COSMIC
COSM7785304 3542 COSMIC
COSM1365551 3546 COSMIC
COSM6000929 3548 COSMIC
COSM4433986 3555 COSMIC
COSM1322967 3564 COSMIC
COSM9715598 3573 COSMIC
COSM7992621 3587 COSMIC
COSM8007904 3607 COSMIC
COSM5602866 3608 COSMIC
COSM4435377 3611 COSMIC
COSM6586749 3611 COSMIC
COSM6457537 3612 COSMIC
COSM8927398 3612 COSMIC
COSM1707042 3614 COSMIC
COSM5970895 3631 COSMIC
COSM4839861 3635 COSMIC
COSM7730642 3635 COSMIC
COSM4598580 3637 COSMIC
COSM8676178 3648 COSMIC
COSM3688620 3650 COSMIC
COSM4570900 3650 COSMIC
COSM1365552 3653 COSMIC
COSM9739825 3660 COSMIC
COSM291518 3663 COSMIC
COSM9685721 3664 COSMIC
COSM2263804 3677 COSMIC
COSM8888084 3683 COSMIC
COSM6607026 3686 COSMIC
COSM5822884 3687 COSMIC
COSM6463076 3687 COSMIC
COSM8118385 3694 COSMIC
COSM1365553 3697 COSMIC
COSM6607071 3699 COSMIC
COSM8266080 3710 COSMIC
COSM5034995 3711 COSMIC
COSM6015413 3722 COSMIC
COSM8872893 3724 COSMIC
COSM7742106 3743 COSMIC
COSM3467320 3750 COSMIC
COSM256371 3752 COSMIC
COSM8792507 3765 COSMIC
COSM7297848 3775 COSMIC
COSM7914910 3787 COSMIC
COSM8197658 3794 COSMIC
COSM8269969 3824 COSMIC
COSM8435674 3834 COSMIC
COSM6607047 3837 COSMIC
COSM3981936 3838 COSMIC
COSM6607058 3840 COSMIC
COSM5797470 3843 COSMIC
COSM9095431 3858 COSMIC
COSM3765677 3860 COSMIC
COSM4943984 3871 COSMIC
COSM7893044 3885 COSMIC
COSM8294044 3901 COSMIC
COSM8180721 3904 COSMIC
COSM6041253 3936 COSMIC
COSM5342284 3971 COSMIC
COSM7244898 4020 COSMIC
COSM4970907 4315 COSMIC
COSM6205595 4471 COSMIC
COSN32064607 4601 COSMIC
COSN21759441 4730 COSMIC
COSN29569052 4741 COSMIC
COSN20111047 4830 COSMIC
COSN17075756 4960 COSMIC
COSN8775344 5099 COSMIC
COSN21782291 5140 COSMIC
COSN31519465 5222 COSMIC
COSN15909552 5398 COSMIC
COSN28796510 5580 COSMIC
COSN26561398 5682 COSMIC
COSN31960953 5743 COSMIC
COSN21532047 5810 COSMIC
COSN31516930 5835 COSMIC
COSN31519161 5853 COSMIC
COSN31555787 5914 COSMIC
COSN25179110 6590 COSMIC
COSN32069227 6727 COSMIC
COSN9743121 6793 COSMIC
COSN20111053 6794 COSMIC
COSN25646064 7083 COSMIC
COSN5722610 7129 COSMIC
COSN28659998 7287 COSMIC
COSN4734805 7298 COSMIC
COSN26619372 7331 COSMIC
COSN17623556 7348 COSMIC
COSN24294711 7604 COSMIC
COSN32057941 7677 COSMIC
COSN26460418 7837 COSMIC
COSN27872557 7844 COSMIC
COSN19659025 8255 COSMIC
COSN31516914 8383 COSMIC
COSN31546843 8425 COSMIC
COSN5335008 8593 COSMIC
COSN1601890 8806 COSMIC
COSN8775345 8840 COSMIC
COSN22750174 8843 COSMIC
rs1765871 1044 GWAS
rs1278766 1775 GWAS
rs9577174 2300 GWAS
rs9577395 2377 GWAS
rs1278768 3342 GWAS
rs1278769 4020 GWAS
rs3742233 4841 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs556716700 4 dbSNP
rs1163266359 8 dbSNP
rs912892370 11 dbSNP
rs1393428689 15 dbSNP
rs751465467 15 dbSNP
rs201745020 16 dbSNP
rs1364483280 17 dbSNP
rs770364528 19 dbSNP
rs1382652870 28 dbSNP
rs536592930 32 dbSNP
rs749788319 33 dbSNP
rs771750869 34 dbSNP
rs775137345 42 dbSNP
rs760433701 44 dbSNP
rs754869268 46 dbSNP
rs144839412 48 dbSNP
rs776493759 49 dbSNP
rs765184682 52 dbSNP
rs750411403 53 dbSNP
rs573062516 54 dbSNP
rs1282037778 57 dbSNP
rs1222203235 60 dbSNP
rs1350029787 63 dbSNP
rs755804943 68 dbSNP
rs1245848207 77 dbSNP
rs937587750 78 dbSNP
rs1055946922 82 dbSNP
rs540443989 95 dbSNP
rs866093149 104 dbSNP
rs779900959 105 dbSNP
rs887111782 109 dbSNP
rs575182917 110 dbSNP
rs1016950637 111 dbSNP
rs1173750260 112 dbSNP
rs1479269155 113 dbSNP
rs1428104102 114 dbSNP
rs949444216 116 dbSNP
rs899065345 121 dbSNP
rs1240344569 125 dbSNP
rs902668437 134 dbSNP
rs1314080209 138 dbSNP
rs996074109 140 dbSNP
rs148593542 141 dbSNP
rs1282853592 143 dbSNP
rs954581093 144 dbSNP
rs1011626807 146 dbSNP
rs1027983393 149 dbSNP
rs953754032 151 dbSNP
rs184241587 153 dbSNP
rs374215559 154 dbSNP
rs1019352023 160 dbSNP
rs1404950152 169 dbSNP
rs1415764877 173 dbSNP
rs1020416606 179 dbSNP
rs562788011 185 dbSNP
rs1185675648 186 dbSNP
rs1473100157 188 dbSNP
rs972595342 189 dbSNP
rs1169396005 190 dbSNP
rs1399871130 215 dbSNP
rs919804106 232 dbSNP
rs530109208 235 dbSNP
rs978803478 236 dbSNP
rs115858407 238 dbSNP
rs937556469 239 dbSNP
rs1448019840 241 dbSNP
rs754996632 242 dbSNP
rs1317737092 243 dbSNP
rs991766985 249 dbSNP
rs1381890784 254 dbSNP
rs1331352813 259 dbSNP
rs1463231163 262 dbSNP
rs541147527 272 dbSNP
rs114334394 284 dbSNP
rs950236569 286 dbSNP
rs924038916 289 dbSNP
rs935460777 290 dbSNP
rs751672092 291 dbSNP
rs528268384 292 dbSNP
rs996441204 299 dbSNP
rs941473645 301 dbSNP
rs1038759458 302 dbSNP
rs1050660232 306 dbSNP
rs1200104782 308 dbSNP
rs889437728 313 dbSNP
rs899873893 319 dbSNP
rs996041459 320 dbSNP
rs1359302401 321 dbSNP
rs1309383577 328 dbSNP
rs546846042 334 dbSNP
rs9324215 341 dbSNP
rs1297251697 347 dbSNP
rs1009114664 348 dbSNP
rs1367220600 349 dbSNP
rs1020127599 351 dbSNP
rs1423962385 362 dbSNP
rs990738540 367 dbSNP
rs1159984723 375 dbSNP
rs1420924664 381 dbSNP
rs1248764536 382 dbSNP
rs1278761 383 dbSNP
rs1271537982 396 dbSNP
rs572332201 397 dbSNP
rs1490344707 403 dbSNP
rs1287337021 404 dbSNP
rs568715461 421 dbSNP
rs536256909 422 dbSNP
rs1424509769 425 dbSNP
rs1413982914 434 dbSNP
rs1332212234 437 dbSNP
rs1219450063 438 dbSNP
rs1361428603 447 dbSNP
rs36077903 447 dbSNP
rs189048000 448 dbSNP
rs182031602 449 dbSNP
rs1290555955 455 dbSNP
rs1361133836 455 dbSNP
rs1455465444 472 dbSNP
rs1338873514 477 dbSNP
rs1158428126 491 dbSNP
rs1480900168 493 dbSNP
rs541310415 497 dbSNP
rs563647273 505 dbSNP
rs9549597 506 dbSNP
rs1207428352 515 dbSNP
rs558764561 517 dbSNP
rs1259658201 518 dbSNP
rs915395954 519 dbSNP
rs1343760066 520 dbSNP
rs1216978296 521 dbSNP
rs1280082664 523 dbSNP
rs932171268 524 dbSNP
rs187641079 525 dbSNP
rs544332966 535 dbSNP
rs1340882894 539 dbSNP
rs983332598 544 dbSNP
rs1256283254 545 dbSNP
rs770051477 550 dbSNP
rs943672019 561 dbSNP
rs775982986 568 dbSNP
rs1288417360 570 dbSNP
rs79195225 570 dbSNP
rs1424624929 572 dbSNP
rs375714358 575 dbSNP
rs1174533864 581 dbSNP
rs993912942 582 dbSNP
rs1373994504 584 dbSNP
rs1195724248 591 dbSNP
rs574707613 597 dbSNP
rs941429697 602 dbSNP
rs367717018 613 dbSNP
rs542264430 616 dbSNP
rs1183710730 636 dbSNP
rs1427317453 641 dbSNP
rs1415593779 645 dbSNP
rs561146417 649 dbSNP
rs1462265425 655 dbSNP
rs564145364 657 dbSNP
rs932617712 661 dbSNP
rs1051055584 662 dbSNP
rs890345119 665 dbSNP
rs1023516069 673 dbSNP
rs1325827612 676 dbSNP
rs970642974 684 dbSNP
rs528538601 686 dbSNP
rs1453549976 693 dbSNP
rs528430817 694 dbSNP
rs540420613 697 dbSNP
rs1469507132 700 dbSNP
rs190765962 702 dbSNP
rs1170052982 703 dbSNP
rs1460757711 705 dbSNP
rs1373076201 707 dbSNP
rs1184736472 709 dbSNP
rs1000343109 711 dbSNP
rs1240762267 715 dbSNP
rs532341900 723 dbSNP
rs550367204 724 dbSNP
rs568951834 729 dbSNP
rs529615379 731 dbSNP
rs547814516 732 dbSNP
rs1292163247 744 dbSNP
rs147290590 745 dbSNP
rs1357133629 748 dbSNP
rs986266155 749 dbSNP
rs1217097508 755 dbSNP
rs972039044 756 dbSNP
rs1278762 758 dbSNP
rs1390083748 759 dbSNP
rs908696271 766 dbSNP
rs559206954 767 dbSNP
rs1248587992 771 dbSNP
rs1427135637 777 dbSNP
rs974217819 779 dbSNP
rs921316032 786 dbSNP
rs1178019786 787 dbSNP
rs1379012629 789 dbSNP
rs772782706 790 dbSNP
rs1269377947 794 dbSNP
rs1051024839 797 dbSNP
rs1224371584 798 dbSNP
rs1159673894 800 dbSNP
rs912585673 801 dbSNP
rs570915347 803 dbSNP
rs888192805 813 dbSNP
rs564173477 814 dbSNP
rs760439637 817 dbSNP
rs1237157936 818 dbSNP
rs180677007 819 dbSNP
rs1304184312 822 dbSNP
rs1407116549 826 dbSNP
rs999992854 835 dbSNP
rs1325110777 839 dbSNP
rs1054296682 840 dbSNP
rs1023468431 841 dbSNP
rs140944423 848 dbSNP
rs894200493 849 dbSNP
rs867528976 850 dbSNP
rs1003445375 861 dbSNP
rs1216430032 866 dbSNP
rs1031366543 870 dbSNP
rs1240745470 882 dbSNP
rs1203443545 883 dbSNP
rs1328795919 886 dbSNP
rs1264689995 896 dbSNP
rs1284156939 909 dbSNP
rs1225796236 911 dbSNP
rs1012695676 912 dbSNP
rs1353976242 917 dbSNP
rs1274558073 940 dbSNP
rs1432143409 942 dbSNP
rs1347409034 943 dbSNP
rs1023965794 945 dbSNP
rs956704881 946 dbSNP
rs989905727 948 dbSNP
rs1406452677 952 dbSNP
rs1178130426 961 dbSNP
rs971120821 973 dbSNP
rs1278763 987 dbSNP
rs550946119 988 dbSNP
rs1178123031 989 dbSNP
rs1236401347 992 dbSNP
rs1442140820 1012 dbSNP
rs554248654 1012 dbSNP
rs529536260 1015 dbSNP
rs1263768224 1020 dbSNP
rs144257187 1022 dbSNP
rs1015809711 1023 dbSNP
rs986218699 1024 dbSNP
rs147800745 1030 dbSNP
rs1215505585 1032 dbSNP
rs1364753852 1038 dbSNP
rs386774995 1043 dbSNP
rs1765871 1044 dbSNP
rs921453598 1045 dbSNP
rs1765762 1046 dbSNP
rs1382906953 1049 dbSNP
rs577746138 1063 dbSNP
rs1338050700 1064 dbSNP
rs139445846 1068 dbSNP
rs1358167358 1074 dbSNP
rs1464744389 1074 dbSNP
rs1328733969 1085 dbSNP
rs1411444126 1089 dbSNP
rs1417364279 1095 dbSNP
rs1167274741 1100 dbSNP
rs149885573 1101 dbSNP
rs1243853630 1103 dbSNP
rs1447498644 1114 dbSNP
rs1185436655 1126 dbSNP
rs1460186359 1128 dbSNP
rs1311914466 1131 dbSNP
rs1237091986 1141 dbSNP
rs1338557797 1146 dbSNP
rs945433922 1148 dbSNP
rs1309622869 1152 dbSNP
rs1271254472 1153 dbSNP
rs1360748128 1154 dbSNP
rs1246731499 1156 dbSNP
rs1449793350 1157 dbSNP
rs978499551 1161 dbSNP
rs1298379076 1164 dbSNP
rs1443848516 1165 dbSNP
rs924517287 1167 dbSNP
rs935927943 1178 dbSNP
rs1307133508 1179 dbSNP
rs567104960 1180 dbSNP
rs757342690 1188 dbSNP
rs1386985496 1190 dbSNP
rs1165599972 1193 dbSNP
rs1413420814 1194 dbSNP
rs1178012856 1201 dbSNP
rs1481703355 1209 dbSNP
rs909585510 1212 dbSNP
rs781491112 1214 dbSNP
rs947785172 1216 dbSNP
rs1490670557 1221 dbSNP
rs145074719 1223 dbSNP
rs894342789 1224 dbSNP
rs570477459 1227 dbSNP
rs1045546059 1228 dbSNP
rs1307003161 1229 dbSNP
rs1256306337 1230 dbSNP
rs1225144756 1231 dbSNP
rs1370659834 1236 dbSNP
rs1459143997 1246 dbSNP
rs1307232154 1259 dbSNP
rs906949873 1261 dbSNP
rs1367451940 1265 dbSNP
rs547776839 1268 dbSNP
rs1278764 1269 dbSNP
rs898725958 1270 dbSNP
rs995740399 1279 dbSNP
rs749625112 1281 dbSNP
rs527300635 1282 dbSNP
rs552560031 1287 dbSNP
rs1022715072 1288 dbSNP
rs1220909847 1295 dbSNP
rs571144912 1303 dbSNP
rs1425231038 1304 dbSNP
rs1465690784 1314 dbSNP
rs1314802421 1316 dbSNP
rs1301687051 1320 dbSNP
rs1178810562 1325 dbSNP
rs185987154 1330 dbSNP
rs967204778 1336 dbSNP
rs978089411 1339 dbSNP
rs925293813 1343 dbSNP
rs763569856 1346 dbSNP
rs1018999627 1349 dbSNP
rs1334630438 1357 dbSNP
rs1339583443 1363 dbSNP
rs935891359 1364 dbSNP
rs990101575 1367 dbSNP
rs915745259 1369 dbSNP
rs1158723366 1372 dbSNP
rs1320198003 1376 dbSNP
rs948496783 1387 dbSNP
rs774780371 1388 dbSNP
rs1045984599 1393 dbSNP
rs1197137431 1394 dbSNP
rs1255450096 1395 dbSNP
rs1263000894 1397 dbSNP
rs906924202 1398 dbSNP
rs748656952 1399 dbSNP
rs117253092 1406 dbSNP
rs898182793 1408 dbSNP
rs995705906 1411 dbSNP
rs1261048436 1412 dbSNP
rs1028568899 1415 dbSNP
rs1191869882 1416 dbSNP
rs568558578 1417 dbSNP
rs1428688735 1418 dbSNP
rs1174778337 1419 dbSNP
rs536001254 1424 dbSNP
rs1363119332 1425 dbSNP
rs1319924794 1426 dbSNP
rs890037221 1428 dbSNP
rs1008316346 1429 dbSNP
rs542049774 1433 dbSNP
rs554311650 1434 dbSNP
rs1278765 1436 dbSNP
rs1448134433 1437 dbSNP
rs1246918921 1439 dbSNP
rs1397934324 1441 dbSNP
rs1032337023 1442 dbSNP
rs539839294 1448 dbSNP
rs75378239 1449 dbSNP
rs776174034 1457 dbSNP
rs1011221348 1463 dbSNP
rs1226125904 1467 dbSNP
rs759642421 1475 dbSNP
rs759321830 1476 dbSNP
rs577099136 1477 dbSNP
rs1385339782 1492 dbSNP
rs1332416444 1493 dbSNP
rs1395615976 1494 dbSNP
rs1007531193 1496 dbSNP
rs1300225432 1497 dbSNP
rs1428409996 1498 dbSNP
rs56117450 1502 dbSNP
rs939775551 1505 dbSNP
rs1163713063 1508 dbSNP
rs1445919712 1509 dbSNP
rs562747533 1511 dbSNP
rs1281671391 1515 dbSNP
rs1186407064 1516 dbSNP
rs564108610 1519 dbSNP
rs1252430811 1521 dbSNP
rs758470203 1525 dbSNP
rs1026897669 1526 dbSNP
rs1292398638 1533 dbSNP
rs1223390479 1534 dbSNP
rs574293397 1536 dbSNP
rs541484030 1537 dbSNP
rs78893452 1540 dbSNP
rs1244378416 1542 dbSNP
rs376427392 1543 dbSNP
rs750556571 1544 dbSNP
rs1408356166 1546 dbSNP
rs1370554308 1551 dbSNP
rs1304267777 1555 dbSNP
rs1023238279 1556 dbSNP
rs969020047 1562 dbSNP
rs1162072555 1564 dbSNP
rs747288418 1568 dbSNP
rs1008451975 1570 dbSNP
rs149102758 1571 dbSNP
rs143196566 1573 dbSNP
rs1472132354 1573 dbSNP
rs1269259126 1578 dbSNP
rs1224639269 1583 dbSNP
rs1264739011 1584 dbSNP
rs1434404765 1586 dbSNP
rs532072690 1589 dbSNP
rs546015086 1591 dbSNP
rs999614202 1592 dbSNP
rs913710537 1599 dbSNP
rs1351725679 1601 dbSNP
rs1032801846 1604 dbSNP
rs1227005801 1607 dbSNP
rs1379640183 1609 dbSNP
rs958117943 1610 dbSNP
rs1012227340 1611 dbSNP
rs1023661761 1616 dbSNP
rs1329833774 1620 dbSNP
rs1322347547 1621 dbSNP
rs1400775217 1626 dbSNP
rs78113857 1627 dbSNP
rs981795979 1644 dbSNP
rs943336569 1648 dbSNP
rs568622561 1651 dbSNP
rs961543416 1652 dbSNP
rs145048652 1665 dbSNP
rs919641358 1666 dbSNP
rs931077434 1668 dbSNP
rs1447644343 1684 dbSNP
rs1049361523 1696 dbSNP
rs901889244 1698 dbSNP
rs993972403 1699 dbSNP
rs1221263873 1702 dbSNP
rs1304187535 1704 dbSNP
rs1026429075 1705 dbSNP
rs910910173 1708 dbSNP
rs547880798 1713 dbSNP
rs556540221 1714 dbSNP
rs1238567714 1718 dbSNP
rs902767918 1719 dbSNP
rs1000068379 1723 dbSNP
rs1406333419 1725 dbSNP
rs1178019334 1726 dbSNP
rs1053972046 1727 dbSNP
rs138909844 1728 dbSNP
rs1317896747 1729 dbSNP
rs893874048 1730 dbSNP
rs1318727193 1733 dbSNP
rs1476314230 1735 dbSNP
rs1250004275 1740 dbSNP
rs1263332020 1743 dbSNP
rs1012362885 1753 dbSNP
rs558170055 1754 dbSNP
rs981724913 1764 dbSNP
rs577058026 1765 dbSNP
rs1278766 1775 dbSNP
rs1294835816 1781 dbSNP
rs970754108 1786 dbSNP
rs1226991638 1791 dbSNP
rs1383159087 1795 dbSNP
rs1304210874 1807 dbSNP
rs1445286237 1808 dbSNP
rs1408525076 1813 dbSNP
rs1329239491 1815 dbSNP
rs1431601851 1817 dbSNP
rs1388211910 1820 dbSNP
rs1423032970 1824 dbSNP
rs1002787712 1825 dbSNP
rs556046663 1834 dbSNP
rs961325315 1836 dbSNP
rs1183819693 1842 dbSNP
rs779315174 1851 dbSNP
rs574257371 1852 dbSNP
rs868376081 1854 dbSNP
rs1205639846 1857 dbSNP
rs1484348576 1859 dbSNP
rs1326707986 1866 dbSNP
rs1278767 1877 dbSNP
rs988267480 1886 dbSNP
rs1445305303 1887 dbSNP
rs952446416 1896 dbSNP
rs190100009 1897 dbSNP
rs910885673 1904 dbSNP
rs1411424529 1907 dbSNP
rs571842629 1908 dbSNP
rs976454679 1909 dbSNP
rs924160846 1913 dbSNP
rs1310977176 1918 dbSNP
rs935617030 1920 dbSNP
rs1053941509 1921 dbSNP
rs1166945169 1926 dbSNP
rs777111617 1931 dbSNP
rs1040293748 1938 dbSNP
rs1256934853 1941 dbSNP
rs1183441494 1942 dbSNP
rs1473769436 1943 dbSNP
rs1249994948 1945 dbSNP
rs1182098181 1960 dbSNP
rs1456065911 1963 dbSNP
rs545473984 1964 dbSNP
rs529375729 1965 dbSNP
rs1482858572 1979 dbSNP
rs1179926555 1982 dbSNP
rs1415650409 1989 dbSNP
rs564156770 1990 dbSNP
rs376048709 1991 dbSNP
rs1229785095 1992 dbSNP
rs45460799 1993 dbSNP
rs887870759 1997 dbSNP
rs1369619681 1999 dbSNP
rs1006767556 2005 dbSNP
rs906618749 2006 dbSNP
rs1349579540 2009 dbSNP
rs1160201038 2010 dbSNP
rs776283587 2014 dbSNP
rs1003918133 2020 dbSNP
rs1014937646 2021 dbSNP
rs1158827060 2026 dbSNP
rs897039556 2041 dbSNP
rs1434290113 2042 dbSNP
rs1447904221 2051 dbSNP
rs1301509429 2056 dbSNP
rs1357747806 2057 dbSNP
rs562385621 2058 dbSNP
rs1210242157 2066 dbSNP
rs1326581072 2068 dbSNP
rs1026761879 2076 dbSNP
rs1415087792 2079 dbSNP
rs1267322934 2080 dbSNP
rs564026889 2083 dbSNP
rs1313951570 2084 dbSNP
rs1315619971 2087 dbSNP
rs201885443 2088 dbSNP
rs1367004485 2098 dbSNP
rs769700926 2100 dbSNP
rs1035956295 2101 dbSNP
rs960628404 2104 dbSNP
rs1320380407 2106 dbSNP
rs1466861175 2108 dbSNP
rs965172136 2113 dbSNP
rs1207903001 2115 dbSNP
rs1021087423 2118 dbSNP
rs967813249 2121 dbSNP
rs1485880471 2124 dbSNP
rs566164989 2129 dbSNP
rs1317040807 2132 dbSNP
rs539966661 2137 dbSNP
rs1200885258 2139 dbSNP
rs1476943642 2142 dbSNP
rs1253956317 2143 dbSNP
rs1232483379 2146 dbSNP
rs551585602 2147 dbSNP
rs935570371 2148 dbSNP
rs989767631 2150 dbSNP
rs915411624 2154 dbSNP
rs775475478 2157 dbSNP
rs1174571836 2161 dbSNP
rs964545439 2162 dbSNP
rs762952913 2165 dbSNP
rs1415795259 2166 dbSNP
rs975944443 2169 dbSNP
rs1404833407 2170 dbSNP
rs764053329 2173 dbSNP
rs1466020086 2174 dbSNP
rs79461906 2180 dbSNP
rs1170017501 2191 dbSNP
rs906580145 2193 dbSNP
rs1270316686 2194 dbSNP
rs939468388 2197 dbSNP
rs1036752758 2198 dbSNP
rs909239209 2202 dbSNP
rs1253846215 2204 dbSNP
rs1276097448 2205 dbSNP
rs751838785 2207 dbSNP
rs1199644282 2212 dbSNP
rs1483378790 2212 dbSNP
rs77124014 2213 dbSNP
rs994036606 2223 dbSNP
rs116148800 2224 dbSNP
rs888371485 2226 dbSNP
rs1207715717 2227 dbSNP
rs906000571 2228 dbSNP
rs1251917707 2229 dbSNP
rs1395807616 2231 dbSNP
rs568041204 2232 dbSNP
rs1310406150 2238 dbSNP
rs1006650644 2244 dbSNP
rs1179818397 2246 dbSNP
rs1163284350 2247 dbSNP
rs1459168377 2254 dbSNP
rs1366321493 2255 dbSNP
rs1018125958 2256 dbSNP
rs1253620666 2257 dbSNP
rs1248471211 2258 dbSNP
rs965484925 2259 dbSNP
rs1454872022 2267 dbSNP
rs1173201932 2276 dbSNP
rs1482657685 2282 dbSNP
rs1393058131 2285 dbSNP
rs755233305 2286 dbSNP
rs1168280047 2287 dbSNP
rs1395762596 2290 dbSNP
rs1389549074 2293 dbSNP
rs1324964697 2295 dbSNP
rs149633794 2297 dbSNP
rs753125880 2298 dbSNP
rs9577174 2300 dbSNP
rs1343820116 2303 dbSNP
rs1231157426 2304 dbSNP
rs778253615 2306 dbSNP
rs1252237746 2312 dbSNP
rs1339320713 2315 dbSNP
rs1168351191 2316 dbSNP
rs1408561805 2318 dbSNP
rs572044555 2319 dbSNP
rs1350388239 2321 dbSNP
rs956439768 2322 dbSNP
rs771552688 2324 dbSNP
rs182744658 2325 dbSNP
rs45462691 2326 dbSNP
rs1156652892 2328 dbSNP
rs768389344 2328 dbSNP
rs769359194 2329 dbSNP
rs1372227818 2334 dbSNP
rs964493264 2336 dbSNP
rs975893527 2337 dbSNP
rs776102070 2338 dbSNP
rs1395099894 2345 dbSNP
rs769640815 2351 dbSNP
rs1323301571 2352 dbSNP
rs1366985466 2355 dbSNP
rs1435290627 2361 dbSNP
rs772974159 2362 dbSNP
rs939417560 2366 dbSNP
rs1225901857 2367 dbSNP
rs1267802794 2371 dbSNP
rs9577395 2377 dbSNP
rs1213210683 2378 dbSNP
rs758789704 2380 dbSNP
rs543467323 2381 dbSNP
rs950656273 2384 dbSNP
rs930612029 2385 dbSNP
rs562349627 2386 dbSNP
rs1049064160 2390 dbSNP
rs1189325107 2392 dbSNP
rs1425537621 2398 dbSNP
rs140879558 2400 dbSNP
rs1205436984 2404 dbSNP
rs187435022 2405 dbSNP
rs1006786380 2406 dbSNP
rs559938385 2407 dbSNP
rs533368052 2414 dbSNP
rs1254929246 2415 dbSNP
rs1446787669 2418 dbSNP
rs1455122163 2420 dbSNP
rs1178553975 2422 dbSNP
rs1279730323 2422 dbSNP
rs1221452613 2429 dbSNP
rs938798468 2433 dbSNP
rs1057289712 2437 dbSNP
rs1378924300 2448 dbSNP
rs1228488509 2454 dbSNP
rs1366985397 2455 dbSNP
rs1471362912 2458 dbSNP
rs998343967 2460 dbSNP
rs568108772 2461 dbSNP
rs143255671 2463 dbSNP
rs1335884031 2466 dbSNP
rs956448750 2471 dbSNP
rs1389608113 2477 dbSNP
rs1401375841 2478 dbSNP
rs1010468698 2480 dbSNP
rs1450155264 2483 dbSNP
rs1392028019 2484 dbSNP
rs1186940198 2487 dbSNP
rs1010546040 2492 dbSNP
rs1021986921 2495 dbSNP
rs969608861 2500 dbSNP
rs1403214711 2501 dbSNP
rs1238457682 2503 dbSNP
rs1043729264 2505 dbSNP
rs903490934 2507 dbSNP
rs879229632 2514 dbSNP
rs535203351 2520 dbSNP
rs570073125 2521 dbSNP
rs1271812379 2522 dbSNP
rs900271497 2524 dbSNP
rs981074849 2533 dbSNP
rs530912143 2537 dbSNP
rs1285778408 2539 dbSNP
rs923893798 2543 dbSNP
rs114395060 2544 dbSNP
rs35907405 2545 dbSNP
rs568003241 2545 dbSNP
rs1030161966 2547 dbSNP
rs1431504323 2553 dbSNP
rs1329237187 2554 dbSNP
rs1337402661 2555 dbSNP
rs950632340 2556 dbSNP
rs535407358 2560 dbSNP
rs553655155 2562 dbSNP
rs773671093 2567 dbSNP
rs1472021189 2568 dbSNP
rs1016612068 2570 dbSNP
rs972649996 2573 dbSNP
rs1239529032 2578 dbSNP
rs747480012 2579 dbSNP
rs1271922080 2581 dbSNP
rs919319985 2582 dbSNP
rs1322023735 2583 dbSNP
rs565827283 2584 dbSNP
rs930747982 2587 dbSNP
rs539273857 2588 dbSNP
rs556712741 2589 dbSNP
rs910583068 2592 dbSNP
rs7324828 2593 dbSNP
rs1249065230 2594 dbSNP
rs1296592281 2597 dbSNP
rs1039666169 2613 dbSNP
rs1342626654 2620 dbSNP
rs901090372 2621 dbSNP
rs1183035976 2623 dbSNP
rs1368233578 2629 dbSNP
rs933803192 2631 dbSNP
rs1167177686 2632 dbSNP
rs1052708985 2637 dbSNP
rs367814782 2638 dbSNP
rs1473883186 2642 dbSNP
rs913385452 2647 dbSNP
rs147372613 2651 dbSNP
rs374754566 2652 dbSNP
rs1021955883 2655 dbSNP
rs904892460 2659 dbSNP
rs1043292351 2668 dbSNP
rs1467732338 2676 dbSNP
rs1002867083 2680 dbSNP
rs1035238839 2692 dbSNP
rs904788977 2693 dbSNP
rs1219665785 2702 dbSNP
rs961262441 2707 dbSNP
rs371260924 2709 dbSNP
rs1295316759 2710 dbSNP
rs148437915 2715 dbSNP
rs1026465700 2716 dbSNP
rs1459148770 2717 dbSNP
rs952118487 2721 dbSNP
rs984876099 2723 dbSNP
rs1434208343 2728 dbSNP
rs1338471656 2733 dbSNP
rs1191167695 2748 dbSNP
rs1467803386 2756 dbSNP
rs1248243901 2774 dbSNP
rs1210141465 2780 dbSNP
rs573680677 2781 dbSNP
rs1259886943 2782 dbSNP
rs1210758760 2784 dbSNP
rs1303551876 2787 dbSNP
rs1030524688 2791 dbSNP
rs1298628482 2793 dbSNP
rs886249391 2795 dbSNP
rs1383285424 2797 dbSNP
rs1288629755 2798 dbSNP
rs1005125685 2804 dbSNP
rs1361398980 2806 dbSNP
rs1171265780 2813 dbSNP
rs1218128461 2814 dbSNP
rs1190143746 2818 dbSNP
rs1249659352 2819 dbSNP
rs1016148505 2831 dbSNP
rs1260840445 2831 dbSNP
rs1342147621 2835 dbSNP
rs1196874567 2845 dbSNP
rs1210004444 2846 dbSNP
rs943346699 2849 dbSNP
rs142571497 2850 dbSNP
rs562608755 2853 dbSNP
rs1484900146 2855 dbSNP
rs547873083 2856 dbSNP
rs1190446311 2857 dbSNP
rs559808145 2858 dbSNP
rs1295392014 2860 dbSNP
rs76821084 2861 dbSNP
rs1034330100 2869 dbSNP
rs1311596833 2886 dbSNP
rs1434597831 2889 dbSNP
rs1477266929 2890 dbSNP
rs1167750076 2891 dbSNP
rs533538758 2897 dbSNP
rs922513125 2898 dbSNP
rs992895942 2905 dbSNP
rs933918260 2907 dbSNP
rs759697384 2910 dbSNP
rs531617576 2911 dbSNP
rs946440055 2912 dbSNP
rs1483327615 2914 dbSNP
rs1043533686 2918 dbSNP
rs563785865 2919 dbSNP
rs904946300 2922 dbSNP
rs1399608846 2923 dbSNP
rs1293595770 2926 dbSNP
rs1337441127 2927 dbSNP
rs1291764763 2928 dbSNP
rs1001848557 2929 dbSNP
rs540578060 2930 dbSNP
rs1395076203 2934 dbSNP
rs1163490651 2936 dbSNP
rs1255938881 2942 dbSNP
rs896717837 2950 dbSNP
rs1163901376 2954 dbSNP
rs1346285096 2957 dbSNP
rs994186006 2960 dbSNP
rs886194842 2961 dbSNP
rs544334802 2965 dbSNP
rs1026434647 2970 dbSNP
rs374575288 2971 dbSNP
rs1184389687 2978 dbSNP
rs1263305562 2980 dbSNP
rs1264804881 2987 dbSNP
rs1233055752 2989 dbSNP
rs1428598719 2998 dbSNP
rs567277362 2998 dbSNP
rs1237437187 3004 dbSNP
rs762788550 3011 dbSNP
rs111647673 3012 dbSNP
rs1001437897 3022 dbSNP
rs1457581739 3023 dbSNP
rs9549316 3023 dbSNP
rs539600713 3034 dbSNP
rs960006228 3038 dbSNP
rs551322914 3040 dbSNP
rs1469520269 3044 dbSNP
rs150923813 3045 dbSNP
rs1419400603 3051 dbSNP
rs766467403 3059 dbSNP
rs753964929 3060 dbSNP
rs1387345201 3065 dbSNP
rs1465637492 3066 dbSNP
rs1286736457 3076 dbSNP
rs537093727 3077 dbSNP
rs1350568147 3079 dbSNP
rs139463013 3080 dbSNP
rs1369477737 3085 dbSNP
rs371589710 3088 dbSNP
rs975608650 3088 dbSNP
rs922858606 3092 dbSNP
rs1237111201 3096 dbSNP
rs1346766637 3098 dbSNP
rs1304696966 3106 dbSNP
rs1353430911 3113 dbSNP
rs563055680 3123 dbSNP
rs1436676385 3131 dbSNP
rs386774996 3133 dbSNP
rs879390838 3133 dbSNP
rs12585036 3134 dbSNP
rs9549317 3135 dbSNP
rs1037482851 3138 dbSNP
rs1191475883 3144 dbSNP
rs937782987 3151 dbSNP
rs898968507 3152 dbSNP
rs1250575717 3153 dbSNP
rs560806806 3155 dbSNP
rs372405433 3159 dbSNP
rs549562533 3160 dbSNP
rs143437437 3163 dbSNP
rs59110136 3164 dbSNP
rs888039001 3166 dbSNP
rs1429753533 3169 dbSNP
rs1006318902 3172 dbSNP
rs1340788678 3174 dbSNP
rs780723910 3179 dbSNP
rs964804859 3182 dbSNP
rs7327930 3185 dbSNP
rs1412820040 3190 dbSNP
rs1373736233 3200 dbSNP
rs1173068729 3201 dbSNP
rs1030322315 3202 dbSNP
rs199897071 3204 dbSNP
rs956273097 3205 dbSNP
rs1238367792 3209 dbSNP
rs542672468 3214 dbSNP
rs913786491 3215 dbSNP
rs140338287 3216 dbSNP
rs1308950909 3218 dbSNP
rs1270463188 3222 dbSNP
rs979241422 3229 dbSNP
rs528440087 3231 dbSNP
rs1000224552 3239 dbSNP
rs1356825623 3240 dbSNP
rs926478444 3243 dbSNP
rs1294849393 3256 dbSNP
rs1412914088 3257 dbSNP
rs1354711604 3267 dbSNP
rs762017843 3267 dbSNP
rs1443034002 3268 dbSNP
rs1033071731 3270 dbSNP
rs1356283193 3272 dbSNP
rs745331819 3275 dbSNP
rs190810521 3276 dbSNP
rs368918441 3277 dbSNP
rs1474550714 3283 dbSNP
rs1056657625 3291 dbSNP
rs1183460774 3298 dbSNP
rs1481332136 3303 dbSNP
rs917679455 3305 dbSNP
rs928942808 3307 dbSNP
rs1047401820 3311 dbSNP
rs1203408307 3315 dbSNP
rs527987181 3318 dbSNP
rs1274862359 3319 dbSNP
rs1231225397 3320 dbSNP
rs1333803989 3320 dbSNP
rs1288910531 3323 dbSNP
rs983075756 3325 dbSNP
rs533118857 3327 dbSNP
rs1375643175 3328 dbSNP
rs907517784 3329 dbSNP
rs1441803347 3332 dbSNP
rs1278768 3342 dbSNP
rs750290720 3343 dbSNP
rs1460219050 3350 dbSNP
rs920345953 3351 dbSNP
rs937124768 3353 dbSNP
rs1309551239 3359 dbSNP
rs1317196996 3363 dbSNP
rs1039163576 3365 dbSNP
rs900700005 3366 dbSNP
rs1160258607 3367 dbSNP
rs997605946 3369 dbSNP
rs183874487 3370 dbSNP
rs956156155 3371 dbSNP
rs1268470773 3372 dbSNP
rs1213715605 3373 dbSNP
rs1237520884 3380 dbSNP
rs1217925126 3383 dbSNP
rs537256840 3385 dbSNP
rs1021659486 3386 dbSNP
rs1305041769 3389 dbSNP
rs1479596389 3393 dbSNP
rs1178773358 3399 dbSNP
rs895692663 3408 dbSNP
rs1250940471 3410 dbSNP
rs949990763 3427 dbSNP
rs1164467247 3428 dbSNP
rs967944758 3429 dbSNP
rs1343948301 3432 dbSNP
rs1463092155 3438 dbSNP
rs145486589 3440 dbSNP
rs1396317001 3441 dbSNP
rs1354498310 3453 dbSNP
rs534585005 3457 dbSNP
rs959429437 3459 dbSNP
rs1262215584 3460 dbSNP
rs567988047 3466 dbSNP
rs1440620624 3471 dbSNP
rs759484184 3476 dbSNP
rs767611815 3477 dbSNP
rs1162186459 3478 dbSNP
rs748952498 3479 dbSNP
rs756403511 3483 dbSNP
rs1348728383 3488 dbSNP
rs1287871131 3490 dbSNP
rs764612141 3493 dbSNP
rs1380922458 3494 dbSNP
rs1232433359 3496 dbSNP
rs1295493470 3499 dbSNP
rs1356676746 3500 dbSNP
rs1233142014 3501 dbSNP
rs903154709 3502 dbSNP
rs1331262550 3503 dbSNP
rs1384264580 3505 dbSNP
rs1360245456 3507 dbSNP
rs1216563242 3509 dbSNP
rs113739799 3510 dbSNP
rs1485014710 3511 dbSNP
rs1202023703 3512 dbSNP
rs1257893090 3513 dbSNP
rs757844210 3517 dbSNP
rs779526162 3520 dbSNP
rs746555281 3521 dbSNP
rs200551675 3524 dbSNP
rs1290177 3525 dbSNP
rs140702919 3531 dbSNP
rs144619142 3532 dbSNP
rs942277969 3533 dbSNP
rs769375979 3541 dbSNP
rs772992390 3542 dbSNP
rs749039026 3545 dbSNP
rs146660189 3546 dbSNP
rs199643298 3547 dbSNP
rs900755087 3548 dbSNP
rs371946066 3549 dbSNP
rs759483715 3550 dbSNP
rs1315362002 3551 dbSNP
rs780701736 3554 dbSNP
rs1280817570 3555 dbSNP
rs146811815 3563 dbSNP
rs376903583 3564 dbSNP
rs764345938 3565 dbSNP
rs754289820 3567 dbSNP
rs771078337 3572 dbSNP
rs983407955 3572 dbSNP
rs1015863588 3573 dbSNP
rs1247724070 3574 dbSNP
rs1434578345 3575 dbSNP
rs1413643721 3586 dbSNP
rs143496402 3587 dbSNP
rs747632489 3588 dbSNP
rs961973550 3590 dbSNP
rs1010354384 3597 dbSNP
rs765615592 3599 dbSNP
rs769331935 3599 dbSNP
rs368676585 3600 dbSNP
rs1221237811 3604 dbSNP
rs780578072 3610 dbSNP
rs747624023 3611 dbSNP
rs200373468 3612 dbSNP
rs375079403 3615 dbSNP
rs147994588 3616 dbSNP
rs770751882 3617 dbSNP
rs920293365 3618 dbSNP
rs575398896 3619 dbSNP
rs771989759 3624 dbSNP
rs141738611 3625 dbSNP
rs1308012069 3626 dbSNP
rs1203686820 3628 dbSNP
rs760797878 3629 dbSNP
rs779668154 3632 dbSNP
rs1193683323 3633 dbSNP
rs764437921 3634 dbSNP
rs1257892573 3646 dbSNP
rs1214691035 3647 dbSNP
rs150131074 3650 dbSNP
rs199825696 3651 dbSNP
rs138949255 3652 dbSNP
rs142877948 3653 dbSNP
rs115526941 3654 dbSNP
rs370084378 3658 dbSNP
rs1430283875 3663 dbSNP
rs1054381488 3664 dbSNP
rs1353241871 3667 dbSNP
rs1463115677 3668 dbSNP
rs565184151 3669 dbSNP
rs777231712 3670 dbSNP
rs1438904343 3677 dbSNP
rs9603797 3678 dbSNP
rs756922422 3679 dbSNP
rs778587924 3683 dbSNP
rs1293403349 3686 dbSNP
rs1336854820 3687 dbSNP
rs745610746 3688 dbSNP
rs373503914 3690 dbSNP
rs779996948 3691 dbSNP
rs750998096 3695 dbSNP
rs376186548 3696 dbSNP
rs776850248 3697 dbSNP
rs1470456939 3698 dbSNP
rs762137072 3699 dbSNP
rs1184071987 3700 dbSNP
rs1418071245 3700 dbSNP
rs748094207 3703 dbSNP
rs773476293 3705 dbSNP
rs763324709 3706 dbSNP
rs1460093435 3707 dbSNP
rs1320588948 3709 dbSNP
rs551349536 3711 dbSNP
rs771940361 3713 dbSNP
rs149551054 3714 dbSNP
rs922147957 3716 dbSNP
rs760030229 3719 dbSNP
rs763650247 3722 dbSNP
rs753287846 3723 dbSNP
rs756866181 3724 dbSNP
rs1271607511 3725 dbSNP
rs369581145 3731 dbSNP
rs750208366 3736 dbSNP
rs758266246 3737 dbSNP
rs1215592854 3749 dbSNP
rs1236241870 3750 dbSNP
rs144291315 3751 dbSNP
rs563595559 3752 dbSNP
rs148734980 3758 dbSNP
rs549232118 3761 dbSNP
rs142416018 3765 dbSNP
rs773528072 3766 dbSNP
rs1409065577 3769 dbSNP
rs1400285531 3770 dbSNP
rs749670091 3771 dbSNP
rs774245843 3771 dbSNP
rs763054639 3772 dbSNP
rs1377004281 3773 dbSNP
rs946110042 3782 dbSNP
rs771393038 3788 dbSNP
rs774684045 3790 dbSNP
rs763484178 3796 dbSNP
rs372751198 3801 dbSNP
rs767946884 3802 dbSNP
rs759559990 3803 dbSNP
rs546677833 3804 dbSNP
rs571116585 3806 dbSNP
rs1350565928 3807 dbSNP
rs1175554548 3811 dbSNP
rs750134334 3813 dbSNP
rs1448141832 3820 dbSNP
rs1001911227 3821 dbSNP
rs1445458344 3828 dbSNP
rs1352359615 3832 dbSNP
rs1236110244 3834 dbSNP
rs1280384661 3834 dbSNP
rs1034370496 3835 dbSNP
rs1218091774 3836 dbSNP
rs1274101453 3839 dbSNP
rs538643668 3840 dbSNP
rs991620448 3840 dbSNP
rs1013534858 3854 dbSNP
rs1174314208 3856 dbSNP
rs1025222817 3857 dbSNP
rs36048052 3860 dbSNP
rs983251753 3862 dbSNP
rs1015933920 3868 dbSNP
rs539286633 3875 dbSNP
rs536435173 3876 dbSNP
rs1402053166 3888 dbSNP
rs112060496 3890 dbSNP
rs1393090882 3901 dbSNP
rs1257678908 3907 dbSNP
rs921640535 3908 dbSNP
rs1437996498 3911 dbSNP
rs554784956 3915 dbSNP
rs754694722 3920 dbSNP
rs1277495046 3928 dbSNP
rs987779613 3929 dbSNP
rs1051576293 3933 dbSNP
rs891218297 3936 dbSNP
rs1238103169 3937 dbSNP
rs541773523 3938 dbSNP
rs1277528222 3944 dbSNP
rs1348875758 3946 dbSNP
rs1004740431 3950 dbSNP
rs1357440011 3957 dbSNP
rs1333776692 3958 dbSNP
rs1410702331 3959 dbSNP
rs913487414 3963 dbSNP
rs946162159 3964 dbSNP
rs1166507476 3966 dbSNP
rs372289386 3967 dbSNP
rs867152662 3968 dbSNP
rs1211830986 3969 dbSNP
rs540323433 3970 dbSNP
rs866124048 3975 dbSNP
rs562051412 3978 dbSNP
rs76277554 3981 dbSNP
rs1231508880 3987 dbSNP
rs1335159609 3991 dbSNP
rs143722716 3992 dbSNP
rs1046261408 3999 dbSNP
rs1158791661 4001 dbSNP
rs886366982 4002 dbSNP
rs1416638169 4008 dbSNP
rs1443283580 4016 dbSNP
rs1004644901 4019 dbSNP
rs1278769 4020 dbSNP
rs1012588757 4035 dbSNP
rs1395612983 4038 dbSNP
rs1167777678 4041 dbSNP
rs1395182454 4043 dbSNP
rs530866913 4046 dbSNP
rs963440677 4054 dbSNP
rs757673486 4055 dbSNP
rs542839325 4056 dbSNP
rs995973314 4060 dbSNP
rs1337310695 4062 dbSNP
rs971166542 4066 dbSNP
rs561018253 4067 dbSNP
rs1274768710 4092 dbSNP
rs750981134 4099 dbSNP
rs1442579314 4100 dbSNP
rs528298550 4101 dbSNP
rs1289333715 4104 dbSNP
rs9603977 4105 dbSNP
rs573728153 4106 dbSNP
rs1397844382 4112 dbSNP
rs193110109 4115 dbSNP
rs967638951 4116 dbSNP
rs978904080 4120 dbSNP
rs375168612 4127 dbSNP
rs755616997 4131 dbSNP
rs1160385299 4132 dbSNP
rs937416738 4142 dbSNP
rs779777692 4153 dbSNP
rs1401948810 4154 dbSNP
rs1195718486 4162 dbSNP
rs571342880 4163 dbSNP
rs531992133 4164 dbSNP
rs748933806 4167 dbSNP
rs140940784 4179 dbSNP
rs950048166 4180 dbSNP
rs1051095971 4181 dbSNP
rs1217803841 4182 dbSNP
rs372998212 4190 dbSNP
rs912594652 4191 dbSNP
rs1474005674 4192 dbSNP
rs1047064571 4195 dbSNP
rs886335592 4197 dbSNP
rs1348852961 4198 dbSNP
rs536598110 4207 dbSNP
rs1189510005 4209 dbSNP
rs754634582 4210 dbSNP
rs1037551986 4211 dbSNP
rs866281843 4218 dbSNP
rs1358115562 4219 dbSNP
rs1297012959 4221 dbSNP
rs995694646 4228 dbSNP
rs1396515837 4232 dbSNP
rs554848411 4234 dbSNP
rs996414111 4236 dbSNP
rs566687323 4237 dbSNP
rs534423715 4241 dbSNP
rs954626161 4242 dbSNP
rs79824403 4245 dbSNP
rs1410343885 4246 dbSNP
rs1019983115 4248 dbSNP
rs967607674 4249 dbSNP
rs1355107222 4253 dbSNP
rs1312004605 4257 dbSNP
rs1296696262 4258 dbSNP
rs577299334 4259 dbSNP
rs1298057758 4261 dbSNP
rs1339067038 4261 dbSNP
rs1033178490 4264 dbSNP
rs958864211 4280 dbSNP
rs957161948 4281 dbSNP
rs747853629 4286 dbSNP
rs544270951 4287 dbSNP
rs989949025 4291 dbSNP
rs1354945862 4292 dbSNP
rs556640472 4296 dbSNP
rs184314123 4297 dbSNP
rs953985791 4303 dbSNP
rs950197581 4304 dbSNP
rs1206367100 4307 dbSNP
rs1280041183 4311 dbSNP
rs1475588791 4314 dbSNP
rs1258298944 4318 dbSNP
rs982729158 4329 dbSNP
rs771920065 4330 dbSNP
rs1484520725 4331 dbSNP
rs61740315 4336 dbSNP
rs377746481 4337 dbSNP
rs940029597 4338 dbSNP
rs572922997 4339 dbSNP
rs1356859836 4342 dbSNP
rs899085504 4345 dbSNP
rs1395152463 4346 dbSNP
rs931804594 4348 dbSNP
rs540450869 4349 dbSNP
rs890191869 4353 dbSNP
rs564815221 4354 dbSNP
rs949647264 4365 dbSNP
rs1172833760 4372 dbSNP
rs1198974855 4373 dbSNP
rs143192298 4377 dbSNP
rs1185487967 4386 dbSNP
rs1423523220 4389 dbSNP
rs1373377454 4390 dbSNP
rs1019951907 4391 dbSNP
rs902892536 4392 dbSNP
rs1433165936 4393 dbSNP
rs191593433 4394 dbSNP
rs1403120906 4395 dbSNP
rs1381755675 4402 dbSNP
rs562100483 4406 dbSNP
rs1328759472 4408 dbSNP
rs959228899 4412 dbSNP
rs998929788 4413 dbSNP
rs1444067098 4414 dbSNP
rs1375925610 4427 dbSNP
rs1031348098 4431 dbSNP
rs892878199 4443 dbSNP
rs1388477758 4444 dbSNP
rs529653054 4446 dbSNP
rs1038135301 4447 dbSNP
rs1364418249 4447 dbSNP
rs548443385 4451 dbSNP
rs1024918160 4453 dbSNP
rs567178466 4454 dbSNP
rs1453617808 4455 dbSNP
rs534113645 4458 dbSNP
rs982863619 4459 dbSNP
rs77960648 4460 dbSNP
rs941330820 4463 dbSNP
rs1287498106 4473 dbSNP
rs986706718 4475 dbSNP
rs974056635 4476 dbSNP
rs1235143155 4478 dbSNP
rs1202893861 4483 dbSNP
rs920497667 4483 dbSNP
rs1329092507 4484 dbSNP
rs1263189913 4492 dbSNP
rs1019969341 4494 dbSNP
rs1192928915 4495 dbSNP
rs1393122561 4498 dbSNP
rs931913229 4500 dbSNP
rs528013431 4501 dbSNP
rs1050254579 4507 dbSNP
rs769852948 4508 dbSNP
rs1378470524 4512 dbSNP
rs1376242754 4515 dbSNP
rs1198826471 4537 dbSNP
rs570853699 4549 dbSNP
rs1448055903 4551 dbSNP
rs184113908 4552 dbSNP
rs931365877 4553 dbSNP
rs573984690 4555 dbSNP
rs1280632287 4560 dbSNP
rs944438683 4561 dbSNP
rs1342666569 4562 dbSNP
rs1274009478 4563 dbSNP
rs1228138908 4565 dbSNP
rs574850897 4568 dbSNP
rs1342288524 4571 dbSNP
rs1276153964 4575 dbSNP
rs1398246708 4576 dbSNP
rs188901208 4578 dbSNP
rs182180010 4579 dbSNP
rs764183916 4581 dbSNP
rs116635697 4582 dbSNP
rs1443603607 4587 dbSNP
rs1192053113 4588 dbSNP
rs1302373358 4596 dbSNP
rs999834649 4599 dbSNP
rs1033110858 4600 dbSNP
rs894709899 4601 dbSNP
rs1013615569 4607 dbSNP
rs1440326955 4608 dbSNP
rs1236413825 4609 dbSNP
rs185179877 4612 dbSNP
rs1262043399 4613 dbSNP
rs1024469702 4614 dbSNP
rs971498225 4623 dbSNP
rs1319667582 4628 dbSNP
rs565135857 4628 dbSNP
rs1256106269 4629 dbSNP
rs1004346394 4634 dbSNP
rs1217893069 4642 dbSNP
rs1015601610 4645 dbSNP
rs962786319 4652 dbSNP
rs1450528782 4653 dbSNP
rs1420521434 4656 dbSNP
rs879835023 4658 dbSNP
rs7985702 4660 dbSNP
rs1052716224 4661 dbSNP
rs543865894 4664 dbSNP
rs986490113 4665 dbSNP
rs911818396 4666 dbSNP
rs1191610677 4670 dbSNP
rs1182024196 4672 dbSNP
rs1458948545 4674 dbSNP
rs1249545445 4676 dbSNP
rs562263238 4679 dbSNP
rs529617318 4680 dbSNP
rs924335208 4683 dbSNP
rs578211350 4684 dbSNP
rs547814512 4685 dbSNP
rs1388849669 4686 dbSNP
rs560611512 4688 dbSNP
rs1008483181 4689 dbSNP
rs1459876114 4691 dbSNP
rs78518626 4692 dbSNP
rs1013165958 4693 dbSNP
rs1446786913 4699 dbSNP
rs1389962724 4700 dbSNP
rs1403121622 4701 dbSNP
rs1412395574 4701 dbSNP
rs972686322 4702 dbSNP
rs1308713302 4703 dbSNP
rs3742232 4704 dbSNP
rs1236199854 4707 dbSNP
rs907477793 4708 dbSNP
rs952701850 4709 dbSNP
rs1232193894 4710 dbSNP
rs1270706891 4713 dbSNP
rs1336931790 4716 dbSNP
rs1289215701 4717 dbSNP
rs190464046 4717 dbSNP
rs113101169 4720 dbSNP
rs1241228855 4721 dbSNP
rs111420916 4722 dbSNP
rs1239895512 4722 dbSNP
rs1479545783 4723 dbSNP
rs962753857 4725 dbSNP
rs1434900955 4727 dbSNP
rs1178679051 4728 dbSNP
rs1348841237 4728 dbSNP
rs527959486 4729 dbSNP
rs1473021485 4730 dbSNP
rs182175488 4732 dbSNP
rs1157610516 4736 dbSNP
rs1415750771 4739 dbSNP
rs954146282 4740 dbSNP
rs986830180 4742 dbSNP
rs1189455521 4743 dbSNP
rs1246273290 4746 dbSNP
rs1217447921 4750 dbSNP
rs1166113444 4751 dbSNP
rs1216115374 4755 dbSNP
rs1354403563 4758 dbSNP
rs970885500 4759 dbSNP
rs982679562 4767 dbSNP
rs924170485 4768 dbSNP
rs1367510601 4770 dbSNP
rs568596498 4771 dbSNP
rs535835939 4772 dbSNP
rs1290980144 4775 dbSNP
rs1466214330 4779 dbSNP
rs1173693352 4780 dbSNP
rs1380720701 4780 dbSNP
rs185192951 4784 dbSNP
rs189949017 4786 dbSNP
rs181255400 4787 dbSNP
rs1195694080 4789 dbSNP
rs977235815 4792 dbSNP
rs1261084819 4793 dbSNP
rs1186195266 4794 dbSNP
rs1483692776 4794 dbSNP
rs879344699 4796 dbSNP
rs1208467155 4803 dbSNP
rs1311912872 4805 dbSNP
rs1206407301 4808 dbSNP
rs924468999 4809 dbSNP
rs1277007108 4815 dbSNP
rs1053994836 4816 dbSNP
rs935757548 4817 dbSNP
rs1483536710 4820 dbSNP
rs1380901093 4822 dbSNP
rs1210430523 4823 dbSNP
rs1465378991 4823 dbSNP
rs1255587322 4824 dbSNP
rs1054652924 4825 dbSNP
rs10566715 4826 dbSNP
rs398056901 4826 dbSNP
rs761600084 4826 dbSNP
rs765080376 4826 dbSNP
rs1421646690 4828 dbSNP
rs1169818431 4829 dbSNP
rs199702502 4829 dbSNP
rs1424402554 4830 dbSNP
rs1258548374 4831 dbSNP
rs915670892 4832 dbSNP
rs1461168553 4839 dbSNP
rs3742233 4841 dbSNP
rs1316593473 4842 dbSNP
rs1419475920 4843 dbSNP
rs1278770 4845 dbSNP
rs1244904833 4846 dbSNP
rs1049453309 4848 dbSNP
rs1391166728 4849 dbSNP
rs889544333