miRTarBase - #MIRT023229 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PYGO1   
Synonyms -
Description pygopus family PHD finger 1
Transcript NM_015617   
Expression
Putative miRNA Targets on PYGO1
3'UTR of PYGO1
(miRNA target sites are highlighted)
>PYGO1|NM_015617|3'UTR
   1 TCAAAGGCATTAACTAAAGTGGGTTTATTTTCCTGTGCATTGCAGAAGTTCATTGACACAGGATTTTAATGTTTTACATT
  81 ATTTTTTTAAATGCATACACAAAAACATTATTTACTTAGTTTTTATTAATCACTTCATCACTAGAGCAAATTTTTTATTG
 161 TCTTTGCTTGCTGTCTTAAATGAGAATAATGTATATGGGGGTGCTTTAGAAACATAAATAAATGTTAGTTGTTGTTATTT
 241 ATCACAAACATAAAAGCCTCTTGAAACTTCAAAATAATATATAACAAATGTAGGCAAGTTTTAACTTTTAAAAGTTAGAA
 321 TCATTGAAAAACGTGTATTTCAGTGCTGAACTTTGGTTGTACCATATTAAAGATTTAGTTCAAAAAGTTTATCAAGGATC
 401 CACTTAACACGTCTTCACAACATAATATATGTAACTGTAACATGGGGGAAAGCATACATTTTTATGGATTAAAAAAATAA
 481 TAGTATGACACCAGATTCCTCCTCCACTAGGGTCTTTGGAATCAATGAATTTCATATTTCAAGTGAGTTTTCAGGATATC
 561 TGTTTGTACAGATACGAGACAGATCTTAGCATATAGTAAATTCTCAGTAAGTATTGTTGATTAACTTGTGGATGGTACCA
 641 CATGAAATTGCTAATATTAGATCAGTTGAAAATTGACTGCAATTAGTAAAGTTGGTATAACGTACGTTCCCAGTTGTGCT
 721 ATTTAGAATTATGATAGTATTATGCTCCTACTTTTCTTTGATATTGAGTTGTCTTGTTATTGTTTATTGTTTTCCAGAGA
 801 AATACTATAGTATCCACAGAAGAATTGTGAATACTTTTTTATAATTTTGAACTGGGACATATTGCAGATGAGGAAGGTAG
 881 AAACATCCATTTGGCCTTAGAGGGCTCTGCTAGTAAAAGAACTACTCAGTGGTGGTTTGAAAAATCTTGTTCTGGGGATC
 961 TGAATTTCAAAAATGAACCCTAGGGGAGATCAAAATCCATTTTAAACAAAGATCAATTAAGAGCCAAAGTGAAATCTAAC
1041 TTGCAAACAACAATTTGAAGCCTTGCAGCAGACTTAAGGAATTCCCGCTCTGACTGGGGAAAAGTATAAAAATGGACCTG
1121 AGAGTACCCTCTTGAGGGATGATCAAGAATGGAGACAGTTGGAGTTGTGCTCATTAAGATTCAAAACAGCAGAAATCCAT
1201 TTTTGGAGCAGATTATAACCTGTGGCCAAAAAAAAAAAATGTGTGCTGTTTGACAGCTAATGGCAATTTATACAATCATT
1281 GGAGGCTGGTAAAGCTCCCTAATATGTTGCCACCATTATCATTGCAACCAAAAAAATTCTGAAGATTGTGTGGTGATCTA
1361 CGAAAGAGATAAATAATTACTGTTATTTAAACCCAAGTGAAACAATGACGGCAGCAGCATATTATCAAGAAATTTAAATT
1441 ATGCATGAAAATGTGATTTAAAAACAATGTCCTTTGGGTAACACACAAGAACCTACACTTTCACAGACAAGGACTCGACC
1521 TCACATGTCACAAGCTACTAAAGCAAAGTTAAGTGACTTGGGCTATGAAATTTTGTCATGTCCATTTTAGTCACTGGACC
1601 TTTATTCCATGGACTACTGTCTATCATTTGGAGCTTTTTCTAAGAAACAATGCATTCCCCAATCGAGATGAAGTAACTGG
1681 AAGATGTTAACAATTTATACAGCCTAACAAATGATGAATTTTATAAAAGTTAGACCTTTAATATTCTGTTGGAAGAAAAC
1761 TATTCATGCTCCTGATGCATATTTTGATTGAATAAAACTTATTTTTTTAAATACATTGTTTTAATTTTGACCTACAAAAA
1841 CAGCAATTTCATATGGTACAAGGTAATACAAGGTTTTCTCCATTTACCCTTGACTAGTTAGAGGTGAGTACAAAATATTT
1921 TCAGTAGTTGTAAAATATTTATCTTTACAATTTTAGGAAACAAAATGATATAAACTATACTTCTAGGTACTCCTTTGTGT
2001 GAAAACTTTACCAGTTGAAGCAGGTTAAAATGCAGTATTTTGGGCTGACAGGCATTTGATGGTGTTCAGTAGTGTACTTG
2081 AAGATCTCATTTTACTTGGATTTTTTATTATACATATTTCTCTAAATGTTTAAGGACCTAGTTATGTTGCTCCTGAAAGT
2161 TTAATGAGTGCTGATTTTTAATAAATGATGCACTGTATGCTGTATGCCTAGTTGTAGCATCAGATCATGATTTATTATTA
2241 CCCTGAATAGAGCTAGATGATAGATATTTTGAGTAGAACTTTCCAGTGTTCTCAGGAGTTAACACTTTACATGGTAGTAC
2321 TTGAGTTGTGATCATTACTAAAATCAATTATGCAGTTTCTTAAACCCTTTATCTCTTTAAGTTTCAGTAGTTAGCTGTTT
2401 TTGTGAAAATGAAATAACTTCTCCCAAGCTAGTCTAAAGGTATGTGTTATGCAATATAATTCATTTTCTATTTCCACATA
2481 GTTGTTTTTAAAAACCTACAAACAGGTGAATTTTTATTCAGGTGTTTAGGTCTTCAAAGCACCTTACTTAAATAAGAATC
2561 TGTAAATATTCAAAAGAAAAACTCACGGTTCATTCTGATAGTGAATCATAGCCAAACTGTAATCATAGCTGATGAATAGC
2641 GTTCATGTGTTTGAATTAATTTTCCTGCTAGTTCTACATTTGTCTCTACATAATGCTAAGTCAAAAGTTATATAGATGCT
2721 TTTGGATGGAATAAGTGATGAACTGTAAGAATAGCCAGATGATAATTTGTCTGAAGAAGGCTATTATACAAACTGAAATG
2801 GCTTCTTAGGATAAATGATAAGCTGCCTTCAACTTTAAAAATATGCAGTGATGGAAAAAAACACAGGTGGAATTGTACCT
2881 TTTTTGGTATAATCCCTTTCCTTCACTGAAAGTCCTCATCTTACACACACACACACACACACACACCCCCCACAGTTTCT
2961 CCAACATCCTTGAGTTTTGCTTAAATTCAACCTGGCTAACTATGAGCATCTAGGTTTACTCACCAAAGCTAGGTTATTGA
3041 CAGAAAGGTGGGTTTTTTTTTGTTTTTTTTGTTTTGTTTTGTTTTGTTTTTGTTTTTTGCCAGTCTTGCTCTGTTGCCCA
3121 GGCTGGAGTGCAGTGATGAGATCTCGGCTCACTGCAACGTCTGCCTTCCTGGTTCAAGTGATTCTCCTGCCTCAGCCTCC
3201 TGAGTAGCTGGGATTACAGTCGCCCACCATCACACCTGGCTAATTTTTGTATTTTTAGTAGAGACGGGTTCACCATGTTG
3281 GCCAGGCTGGTGTCAAACTCCTGACCTCAAGTGATCTGCCCGCCTCAGCCTCCCAAAGTGCTGGGATTACAGGTGTAAGC
3361 CACCACGCCTGGCCAGACAGAAAATTTTAAAAAGCATCAGTTCCTTTCTCAGAACTTGACTTGCTCATGCACTAGAGAAT
3441 TTGTGGTCCACATGCTTCTAGGTGTTACTCGATTCACTAATACTGAAACAGCTCAGCTTGTGAAAGATAAATTGTTCTTC
3521 AGACAGAGTGCTTAGAATTAGATTTGTGATCAGTGTTTTCCTTTTGTGTGAAATACTTTAGAGTACTGCTATAATTGTTA
3601 TTCAAATTAGAAGGTTATATACATAAAACTAAAGATTTTCTTGTACTAGTGCTTATTCTTCATAAACACAGTGTAAAGAA
3681 ATCTACTTTTTTGGTGGTTTGTTTTAGACTCCCAACTCTGCCTAGTGGCAGAAAAACCTCTTAATAGTGTGGGTCATCAT
3761 AAAATCTGCCAACTTTAATCCAAATAAGTATCAAGAGTCTTCATTCAATATTCTTTCAAACTTGTTTGTCTCGAACAAAT
3841 TAGAGTTTTAGCACTTATTGTTCAATGTACTATAGTAATTGTATTTAATAGTAAGAAAATATATAAGCAATGATTTTTTA
3921 AAAGGGAGTTCTCAAGAGTTTTGGATTTCTTTCTGCCGTGTATAGAGGTTTCTTATGCATGGACATTTGTGCTGTTTTAT
4001 ATCTTTTTCAATTAAAAAAAAATTTAAAGGCATCAGGCTCCCTAAGTTCATTTGTAAATAGTGGCTTGGAACTCTACACA
4081 ATAGGGAAGCTCCTAAAGGCTCATTTAGACCATAATCTAGTTAATAGTATCATGCTGAACTCTCAGTTTTCTTTAGGAAA
4161 CCAATCAATCAGTGTAGGAGGGAGAAAGAAGCAGAGGTCTTGTCTTTTTCCTGATGTGATTAGGAGGTTAAGTTCTTTGG
4241 TGTGGGTTTCTTTGCATTTGCCCCCTTACCATGCTAAACTCTGGTGAAATGTATAAGCAGCCTTGGCTTTTCCTCTCCTG
4321 GGTGCTCTGTGCTTCAACATTTTATATCTTTCCTCCCATCAGAAATCCTGTGTCTTTGTGTGGCAGTAGTAGTTGGCTAG
4401 ACTTTAAGAGAAAAGCATTTTCTACTAAGGTATGAATGAAGATAGTGGGAAAAGTGTCATTAAATTTCTTTTTTAAAAAA
4481 GTATGTTTATTAAGAATGAATCTTTAATATCTAACATTTCAGACAATATGACCGCATTTCAGATACCATGGGAAGCAGTA
4561 CATTTAGTGAATTAGCTGGTACTGTCTGAGGGTACTTCCAGTTTCCTTTAGGCTGTTGTGACTTTTCACAGCTTCCTCTC
4641 CTCTAATTCTGAACTTAGAGATTTTCTTCTCATTTCTAATTTTTAGTAGCTTATTGTTCCATCCAGTAGAGCATTATAAA
4721 AGTCACATCTGCATCTTCCAACTTATGGTACAGTGATGGGAATTTGGAAGCACCCCTGGAGCAAAGAGGCTAGGGATAGC
4801 ATTAACATCTCCCAAGACAAGTGGTATAGGGGAAATGAAGGAAAGACTGTGGCCATGTATATGCCAGGCGTTAATACATC
4881 AGAGCTGCCTGTATTTAATTTAAAACTTTTGATGAAACTCAGTGGATAAGCATCTTTGTCATATTTTGTCAATAATACAT
4961 TACTTGCAATTATATTAAAACTTATTCTAAATACCTGTACCTTTCTTGTTCTGTAGATGTGTAGATGATGTTGCTTGTTT
5041 GTCAAAATATTATCTTTTATAAAAGAAAGTCCTGCTTCTTATCATGATGTATGTGACTTAAATGATTGTTTCATATTAAA
5121 ACTATTTCTTCCTTATGTACTGTTTACATATACCTCTTTTTGGGATATTAGTTCAGTACTTTTATACAAATCTGAGTGTG
5201 TTCCACATTGGTGACATGTATTTTTGCAGTAACTTTTTGTTTTGTTCTTAGAACATGTCTAAAGTAACACATGCACTAGT
5281 GCTGTGGTCTGTGGCAAAATTACTGTAATTCAAATTGGAAAAAAAAATGTTTCCAGACTTTGTCCAACATTTATTCCTAT
5361 GGCAAAGGAAATTACTATGTAATACTAATTATTTCTTATGCTGGTATGTTTTAAGCTACTCTATGAAGTATGTGAAACAT
5441 CAATATTTATGGATTAATAGATGGCCTGATGTCTTTCAAATGGGAGAGGAGTAAATTTTAGTGTTACCAACTCATGACAC
5521 TTGTAATACAATAAATCTTAAAATTTTTATTTTCCACTTACAGGTATACTTTACTAAATAATTACCTTAAATGGCAGTGC
5601 ATATTAGGATTTTTTAGCACATACTACTAAAATTATATAGTAACTTTTAACTTGTGCTGATATTTCCCAACCAAAAAAGA
5681 CATCATTCACTTCATCATAACCAAAATAAGTAGTACTGTAATATTTATCTTCATTTATTTAGACATGATTAAGATACCGT
5761 AAGACTCCTCTAATTTACCTGGAATTTTTAGCCATTGATTCAAGGACTTGAATGCTGTTTACTTGGTACTACCTAATGAA
5841 AGGATTTGGTAATAAAGGTTATAATCACGATTTTAAAGAAAAATGTTTCATCTTGAAGGCAAATTTTTAAGCTTTTTATT
5921 TAGAGGTGTTTACTTAAGAATAGTAATTTAAAAGCATTCTTATTTTGTCATTAAGACAAGTACCCAAAAGAATTGTAATA
6001 AGTAATACTTGGCCAATGCAAATTTGTACATTTGAAATCATACACTTGAAAGAAAAAAATGAAGGCTTGTGAGTGCTTAA
6081 ACTGCATATCTTTTTAAAAATTCAAATTTTAGACATATCAGTTTAAATTATCCTTAATAAGGTTTTACTATGTCAGTGAT
6161 GTATATTACAAAATGTCTACCTATGTTATGTTAATGATATCTCTATACTGCATCATATTCGGCATGGTTATGGTATATTT
6241 TGTACTTTTGATTGTGGACTATTGATAGGATTGATATAGCAATAAATCTGATTCAGACTTAATATTTTTTAAAACGCTAG
6321 ATACCATACTGTATCATAATCCTATTATATTTGACTTGAATGCCCAAAATTTTCATAGTTCTATATTTTATGTTAAAAAT
6401 TTAGTATTACATGTTAGGGATTTATTTTTGTCTGCTATTTTCACATACATTCTTTTAGAACTGAGTCTGTTTCTATTTAG
6481 ATCATAGACGTCTAAAGAAGTATTATTAATTCATGAACTGCTTTGTGGAAAAATTTAAATAAAGTATGAAATGACTAGAT
6561 TACCCCAAATTGTTTATTTTTTTTTTTGGTTAATGACCAGGTTACAATTCTCAGACAAATGAAATTGGCTTGATAACTGA
6641 TTGAATATAGTAGATAATGGAAAGTTTGACTCTTTAAGGGCTTCCAAGTGTTAAATACATTCTCAATTCTGAATTACTTC
6721 ATAGTAACTACTTAAATAATGGTAAGCCAATTCTCCTTTTTCTTTTTGAGATATTTAACACAATTTGCGTCTTCTGATCC
6801 CATTCCCTTCTTCCCCAAAAACCATGCTAGAATTTAAAATTGGAAGAGTTTAATTTGTCATCTACATTTTAGTTTTTTTA
6881 TTCTATAGATAAGTAAGAAGACAAGTAGACGTTCTGCTGTCAAGACAGTCCATGTTATTGTTGGCCATTCTTTTCAGGGA
6961 TAATGCTTAATGTTATTTGTGCGTTGTATAAGGAATGTTGTTTATCAGTATATAGACCTACCATTAGTAGAAATGATGTA
7041 TGGCAGGCTTTCTTGAATAATATGTATTGTAAGTTTGTTTCCTATAGTGTTATTATGGTTCAGATTCTTTTAAATAAAGC
7121 TAGTTTTTAAAGAGAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            || ||:||  |||::|||| 
Target 5' agAAAACTAT--TCATGCTCCt 3'
1754 - 1773 136.00 -11.30
2
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             | :|:: ||||| ||||| 
Target 5' gccAGGCTGGTGTCAAACTCCt 3'
3281 - 3302 135.00 -15.90
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            :|:|||   || | ||||| 
Target 5' aaGATACC---GTAAGACTCCt 3'
5751 - 5769 125.00 -15.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31512078 2 COSMIC
COSN30373970 14 COSMIC
COSN28871996 82 COSMIC
COSN29423085 120 COSMIC
COSN1680092 163 COSMIC
COSN9090721 304 COSMIC
COSN15109066 418 COSMIC
COSN23507758 484 COSMIC
COSN28288152 702 COSMIC
COSN16407051 738 COSMIC
COSN23826849 928 COSMIC
COSN22228096 977 COSMIC
COSN8747469 1192 COSMIC
COSN1178080 1228 COSMIC
COSN27141657 1337 COSMIC
COSN21333591 1433 COSMIC
COSN20923347 1592 COSMIC
COSN24190598 1713 COSMIC
COSN15809975 1822 COSMIC
COSN6276289 2120 COSMIC
COSN16726419 2122 COSMIC
COSN5398967 2328 COSMIC
COSN18992620 2723 COSMIC
COSN9626634 2842 COSMIC
COSN26290675 2855 COSMIC
COSN27547114 2947 COSMIC
COSN32063445 2947 COSMIC
COSN18723445 2949 COSMIC
COSN28426787 3053 COSMIC
COSN7049005 3062 COSMIC
COSN7049004 3063 COSMIC
COSN16118539 3461 COSMIC
COSN19294454 3486 COSMIC
COSN32011454 3530 COSMIC
COSN4621689 3824 COSMIC
COSN7049003 3979 COSMIC
COSN20570277 4157 COSMIC
COSN29249950 4215 COSMIC
COSN31779068 4298 COSMIC
COSN8747468 4300 COSMIC
COSN16172365 4712 COSMIC
COSN25050674 5307 COSMIC
COSN17570335 5656 COSMIC
COSN6276288 5690 COSMIC
COSN1680091 5800 COSMIC
COSN8174923 5868 COSMIC
COSN1680090 6246 COSMIC
COSN16806061 6339 COSMIC
COSN27371053 6577 COSMIC
COSN1680089 6669 COSMIC
COSN22589825 6796 COSMIC
COSN28201514 6983 COSMIC
COSN5755422 7064 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1216654735 1 dbSNP
rs1381100666 2 dbSNP
rs374122709 6 dbSNP
rs751652504 7 dbSNP
rs575603775 8 dbSNP
rs763141627 13 dbSNP
rs145824639 16 dbSNP
rs1205201129 22 dbSNP
rs763836433 23 dbSNP
rs760666619 30 dbSNP
rs775236906 35 dbSNP
rs772034901 36 dbSNP
rs759039758 39 dbSNP
rs112188395 42 dbSNP
rs774209139 56 dbSNP
rs986057992 61 dbSNP
rs34391719 68 dbSNP
rs1476711980 75 dbSNP
rs1171434017 77 dbSNP
rs542333151 78 dbSNP
rs1468382110 82 dbSNP
rs1338977415 88 dbSNP
rs200694029 89 dbSNP
rs60949037 89 dbSNP
rs763291712 89 dbSNP
rs1264022659 94 dbSNP
rs1031516596 95 dbSNP
rs1328100044 100 dbSNP
rs1400593876 106 dbSNP
rs1173145882 107 dbSNP
rs999989076 113 dbSNP
rs1282037315 118 dbSNP
rs1320843412 122 dbSNP
rs925650627 125 dbSNP
rs1263388144 132 dbSNP
rs904341772 133 dbSNP
rs1355083332 136 dbSNP
rs977192960 147 dbSNP
rs1260131718 165 dbSNP
rs745966195 173 dbSNP
rs1195058637 175 dbSNP
rs1049814141 182 dbSNP
rs1444667722 184 dbSNP
rs573325047 197 dbSNP
rs1479497829 201 dbSNP
rs35596002 216 dbSNP
rs374849883 216 dbSNP
rs75288108 216 dbSNP
rs1491305301 217 dbSNP
rs199725290 217 dbSNP
rs370305544 217 dbSNP
rs1324530447 222 dbSNP
rs141530042 223 dbSNP
rs992933167 224 dbSNP
rs545524875 237 dbSNP
rs1302478581 243 dbSNP
rs553186651 249 dbSNP
rs1406232792 250 dbSNP
rs901234462 263 dbSNP
rs1041090638 273 dbSNP
rs1334773313 277 dbSNP
rs1236488454 280 dbSNP
rs940006791 281 dbSNP
rs1401339095 291 dbSNP
rs539720395 298 dbSNP
rs1353323378 318 dbSNP
rs984330674 320 dbSNP
rs570854361 322 dbSNP
rs931485194 327 dbSNP
rs1550327 333 dbSNP
rs981332764 337 dbSNP
rs1490018528 340 dbSNP
rs969874158 341 dbSNP
rs1026099226 351 dbSNP
rs536599231 359 dbSNP
rs137899798 360 dbSNP
rs1420095946 362 dbSNP
rs994188588 364 dbSNP
rs762600455 375 dbSNP
rs901213331 380 dbSNP
rs1209640709 381 dbSNP
rs1363633124 384 dbSNP
rs1488786536 386 dbSNP
rs1293579848 390 dbSNP
rs1395172366 391 dbSNP
rs1550328 403 dbSNP
rs1308697225 410 dbSNP
rs150283748 411 dbSNP
rs1353146992 414 dbSNP
rs1314844883 417 dbSNP
rs1031568719 442 dbSNP
rs1224463627 443 dbSNP
rs1000039991 445 dbSNP
rs1266070862 448 dbSNP
rs968592985 451 dbSNP
rs374792738 452 dbSNP
rs577043315 452 dbSNP
rs534368992 453 dbSNP
rs997080700 458 dbSNP
rs1252914206 473 dbSNP
rs1182716751 478 dbSNP
rs935952193 478 dbSNP
rs901291059 493 dbSNP
rs1446316430 495 dbSNP
rs1041491127 501 dbSNP
rs552447346 502 dbSNP
rs887081357 508 dbSNP
rs532438649 509 dbSNP
rs745814552 520 dbSNP
rs931578699 521 dbSNP
rs926861903 534 dbSNP
rs992566841 541 dbSNP
rs1045272295 547 dbSNP
rs565345930 554 dbSNP
rs1230461334 556 dbSNP
rs1314084966 557 dbSNP
rs776575797 559 dbSNP
rs1359388343 562 dbSNP
rs917009312 568 dbSNP
rs992965207 569 dbSNP
rs927503762 571 dbSNP
rs186717346 575 dbSNP
rs181233005 576 dbSNP
rs530786382 582 dbSNP
rs1343946337 598 dbSNP
rs569389546 602 dbSNP
rs994549081 606 dbSNP
rs1171880377 613 dbSNP
rs1423751311 616 dbSNP
rs28523602 628 dbSNP
rs1404293115 630 dbSNP
rs1450617811 631 dbSNP
rs541944520 635 dbSNP
rs573027531 638 dbSNP
rs746803046 639 dbSNP
rs1381068651 645 dbSNP
rs1280116781 653 dbSNP
rs1318734133 661 dbSNP
rs1223063254 663 dbSNP
rs1261507250 665 dbSNP
rs1314219509 675 dbSNP
rs996698282 677 dbSNP
rs1190356521 678 dbSNP
rs553145708 680 dbSNP
rs888945878 682 dbSNP
rs546025083 685 dbSNP
rs1274554134 692 dbSNP
rs1414724217 695 dbSNP
rs1004268496 698 dbSNP
rs1177213194 700 dbSNP
rs887174668 701 dbSNP
rs563207086 702 dbSNP
rs995501382 705 dbSNP
rs577029329 706 dbSNP
rs1041649258 712 dbSNP
rs905453859 719 dbSNP
rs190360594 721 dbSNP
rs1314917869 723 dbSNP
rs916937670 731 dbSNP
rs1286636426 740 dbSNP
rs1490185475 742 dbSNP
rs1325807378 764 dbSNP
rs1196612632 782 dbSNP
rs755174672 788 dbSNP
rs1056807790 793 dbSNP
rs1334670474 795 dbSNP
rs1176298096 802 dbSNP
rs918050213 807 dbSNP
rs1415682381 814 dbSNP
rs1438238161 815 dbSNP
rs1399423904 818 dbSNP
rs1175334300 835 dbSNP
rs937125596 837 dbSNP
rs1301342334 861 dbSNP
rs1052602557 862 dbSNP
rs934435223 863 dbSNP
rs924360991 867 dbSNP
rs927053219 878 dbSNP
rs1279207820 879 dbSNP
rs1371529720 885 dbSNP
rs984214650 888 dbSNP
rs1465795965 902 dbSNP
rs978431458 904 dbSNP
rs1220188175 909 dbSNP
rs968320528 913 dbSNP
rs1203309090 926 dbSNP
rs111560353 928 dbSNP
rs79714537 931 dbSNP
rs1441230740 933 dbSNP
rs975711177 934 dbSNP
rs973035665 935 dbSNP
rs1444523449 937 dbSNP
rs965252077 945 dbSNP
rs1161985326 946 dbSNP
rs537770220 949 dbSNP
rs567928840 950 dbSNP
rs1019892634 969 dbSNP
rs1415985114 970 dbSNP
rs749413892 973 dbSNP
rs1019664453 977 dbSNP
rs554583056 978 dbSNP
rs1449344758 980 dbSNP
rs1331733873 986 dbSNP
rs1381806071 988 dbSNP
rs1243592712 992 dbSNP
rs116965769 1011 dbSNP
rs995511354 1014 dbSNP
rs905170422 1016 dbSNP
rs1270319203 1028 dbSNP
rs1023903451 1029 dbSNP
rs1014282805 1032 dbSNP
rs896716348 1044 dbSNP
rs1277977039 1046 dbSNP
rs780030536 1047 dbSNP
rs1185944596 1048 dbSNP
rs935493720 1069 dbSNP
rs1199553521 1086 dbSNP
rs904384989 1087 dbSNP
rs565822101 1090 dbSNP
rs1421606656 1094 dbSNP
rs1256340343 1097 dbSNP
rs756173176 1098 dbSNP
rs141086839 1099 dbSNP
rs1405009648 1104 dbSNP
rs1263927739 1110 dbSNP
rs947071055 1118 dbSNP
rs1336004262 1119 dbSNP
rs567103292 1132 dbSNP
rs11071189 1133 dbSNP
rs1319398119 1134 dbSNP
rs1218802850 1138 dbSNP
rs769790035 1144 dbSNP
rs745799434 1147 dbSNP
rs1262110994 1149 dbSNP
rs1239105293 1151 dbSNP
rs905596621 1153 dbSNP
rs1168015673 1159 dbSNP
rs1677235 1165 dbSNP
rs1443449548 1175 dbSNP
rs912474712 1176 dbSNP
rs1193139577 1179 dbSNP
rs1478850637 1182 dbSNP
rs549776426 1199 dbSNP
rs1194547962 1200 dbSNP
rs982622379 1211 dbSNP
rs1428855354 1219 dbSNP
rs530040237 1220 dbSNP
rs1165560378 1226 dbSNP
rs1472079312 1227 dbSNP
rs951155836 1229 dbSNP
rs1402667867 1231 dbSNP
rs561915402 1235 dbSNP
rs113099590 1240 dbSNP
rs1342357844 1240 dbSNP
rs879050910 1240 dbSNP
rs574313829 1241 dbSNP
rs796302123 1241 dbSNP
rs974125980 1248 dbSNP
rs776620450 1249 dbSNP
rs1550329 1256 dbSNP
rs747222626 1260 dbSNP
rs1346154569 1268 dbSNP
rs370363942 1272 dbSNP
rs1024080781 1277 dbSNP
rs912823393 1278 dbSNP
rs1217387390 1279 dbSNP
rs1013585364 1290 dbSNP
rs896764590 1292 dbSNP
rs1377930788 1293 dbSNP
rs1469428958 1302 dbSNP
rs1156689125 1304 dbSNP
rs184434612 1320 dbSNP
rs11071188 1322 dbSNP
rs1301938465 1323 dbSNP
rs904005329 1324 dbSNP
rs1042799874 1335 dbSNP
rs555395078 1337 dbSNP
rs968955569 1350 dbSNP
rs545893511 1361 dbSNP
rs576996381 1362 dbSNP
rs1314224764 1369 dbSNP
rs16976371 1372 dbSNP
rs1039813681 1376 dbSNP
rs1241530309 1379 dbSNP
rs943686838 1381 dbSNP
rs1487547859 1382 dbSNP
rs562261579 1395 dbSNP
rs543742033 1406 dbSNP
rs912473619 1409 dbSNP
rs1035587624 1410 dbSNP
rs1441003270 1415 dbSNP
rs1001126012 1421 dbSNP
rs1046992647 1424 dbSNP
rs1440194445 1432 dbSNP
rs1162859909 1443 dbSNP
rs1350876214 1445 dbSNP
rs748444448 1452 dbSNP
rs1048599602 1460 dbSNP
rs1395274907 1461 dbSNP
rs931116358 1465 dbSNP
rs1329667264 1467 dbSNP
rs1325986090 1478 dbSNP
rs1241423530 1479 dbSNP
rs897305987 1484 dbSNP
rs1320513118 1485 dbSNP
rs1247045821 1492 dbSNP
rs762725446 1493 dbSNP
rs79859702 1498 dbSNP
rs1239705063 1504 dbSNP
rs1458058627 1516 dbSNP
rs1677234 1517 dbSNP
rs1253989022 1518 dbSNP
rs1425525877 1525 dbSNP
rs868866943 1531 dbSNP
rs1372023458 1534 dbSNP
rs1159706711 1535 dbSNP
rs912790989 1538 dbSNP
rs1360549543 1540 dbSNP
rs1447981110 1543 dbSNP
rs985738746 1561 dbSNP
rs932623777 1565 dbSNP
rs1441692150 1585 dbSNP
rs1339948755 1589 dbSNP
rs973883820 1591 dbSNP
rs969915752 1598 dbSNP
rs1216969986 1603 dbSNP
rs534559031 1609 dbSNP
rs1318947534 1610 dbSNP
rs1209122082 1611 dbSNP
rs1378537158 1613 dbSNP
rs369576159 1619 dbSNP
rs1254074132 1625 dbSNP
rs916662255 1629 dbSNP
rs572073788 1630 dbSNP
rs1484166301 1632 dbSNP
rs992574516 1633 dbSNP
rs960700082 1634 dbSNP
rs764666091 1638 dbSNP
rs966787105 1640 dbSNP
rs1423858293 1645 dbSNP
rs1469014357 1646 dbSNP
rs759021133 1651 dbSNP
rs1291036502 1657 dbSNP
rs1021458380 1659 dbSNP
rs1303950157 1662 dbSNP
rs968255728 1664 dbSNP
rs1355295813 1667 dbSNP
rs1340511763 1668 dbSNP
rs1398222036 1669 dbSNP
rs558660765 1674 dbSNP
rs151099441 1700 dbSNP
rs1218882484 1702 dbSNP
rs1298868289 1703 dbSNP
rs117073629 1713 dbSNP
rs1210656947 1715 dbSNP
rs1285201819 1718 dbSNP
rs573343521 1723 dbSNP
rs1276191591 1728 dbSNP
rs1477468548 1731 dbSNP
rs1189107852 1733 dbSNP
rs1434763745 1734 dbSNP
rs1177336866 1735 dbSNP
rs549977737 1737 dbSNP
rs1365331808 1739 dbSNP
rs1039417478 1747 dbSNP
rs1361284270 1750 dbSNP
rs1435942619 1751 dbSNP
rs1035558240 1760 dbSNP
rs536151302 1762 dbSNP
rs969692652 1773 dbSNP
rs1358745547 1779 dbSNP
rs1158513206 1782 dbSNP
rs1351355315 1786 dbSNP
rs1026684276 1787 dbSNP
rs1450557297 1789 dbSNP
rs770888212 1792 dbSNP
rs1427534305 1794 dbSNP
rs1189691476 1805 dbSNP
rs1248092104 1807 dbSNP
rs544896603 1808 dbSNP
rs1194627963 1809 dbSNP
rs1488624499 1809 dbSNP
rs1380096837 1814 dbSNP
rs1438336256 1820 dbSNP
rs373154711 1826 dbSNP
rs760516536 1832 dbSNP
rs1046752840 1836 dbSNP
rs574249542 1846 dbSNP
rs1321741186 1850 dbSNP
rs929901672 1851 dbSNP
rs919839694 1856 dbSNP
rs1330379623 1857 dbSNP
rs559809529 1858 dbSNP
rs1326354278 1863 dbSNP
rs947879123 1865 dbSNP
rs1659298 1869 dbSNP
rs1280377522 1870 dbSNP
rs1217097893 1873 dbSNP
rs932925018 1875 dbSNP
rs992231210 1878 dbSNP
rs1226089563 1880 dbSNP
rs749538405 1881 dbSNP
rs1291460651 1887 dbSNP
rs1321892986 1892 dbSNP
rs1197654952 1903 dbSNP
rs35900394 1905 dbSNP
rs780251803 1909 dbSNP
rs1043691848 1941 dbSNP
rs1279201698 1946 dbSNP
rs1180961037 1947 dbSNP
rs923971359 1950 dbSNP
rs769827646 1955 dbSNP
rs1402192129 1960 dbSNP
rs913956799 1969 dbSNP
rs766976749 1970 dbSNP
rs1416093124 1975 dbSNP
rs181974020 1978 dbSNP
rs1462102763 1986 dbSNP
rs559342323 1987 dbSNP
rs1466678036 1999 dbSNP
rs1360953617 2007 dbSNP
rs1466990163 2010 dbSNP
rs1331840193 2019 dbSNP
rs1174283166 2021 dbSNP
rs552218752 2027 dbSNP
rs1285405535 2037 dbSNP
rs116594555 2045 dbSNP
rs11634919 2052 dbSNP
rs964885429 2058 dbSNP
rs1319640435 2059 dbSNP
rs1018456523 2064 dbSNP
rs1185851923 2073 dbSNP
rs995155228 2078 dbSNP
rs763748045 2083 dbSNP
rs1239224193 2088 dbSNP
rs73413219 2089 dbSNP
rs1193129057 2093 dbSNP
rs1015325378 2095 dbSNP
rs1421719350 2103 dbSNP
rs1659299 2107 dbSNP
rs536943513 2111 dbSNP
rs1322435533 2112 dbSNP
rs561581785 2114 dbSNP
rs993826072 2115 dbSNP
rs1258247426 2118 dbSNP
rs778304589 2122 dbSNP
rs1275799482 2124 dbSNP
rs1220856328 2126 dbSNP
rs1218896843 2127 dbSNP
rs898422967 2128 dbSNP
rs1344768878 2138 dbSNP
rs1199161511 2141 dbSNP
rs997021167 2152 dbSNP
rs1486309109 2153 dbSNP
rs758777677 2164 dbSNP
rs1261148593 2166 dbSNP
rs1478901008 2166 dbSNP
rs541768343 2173 dbSNP
rs1376794757 2175 dbSNP
rs1476911180 2186 dbSNP
rs1174173061 2187 dbSNP
rs1395577188 2189 dbSNP
rs1397099779 2197 dbSNP
rs897342829 2202 dbSNP
rs572038972 2207 dbSNP
rs1382382277 2211 dbSNP
rs894948781 2217 dbSNP
rs1329065133 2219 dbSNP
rs1056685972 2223 dbSNP
rs558623921 2243 dbSNP
rs1231491706 2245 dbSNP
rs1277025745 2250 dbSNP
rs1240098778 2253 dbSNP
rs939459432 2253 dbSNP
rs752297402 2256 dbSNP
rs538717547 2260 dbSNP
rs1205849763 2263 dbSNP
rs978073551 2272 dbSNP
rs1401324078 2276 dbSNP
rs1266936971 2277 dbSNP
rs576135681 2283 dbSNP
rs1056471838 2286 dbSNP
rs1173003711 2288 dbSNP
rs556072437 2291 dbSNP
rs574579486 2293 dbSNP
rs1382158726 2306 dbSNP
rs1453854003 2310 dbSNP
rs915499358 2314 dbSNP
rs926716112 2334 dbSNP
rs1371112199 2337 dbSNP
rs1388177800 2341 dbSNP
rs764939712 2347 dbSNP
rs759027868 2359 dbSNP
rs965318625 2366 dbSNP
rs1424294160 2375 dbSNP
rs1446618512 2377 dbSNP
rs1019136646 2378 dbSNP
rs1415823829 2390 dbSNP
rs970309682 2394 dbSNP
rs1181238371 2396 dbSNP
rs1319322857 2403 dbSNP
rs1239823122 2414 dbSNP
rs536404639 2416 dbSNP
rs143772615 2423 dbSNP
rs988043285 2425 dbSNP
rs919841043 2429 dbSNP
rs62020023 2432 dbSNP
rs1211866289 2433 dbSNP
rs1200127052 2442 dbSNP
rs533850679 2448 dbSNP
rs565721313 2450 dbSNP
rs1025364502 2454 dbSNP
rs1176618754 2460 dbSNP
rs1239905779 2470 dbSNP
rs1251077603 2479 dbSNP
rs1015304845 2481 dbSNP
rs993837156 2483 dbSNP
rs986474851 2490 dbSNP
rs1366240819 2491 dbSNP
rs189310877 2498 dbSNP
rs1399164651 2500 dbSNP
rs1245346089 2501 dbSNP
rs898138459 2502 dbSNP
rs532461908 2507 dbSNP
rs1465426552 2520 dbSNP
rs1028093773 2522 dbSNP
rs1376139178 2524 dbSNP
rs1017276380 2531 dbSNP
rs1444806159 2537 dbSNP
rs1338789506 2540 dbSNP
rs879182353 2542 dbSNP
rs1235279833 2544 dbSNP
rs1274038443 2551 dbSNP
rs895036319 2556 dbSNP
rs904045663 2560 dbSNP
rs1297424675 2562 dbSNP
rs1196506159 2563 dbSNP
rs1022525217 2569 dbSNP
rs1480897456 2571 dbSNP
rs1458175665 2572 dbSNP
rs534426961 2573 dbSNP
rs1056335927 2576 dbSNP
rs1188125769 2579 dbSNP
rs1370133741 2582 dbSNP
rs1161593215 2585 dbSNP
rs892458016 2586 dbSNP
rs939178119 2587 dbSNP
rs1168919411 2588 dbSNP
rs766347206 2592 dbSNP
rs1042431166 2595 dbSNP
rs1302762992 2596 dbSNP
rs946733975 2600 dbSNP
rs915276513 2615 dbSNP
rs1416668614 2623 dbSNP
rs1294039191 2629 dbSNP
rs1340066439 2632 dbSNP
rs975131749 2637 dbSNP
rs1210825317 2639 dbSNP
rs570095113 2641 dbSNP
rs1254169601 2644 dbSNP
rs1486632882 2645 dbSNP
rs1290299510 2651 dbSNP
rs1487080541 2664 dbSNP
rs1195415273 2670 dbSNP
rs1222378087 2671 dbSNP
rs1354558305 2676 dbSNP
rs796632671 2682 dbSNP
rs1045156474 2690 dbSNP
rs1311510701 2700 dbSNP
rs943674068 2701 dbSNP
rs1335421563 2702 dbSNP
rs1302171869 2705 dbSNP
rs1437151063 2710 dbSNP
rs1387139118 2711 dbSNP
rs912123162 2719 dbSNP
rs1367192985 2730 dbSNP
rs776587988 2732 dbSNP
rs1362996522 2738 dbSNP
rs550009858 2750 dbSNP
rs1361046265 2757 dbSNP
rs939900580 2763 dbSNP
rs1284602584 2764 dbSNP
rs183787554 2768 dbSNP
rs1450931325 2769 dbSNP
rs1362869321 2771 dbSNP
rs1217396723 2775 dbSNP
rs1242309743 2778 dbSNP
rs1487983275 2780 dbSNP
rs62020022 2783 dbSNP
rs1251559135 2785 dbSNP
rs955036980 2786 dbSNP
rs1174835495 2787 dbSNP
rs1380285533 2791 dbSNP
rs1417927783 2803 dbSNP
rs1161423523 2827 dbSNP
rs1028061241 2832 dbSNP
rs975588739 2844 dbSNP
rs972447730 2846 dbSNP
rs1022919527 2847 dbSNP
rs1267182099 2860 dbSNP
rs1009744833 2862 dbSNP
rs892678938 2870 dbSNP
rs541733477 2887 dbSNP
rs1199374975 2889 dbSNP
rs1284374102 2894 dbSNP
rs1003487050 2917 dbSNP
rs1271600111 2924 dbSNP
rs1335208681 2930 dbSNP
rs1470093634 2933 dbSNP
rs905225976 2934 dbSNP
rs1194724392 2935 dbSNP
rs1045125579 2941 dbSNP
rs1288720284 2942 dbSNP
rs528022234 2943 dbSNP
rs781765173 2944 dbSNP
rs564873127 2945 dbSNP
rs34432487 2946 dbSNP
rs750272287 2946 dbSNP
rs796379209 2946 dbSNP
rs11633629 2947 dbSNP
rs1404917586 2947 dbSNP
rs1408843450 2947 dbSNP
rs377098178 2947 dbSNP
rs62849961 2947 dbSNP
rs1377831955 2948 dbSNP
rs58324826 2948 dbSNP
rs1012320800 2949 dbSNP
rs1214679812 2949 dbSNP
rs1226180457 2949 dbSNP
rs1257842901 2949 dbSNP
rs1335116826 2949 dbSNP
rs368507767 2949 dbSNP
rs908428676 2949 dbSNP
rs939890117 2949 dbSNP
rs1256872055 2950 dbSNP
rs1491321851 2951 dbSNP
rs1217668923 2952 dbSNP
rs1355642544 2952 dbSNP
rs1358568411 2952 dbSNP
rs199517955 2952 dbSNP
rs35977807 2952 dbSNP
rs1235670235 2953 dbSNP
rs1277889244 2955 dbSNP
rs1337868784 2958 dbSNP
rs895095981 2959 dbSNP
rs575956168 2965 dbSNP
rs1003352641 2968 dbSNP
rs1208759676 2986 dbSNP
rs1281179348 2990 dbSNP
rs1193238025 3004 dbSNP
rs556175171 3005 dbSNP
rs1371618276 3006 dbSNP
rs902328067 3008 dbSNP
rs968168415 3010 dbSNP
rs1042192031 3012 dbSNP
rs914999138 3014 dbSNP
rs773310656 3021 dbSNP
rs1432805118 3035 dbSNP
rs988690584 3036 dbSNP
rs956899662 3041 dbSNP
rs1320133531 3043 dbSNP
rs1010970264 3045 dbSNP
rs1315770416 3047 dbSNP
rs893881381 3052 dbSNP
rs370544163 3053 dbSNP
rs371101776 3053 dbSNP
rs1344879653 3056 dbSNP
rs969352296 3061 dbSNP
rs1282496098 3062 dbSNP
rs564538742 3062 dbSNP
rs78177614 3062 dbSNP
rs142450413 3063 dbSNP
rs1051992865 3064 dbSNP
rs1193568228 3064 dbSNP
rs148296803 3064 dbSNP
rs796640317 3064 dbSNP
rs1426717774 3065 dbSNP
rs1176188735 3066 dbSNP
rs1395677071 3067 dbSNP
rs533813178 3067 dbSNP
rs1024025508 3070 dbSNP
rs1386619182 3071 dbSNP
rs61603322 3071 dbSNP
rs773083404 3071 dbSNP
rs1478320287 3072 dbSNP
rs1265978974 3076 dbSNP
rs994853229 3087 dbSNP
rs1370738652 3091 dbSNP
rs1439238642 3091 dbSNP
rs11633460 3092 dbSNP
rs1372419236 3094 dbSNP
rs1353062301 3099 dbSNP
rs899224010 3099 dbSNP
rs1180331666 3101 dbSNP
rs538279670 3109 dbSNP
rs771870376 3111 dbSNP
rs539174655 3116 dbSNP
rs962528524 3119 dbSNP
rs1321700348 3123 dbSNP
rs909614055 3125 dbSNP
rs1253514949 3132 dbSNP
rs1439033436 3134 dbSNP
rs1178998638 3136 dbSNP
rs1262687906 3143 dbSNP
rs1222682547 3145 dbSNP
rs990506193 3146 dbSNP
rs886962802 3150 dbSNP
rs1428523883 3155 dbSNP
rs1051002537 3156 dbSNP
rs933929134 3158 dbSNP
rs921190286 3159 dbSNP
rs1304878235 3184 dbSNP
rs1039736903 3186 dbSNP
rs946421352 3191 dbSNP
rs959276724 3201 dbSNP
rs1292899981 3202 dbSNP
rs1333015912 3204 dbSNP
rs569539922 3207 dbSNP
rs987933710 3213 dbSNP
rs192809379 3221 dbSNP
rs966582867 3223 dbSNP
rs1020783878 3226 dbSNP
rs60663227 3229 dbSNP
rs1419147099 3236 dbSNP
rs1372410631 3240 dbSNP
rs1186273617 3252 dbSNP
rs1335588227 3265 dbSNP
rs1475998837 3266 dbSNP
rs569972146 3268 dbSNP
rs893900083 3272 dbSNP
rs1167504676 3273 dbSNP
rs969576499 3277 dbSNP
rs1296945736 3283 dbSNP
rs1399343893 3284 dbSNP
rs1039491004 3285 dbSNP
rs1007576391 3290 dbSNP
rs781362821 3291 dbSNP
rs376327953 3292 dbSNP
rs1353752810 3300 dbSNP
rs1235373566 3306 dbSNP
rs1051753078 3313 dbSNP
rs929566194 3314 dbSNP
rs146819334 3321 dbSNP
rs1037906572 3322 dbSNP
rs1480944896 3326 dbSNP
rs1005007519 3331 dbSNP
rs111663554 3332 dbSNP
rs1254823217 3333 dbSNP
rs1486412308 3342 dbSNP
rs1265450322 3345 dbSNP
rs1188238041 3350 dbSNP
rs942157942 3353 dbSNP
rs1428289461 3359 dbSNP
rs1168828014 3366 dbSNP
rs143685196 3367 dbSNP
rs990948828 3381 dbSNP
rs998020773 3383 dbSNP
rs959142568 3385 dbSNP
rs1416762262 3388 dbSNP
rs1039636770 3394 dbSNP
rs1361571606 3400 dbSNP
rs1189728377 3403 dbSNP
rs1380286443 3408 dbSNP
rs946357104 3409 dbSNP
rs1459987689 3413 dbSNP
rs927659158 3415 dbSNP
rs981740736 3419 dbSNP
rs1233483908 3420 dbSNP
rs966633073 3424 dbSNP
rs749790953 3428 dbSNP
rs1242840810 3429 dbSNP
rs1349404361 3432 dbSNP
rs1020795335 3444 dbSNP
rs1010743641 3446 dbSNP
rs187566491 3452 dbSNP
rs548058787 3453 dbSNP
rs184995083 3460 dbSNP
rs1008085731 3464 dbSNP
rs1264304575 3465 dbSNP
rs1429567297 3466 dbSNP
rs890527033 3470 dbSNP
rs778357623 3471 dbSNP
rs1174388733 3472 dbSNP
rs1338687571 3475 dbSNP
rs1344776456 3483 dbSNP
rs1451941905 3490 dbSNP
rs1290349695 3492 dbSNP
rs1284650706 3499 dbSNP
rs948238001 3502 dbSNP
rs1030373825 3512 dbSNP
rs973701941 3528 dbSNP
rs758900836 3537 dbSNP
rs1234356995 3539 dbSNP
rs1379934675 3553 dbSNP
rs1313996714 3558 dbSNP
rs993486447 3562 dbSNP
rs898085954 3568 dbSNP
rs1355882433 3570 dbSNP
rs1465625631 3571 dbSNP
rs1037916511 3579 dbSNP
rs1327295783 3581 dbSNP
rs1251652666 3585 dbSNP
rs536810692 3587 dbSNP
rs1407361512 3588 dbSNP
rs1392092814 3591 dbSNP
rs567876969 3592 dbSNP
rs894666124 3597 dbSNP
rs1346086269 3600 dbSNP
rs1442923199 3601 dbSNP
rs1055951492 3609 dbSNP
rs776345972 3614 dbSNP
rs545717722 3620 dbSNP
rs77921835 3622 dbSNP
rs1202195267 3623 dbSNP
rs1018607117 3631 dbSNP
rs562357141 3634 dbSNP
rs542691164 3635 dbSNP
rs1333763420 3636 dbSNP
rs981750609 3646 dbSNP
rs1271692106 3661 dbSNP
rs1470172618 3666 dbSNP
rs945005916 3667 dbSNP
rs1436943221 3669 dbSNP
rs1479697257 3671 dbSNP
rs913839582 3673 dbSNP
rs573683099 3682 dbSNP
rs1179068026 3684 dbSNP
rs1412946465 3685 dbSNP
rs1371054 3686 dbSNP
rs1224611598 3692 dbSNP
rs35635232 3693 dbSNP
rs1356695563 3696 dbSNP
rs540076801 3705 dbSNP
rs893722759 3705 dbSNP
rs1461819191 3712 dbSNP
rs1328094017 3721 dbSNP
rs935018704 3726 dbSNP
rs1375092630 3728 dbSNP
rs765901059 3730 dbSNP
rs1443710070 3743 dbSNP
rs985977140 3748 dbSNP
rs1354382078 3752 dbSNP
rs1046161683 3756 dbSNP
rs954807058 3757 dbSNP
rs1030385233 3764 dbSNP
rs577419984 3769 dbSNP
rs1229319214 3779 dbSNP
rs1272888698 3782 dbSNP
rs916792734 3784 dbSNP
rs867800598 3790 dbSNP
rs1206657552 3792 dbSNP
rs993497850 3799 dbSNP
rs528677339 3807 dbSNP
rs1252667671 3808 dbSNP
rs141264086 3811 dbSNP
rs1259955887 3816 dbSNP
rs62020021 3824 dbSNP
rs1167157653 3825 dbSNP
rs551753982 3832 dbSNP
rs1006911325 3833 dbSNP
rs1374338994 3836 dbSNP
rs1412451815 3839 dbSNP
rs1314329530 3841 dbSNP
rs1159348474 3843 dbSNP
rs1449185534 3850 dbSNP
rs894726457 3858 dbSNP
rs1270004746 3860 dbSNP
rs1337972894 3863 dbSNP
rs1216834649 3864 dbSNP
rs954706097 3865 dbSNP
rs1371055 3872 dbSNP
rs556313543 3875 dbSNP
rs1176830243 3888 dbSNP
rs1469489398 3889 dbSNP
rs974864623 3890 dbSNP
rs116463100 3891 dbSNP
rs796770724 3893 dbSNP
rs906295822 3895 dbSNP
rs370235249 3901 dbSNP
rs1046109048 3902 dbSNP
rs1290875227 3910 dbSNP
rs192606967 3911 dbSNP
rs945056566 3927 dbSNP
rs1011159314 3936 dbSNP
rs1432294708 3941 dbSNP
rs893702032 3949 dbSNP
rs1030892300 3951 dbSNP
rs761560080 3957 dbSNP
rs547919538 3958 dbSNP
rs1325064242 3970 dbSNP
rs1222832825 3971 dbSNP
rs145173599 3979 dbSNP
rs1370969109 3980 dbSNP
rs936623484 3985 dbSNP
rs1282598555 3997 dbSNP
rs1345894878 3999 dbSNP
rs149965846 4003 dbSNP
rs1037833264 4008 dbSNP
rs1448519111 4009 dbSNP
rs1345446704 4012 dbSNP
rs878864130 4023 dbSNP
rs908094899 4023 dbSNP
rs986374039 4024 dbSNP
rs954488074 4032 dbSNP
rs1030437414 4036 dbSNP
rs1469257516 4037 dbSNP
rs1156440495 4042 dbSNP
rs1386733994 4045 dbSNP
rs74698238 4046 dbSNP
rs962104714 4052 dbSNP
rs531945377 4054 dbSNP
rs550146327 4059 dbSNP
rs1433062984 4060 dbSNP
rs923301153 4065 dbSNP
rs934715981 4068 dbSNP
rs1439343397 4070 dbSNP
rs1016719741 4076 dbSNP
rs1303423488 4080 dbSNP
rs1331737827 4081 dbSNP
rs1006216461 4086 dbSNP
rs139207545 4090 dbSNP
rs188716593 4091 dbSNP
rs1343494209 4092 dbSNP
rs1277978405 4094 dbSNP
rs959222371 4098 dbSNP
rs548749027 4100 dbSNP
rs763755494 4110 dbSNP
rs1003015361 4111 dbSNP
rs528972076 4114 dbSNP
rs1431657824 4118 dbSNP
rs989300811 4120 dbSNP
rs958142214 4130 dbSNP
rs1365130124 4133 dbSNP
rs1472731662 4134 dbSNP
rs182737942 4135 dbSNP
rs1041855388 4143 dbSNP
rs1009293985 4158 dbSNP
rs1295794199 4160 dbSNP
rs1486592623 4163 dbSNP
rs113112482 4164 dbSNP
rs1390871140 4165 dbSNP
rs1326961121 4168 dbSNP
rs1239833272 4172 dbSNP
rs1352519846 4173 dbSNP
rs1410673667 4184 dbSNP
rs28510545 4190 dbSNP
rs1332397952 4202 dbSNP
rs970357372 4214 dbSNP
rs1265935764 4226 dbSNP
rs1338690592 4227 dbSNP
rs1053897319 4228 dbSNP
rs1193530609 4230 dbSNP
rs936314257 4235 dbSNP
rs1252051252 4240 dbSNP
rs1483143625 4246 dbSNP
rs563489197 4250 dbSNP
rs1474414932 4262 dbSNP
rs555496661 4263 dbSNP
rs910460773 4264 dbSNP
rs752364093 4265 dbSNP
rs1461951858 4269 dbSNP
rs933213236 4291 dbSNP
rs1264547012 4297 dbSNP
rs1166166019 4300 dbSNP
rs925792678 4306 dbSNP
rs1012327267 4307 dbSNP
rs1222068780 4317 dbSNP
rs1410579943 4336 dbSNP
rs923124530 4337 dbSNP
rs1323266821 4338 dbSNP
rs1279448789 4344 dbSNP
rs776936064 4351 dbSNP
rs894870450 4355 dbSNP
rs150789906 4357 dbSNP
rs1313198329 4358 dbSNP
rs1325715987 4361 dbSNP
rs190897686 4368 dbSNP
rs909264915 4370 dbSNP
rs187933093 4380 dbSNP
rs62020020 4383 dbSNP
rs606143 4389 dbSNP
rs536215015 4406 dbSNP
rs1183927649 4414 dbSNP
rs923520588 4415 dbSNP
rs2290982 4419 dbSNP
rs1428313860 4421 dbSNP
rs1191650349 4425 dbSNP
rs1392643905 4426 dbSNP
rs12908678 4432 dbSNP
rs1039011887 4440 dbSNP
rs772612515 4461 dbSNP
rs1373824852 4462 dbSNP
rs1160344204 4471 dbSNP
rs1467778842 4474 dbSNP
rs943379793 4475 dbSNP
rs748502316 4481 dbSNP
rs914650214 4482 dbSNP
rs1020448591 4483 dbSNP
rs1185440588 4484 dbSNP
rs779369996 4496 dbSNP
rs892215577 4500 dbSNP
rs1461323440 4502 dbSNP
rs1232868869 4513 dbSNP
rs766272908 4521 dbSNP
rs554278949 4526 dbSNP
rs1454143797 4529 dbSNP
rs1053499420 4534 dbSNP
rs1000956400 4545 dbSNP
rs1259843232 4549 dbSNP
rs772112287 4551 dbSNP
rs1250392543 4559 dbSNP
rs888757164 4561 dbSNP
rs1193015161 4571 dbSNP
rs1393361958 4574 dbSNP
rs957865479 4577 dbSNP
rs1177047087 4587 dbSNP
rs1207006682 4598 dbSNP
rs62020019 4613 dbSNP
rs1451327343 4614 dbSNP
rs191151956 4618 dbSNP
rs923178409 4649 dbSNP
rs1229030739 4672 dbSNP
rs1385070842 4686 dbSNP
rs1389241105 4696 dbSNP
rs1313256363 4698 dbSNP
rs1624779 4700 dbSNP
rs1369083619 4701 dbSNP
rs1401257509 4709 dbSNP
rs1219375546 4712 dbSNP
rs940466544 4716 dbSNP
rs1298552350 4717 dbSNP
rs185878032 4721 dbSNP
rs1226898406 4724 dbSNP
rs984865334 4728 dbSNP
rs1465698177 4736 dbSNP
rs1169647929 4738 dbSNP
rs959326184 4742 dbSNP
rs569488729 4744 dbSNP
rs1015996626 4746 dbSNP
rs1006418065 4747 dbSNP
rs886197602 4748 dbSNP
rs959030873 4752 dbSNP
rs1161028920 4754 dbSNP
rs1250721848 4755 dbSNP
rs927338206 4759 dbSNP
rs981404842 4768 dbSNP
rs144410334 4773 dbSNP
rs1197931961 4776 dbSNP
rs1479861520 4789 dbSNP
rs1162698920 4793 dbSNP
rs1351588371 4794 dbSNP
rs971655116 4796 dbSNP
rs1020459785 4801 dbSNP
rs1436547356 4806 dbSNP
rs988939438 4808 dbSNP
rs528831801 4809 dbSNP
rs77390774 4815 dbSNP
rs559734106 4831 dbSNP
rs1032519194 4834 dbSNP
rs140466327 4836 dbSNP
rs1330230861 4847 dbSNP
rs1233096878 4849 dbSNP
rs779619364 4855 dbSNP
rs558269142 4856 dbSNP
rs893168198 4857 dbSNP
rs1232380454 4858 dbSNP
rs563938412 4859 dbSNP
rs1184598503 4866 dbSNP
rs749908095 4869 dbSNP
rs1028699345 4870 dbSNP
rs1336589121 4871 dbSNP
rs1161296678 4880 dbSNP
rs1309336550 4884 dbSNP
rs1415823549 4887 dbSNP
rs1405885910 4898 dbSNP
rs1169064117 4904 dbSNP
rs997153363 4909 dbSNP
rs977869609 4910 dbSNP
rs1308223346 4911 dbSNP
rs1051506 4920 dbSNP
rs1414494458 4922 dbSNP
rs917826868 4935 dbSNP
rs1381893897 4976 dbSNP
rs1229411809 4981 dbSNP
rs991168093 4983 dbSNP
rs1340133138 4993 dbSNP
rs1297587567 4995 dbSNP
rs1425186049 5006 dbSNP
rs867612111 5008 dbSNP
rs1485481342 5021 dbSNP
rs569633307 5023 dbSNP
rs1161148620 5024 dbSNP
rs575408021 5025 dbSNP
rs1450766536 5028 dbSNP
rs1016310907 5037 dbSNP
rs940533894 5039 dbSNP
rs1364085176 5040 dbSNP
rs984459261 5043 dbSNP
rs561785198 5050 dbSNP
rs1332544646 5052 dbSNP
rs1361249410 5053 dbSNP
rs1183520443 5056 dbSNP
rs1449307204 5059 dbSNP
rs1270096127 5061 dbSNP
rs887647552 5069 dbSNP
rs1049349340 5076 dbSNP
rs937480069 5077 dbSNP
rs950425964 5077 dbSNP
rs927373212 5085 dbSNP
rs1298426006 5097 dbSNP
rs1347351152 5104 dbSNP
rs1198932227 5105 dbSNP
rs1281074279 5108 dbSNP
rs1442752426 5115 dbSNP
rs1214864752 5116 dbSNP
rs1246059864 5122 dbSNP
rs981416318 5128 dbSNP
rs950012329 5133 dbSNP
rs997674064 5135 dbSNP
rs1476791192 5136 dbSNP
rs539478622 5136 dbSNP
rs1173968650 5137 dbSNP
rs1425479494 5150 dbSNP
rs902037035 5154 dbSNP
rs1320333783 5156 dbSNP
rs1387042475 5161 dbSNP
rs757247648 5180 dbSNP
rs1321872118 5190 dbSNP
rs183367960 5216 dbSNP
rs893394588 5227 dbSNP
rs191053623 5228 dbSNP
rs1345998993 5229 dbSNP
rs1033221741 5230 dbSNP
rs1466155178 5239 dbSNP
rs903245185 5239 dbSNP
rs986026488 5247 dbSNP
rs571109895 5251 dbSNP
rs867302106 5255 dbSNP
rs574046755 5256 dbSNP
rs1221844439 5258 dbSNP
rs949202993 5273 dbSNP
rs1246879290 5274 dbSNP
rs1469339478 5276 dbSNP
rs1158812366 5280 dbSNP
rs147177922 5283 dbSNP
rs1262773398 5286 dbSNP
rs1237124167 5305 dbSNP
rs990676600 5312 dbSNP
rs1314951223 5315 dbSNP
rs1287523936 5319 dbSNP
rs1385099998 5327 dbSNP
rs1405278560 5328 dbSNP
rs764457766 5328 dbSNP
rs201039374 5334 dbSNP
rs909151290 5339 dbSNP
rs1286756934 5344 dbSNP
rs537774155 5354 dbSNP
rs950393539 5356 dbSNP
rs1272449887 5359 dbSNP
rs763961415 5363 dbSNP
rs1289979682 5367 dbSNP
rs534263615 5367 dbSNP
rs762587942 5369 dbSNP
rs536464835 5398 dbSNP
rs568689036 5404 dbSNP
rs1183376042 5408 dbSNP
rs1451221662 5418 dbSNP
rs1362813137 5420 dbSNP
rs887687843 5423 dbSNP
rs1391532204 5425 dbSNP
rs1033235544 5426 dbSNP
rs1177623171 5433 dbSNP
rs538013900 5439 dbSNP
rs1048919910 5443 dbSNP
rs1352614010 5448 dbSNP
rs569457219 5449 dbSNP
rs766696682 5455 dbSNP
rs905959847 5459 dbSNP
rs1311785837 5475 dbSNP
rs1045766873 5479 dbSNP
rs1447702637 5480 dbSNP
rs555749910 5482 dbSNP
rs1266029423 5487 dbSNP
rs1340801700 5500 dbSNP
rs913262933 5506 dbSNP
rs186135213 5507 dbSNP
rs894562868 5509 dbSNP
rs566110721 5513 dbSNP
rs1485677714 5514 dbSNP
rs936302794 5519 dbSNP
rs1290242337 5534 dbSNP
rs926166189 5543 dbSNP
rs1219354662 5545 dbSNP
rs548886848 5554 dbSNP
rs1369591330 5555 dbSNP
rs1223963131 5561 dbSNP
rs546238857 5564 dbSNP
rs528737002 5566 dbSNP
rs769032598 5569 dbSNP
rs567873350 5574 dbSNP
rs965768856 5586 dbSNP
rs1301988297 5595 dbSNP
rs1399788190 5597 dbSNP
rs1397601697 5603 dbSNP
rs1014636906 5610 dbSNP
rs1225492504 5615 dbSNP
rs1319747021 5616 dbSNP
rs1004946316 5621 dbSNP
rs1253948577 5623 dbSNP
rs749611835 5636 dbSNP
rs1202603020 5637 dbSNP
rs780432921 5644 dbSNP
rs1027946231 5648 dbSNP
rs1464868748 5650 dbSNP
rs1001391581 5654 dbSNP
rs17238318 5655 dbSNP
rs1045527192 5656 dbSNP
rs1014315031 5657 dbSNP
rs1450238817 5659 dbSNP
rs1175585984 5660 dbSNP
rs891875200 5661 dbSNP
rs1467340969 5662 dbSNP
rs878904599 5666 dbSNP
rs1387728011 5668 dbSNP
rs1432825968 5670 dbSNP
rs1053134968 5682 dbSNP
rs1218173769 5684 dbSNP
rs1471192532 5697 dbSNP
rs935963665 5698 dbSNP
rs926247053 5702 dbSNP
rs1050402630 5703 dbSNP
rs1235838453 5706 dbSNP
rs932877428 5716 dbSNP
rs1264152497 5717 dbSNP
rs1329015160 5720 dbSNP
rs1207376517 5722 dbSNP
rs910317918 5725 dbSNP
rs922789673 5729 dbSNP
rs976917385 5737 dbSNP
rs550656175 5738 dbSNP
rs1191132186 5747 dbSNP
rs1435131963 5756 dbSNP
rs957588341 5758 dbSNP
rs16976367 5759 dbSNP
rs1244038608 5760 dbSNP
rs1205785020 5763 dbSNP
rs1389352704 5771 dbSNP
rs117471766 5788 dbSNP
rs2248033 5791 dbSNP
rs11639329 5805 dbSNP
rs894523889 5808 dbSNP
rs1287397865 5816 dbSNP
rs1340011960 5821 dbSNP
rs1350252218 5829 dbSNP
rs1271797983 5831 dbSNP
rs11634657 5835 dbSNP
rs1002429998 5851 dbSNP
rs1318075726 5858 dbSNP
rs1363807110 5861 dbSNP
rs1001885108 5868 dbSNP
rs1263772502 5869 dbSNP
rs1489538772 5877 dbSNP
rs1454217064 5882 dbSNP
rs763543633 5884 dbSNP
rs969928397 5889 dbSNP
rs1251415020 5890 dbSNP
rs1471476074 5900 dbSNP
rs62020018 5902 dbSNP
rs1014010763 5926 dbSNP
rs1404704470 5928 dbSNP
rs891886556 5940 dbSNP
rs1162027132 5941 dbSNP
rs1351106016 5945 dbSNP
rs1410824224 5947 dbSNP
rs929176410 5950 dbSNP
rs919175757 5954 dbSNP
rs1408341849 5971 dbSNP
rs1290599477 5975 dbSNP
rs1374614432 5976 dbSNP
rs1053589507 5986 dbSNP
rs1040037447 5990 dbSNP
rs755730132 6000 dbSNP
rs1323547563 6001 dbSNP
rs1223386685 6005 dbSNP
rs1000216865 6006 dbSNP
rs904553687 6011 dbSNP
rs1049734841 6012 dbSNP
rs932929830 6016 dbSNP
rs944399759 6030 dbSNP
rs1385909452 6031 dbSNP
rs1233260358 6038 dbSNP
rs1185454352 6039 dbSNP
rs1472379632 6040 dbSNP
rs578077090 6046 dbSNP
rs76359269 6052 dbSNP
rs1041240057 6061 dbSNP
rs780701646 6073 dbSNP
rs1167446379 6074 dbSNP
rs1368245400 6082 dbSNP
rs957768885 6083 dbSNP
rs1308320081 6086 dbSNP
rs926158430 6087 dbSNP
rs544709434 6090 dbSNP
rs907633510 6098 dbSNP
rs1447811251 6100 dbSNP
rs1301584288 6104 dbSNP
rs983577576 6110 dbSNP
rs575733503 6115 dbSNP
rs1246753082 6117 dbSNP
rs977566944 6121 dbSNP
rs1340238101 6122 dbSNP
rs930396890 6132 dbSNP
rs920277499 6133 dbSNP
rs1438175723 6141 dbSNP
rs1275096754 6149 dbSNP
rs979734925 6150 dbSNP
rs1024526221 6151 dbSNP
rs1461713041 6152 dbSNP
rs993225355 6154 dbSNP
rs1193979933 6155 dbSNP
rs1340890608 6166 dbSNP
rs78793154 6175 dbSNP
rs1387768426 6179 dbSNP
rs958757946 6183 dbSNP
rs756661911 6188 dbSNP
rs969957825 6189 dbSNP
rs181448671 6190 dbSNP
rs1380139878 6194 dbSNP
rs1283170486 6208 dbSNP
rs1332646388 6211 dbSNP
rs535744838 6212 dbSNP
rs1408855357 6213 dbSNP
rs1005671627 6220 dbSNP
rs189063275 6221 dbSNP
rs1027452329 6224 dbSNP
rs993345896 6232 dbSNP
rs529739174 6245 dbSNP
rs539003153 6248 dbSNP
rs570446349 6250 dbSNP
rs1031493093 6261 dbSNP
rs1324074225 6264 dbSNP
rs751519122 6267 dbSNP
rs904605810 6271 dbSNP
rs1246157709 6277 dbSNP
rs796673264 6277 dbSNP
rs944351936 6280 dbSNP
rs1476840120 6287 dbSNP
rs1028777829 6288 dbSNP
rs1171127849 6291 dbSNP
rs186564734 6294 dbSNP
rs1470548164 6296 dbSNP
rs1159038032 6297 dbSNP
rs879193527 6299 dbSNP
rs766074013 6301 dbSNP
rs1402478645 6311 dbSNP
rs1319067410 6314 dbSNP
rs1330680031 6315 dbSNP
rs182006553 6315 dbSNP
rs901425183 6316 dbSNP
rs1041292792 6324 dbSNP
rs1050590229 6326 dbSNP
rs940182872 6329 dbSNP
rs1413423390 6331 dbSNP
rs1331184042 6334 dbSNP
rs540915844 6353 dbSNP
rs1159358135 6354 dbSNP
rs1470420085 6366 dbSNP
rs887302621 6368 dbSNP
rs1048536320 6369 dbSNP
rs1288543511 6379 dbSNP
rs1179349628 6381 dbSNP
rs1482701917 6383 dbSNP
rs1269440751 6392 dbSNP
rs1449433391 6392 dbSNP
rs930427505 6401 dbSNP
rs540582338 6413 dbSNP
rs1480956877 6414 dbSNP
rs1181939948 6415 dbSNP
rs1356637531 6435 dbSNP
rs1455815490 6442 dbSNP
rs1159707496 6448 dbSNP
rs573262186 6449 dbSNP
rs979741572 6451 dbSNP
rs1403716740 6454 dbSNP
rs1305161950 6459 dbSNP
rs1366451137 6462 dbSNP
rs1408950985 6463 dbSNP
rs756126056 6465 dbSNP
rs35309142 6468 dbSNP
rs1286233273 6469 dbSNP
rs948367828 6475 dbSNP
rs1283597296 6478 dbSNP
rs917178047 6480 dbSNP
rs977530822 6484 dbSNP
rs1482525222 6488 dbSNP
rs992736119 6489 dbSNP
rs571953615 6490 dbSNP
rs1031963737 6500 dbSNP
rs1346699272 6502 dbSNP
rs1183126269 6503 dbSNP
rs1305480758 6509 dbSNP
rs750331336 6512 dbSNP
rs978612144 6518 dbSNP
rs1429591586 6522 dbSNP
rs993136178 6523 dbSNP
rs1306469295 6525 dbSNP
rs1319278823 6534 dbSNP
rs1402695768 6539 dbSNP
rs1391802261 6558 dbSNP
rs1333407629 6564 dbSNP
rs1406006177 6566 dbSNP
rs1338655382 6567 dbSNP
rs1247487952 6576 dbSNP
rs530663651 6576 dbSNP
rs1028370528 6577 dbSNP
rs1252740919 6580 dbSNP
rs79753177 6587 dbSNP
rs1256021133 6588 dbSNP
rs1441198240 6588 dbSNP
rs1481809897 6588 dbSNP
rs765595908 6588 dbSNP
rs996866134 6589 dbSNP
rs558229352 6591 dbSNP
rs1243811609 6595 dbSNP
rs1449012212 6606 dbSNP
rs1166918014 6607 dbSNP
rs1375052309 6612 dbSNP
rs1462263498 6614 dbSNP
rs1171818779 6618 dbSNP
rs1193750023 6625 dbSNP
rs1201474006 6625 dbSNP
rs1454495659 6627 dbSNP
rs758272368 6640 dbSNP
rs1004492014 6645 dbSNP
rs1025744769 6647 dbSNP
rs993316156 6651 dbSNP
rs1245655149 6654 dbSNP
rs1215818963 6671 dbSNP
rs887363733 6679 dbSNP
rs1281614126 6680 dbSNP
rs1255785219 6684 dbSNP
rs752517788 6685 dbSNP
rs1206120231 6688 dbSNP
rs1228233684 6693 dbSNP
rs1244339914 6702 dbSNP
rs1464485126 6709 dbSNP
rs1186782516 6717 dbSNP
rs1264080462 6721 dbSNP
rs1429346575 6723 dbSNP
rs1198490960 6731 dbSNP
rs558281474 6736 dbSNP
rs1375713241 6746 dbSNP
rs931460972 6748 dbSNP
rs1177039320 6750 dbSNP
rs1387844350 6758 dbSNP
rs1324695540 6764 dbSNP
rs1285810083 6765 dbSNP
rs189540870 6767 dbSNP
rs1455150929 6783 dbSNP
rs898928667 6788 dbSNP
rs137938884 6789 dbSNP
rs935682074 6794 dbSNP
rs948459711 6807 dbSNP
rs528384654 6810 dbSNP
rs1264249059 6831 dbSNP
rs1329116299 6843 dbSNP
rs1041472694 6844 dbSNP
rs1262550848 6848 dbSNP
rs1486270888 6853 dbSNP
rs774529267 6857 dbSNP
rs1432909153 6861 dbSNP
rs1267092382 6862 dbSNP
rs1343659000 6864 dbSNP
rs1199918872 6865 dbSNP
rs946218072 6883 dbSNP
rs1471576677 6885 dbSNP
rs750628238 6894 dbSNP
rs1345266715 6896 dbSNP
rs749330745 6898 dbSNP
rs917460883 6899 dbSNP
rs1367079994 6900 dbSNP
rs1056724819 6902 dbSNP
rs993414152 6903 dbSNP
rs1284334902 6908 dbSNP
rs934609877 6910 dbSNP
rs924518972 6911 dbSNP
rs1424301251 6914 dbSNP
rs1222556908 6917 dbSNP
rs1309830511 6919 dbSNP
rs979004332 6925 dbSNP
rs968555887 6928 dbSNP
rs921360520 6930 dbSNP
rs1220953862 6931 dbSNP
rs770071108 6940 dbSNP
rs117839328 6944 dbSNP
rs546121747 6947 dbSNP
rs1019665920 6959 dbSNP
rs1222875697 6962 dbSNP
rs1462078851 6966 dbSNP
rs1926 6974 dbSNP
rs918655561 6976 dbSNP
rs972849681 6978 dbSNP
rs1422682710 6979 dbSNP
rs951724887 6982 dbSNP
rs184165022 6983 dbSNP
rs996092189 6989 dbSNP
rs1296840023 6990 dbSNP
rs374162670 6998 dbSNP
rs1009149131 7003 dbSNP
rs1370303231 7017 dbSNP
rs774993318 7019 dbSNP
rs1029354400 7023 dbSNP
rs1374734772 7038 dbSNP
rs999800778 7042 dbSNP
rs1313027976 7043 dbSNP
rs1361754626 7059 dbSNP
rs1246984214 7060 dbSNP
rs904238339 7063 dbSNP
rs1453693068 7069 dbSNP
rs1385198001 7073 dbSNP
rs1206392732 7077 dbSNP
rs1233348953 7081 dbSNP
rs1012660919 7082 dbSNP
rs1338470355 7084 dbSNP
rs1181154305 7085 dbSNP
rs1464296232 7086 dbSNP
rs1244435273 7112 dbSNP
rs769017465 7123 dbSNP
rs1167543118 7129 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1