miRTarBase - #MIRT007083 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNF395   
Synonyms HDBP-2, HDBP2, HDRF-2, PBF, PRF-1, PRF1, Si-1-8-14
Description zinc finger protein 395
Transcript NM_018660   
Expression
Putative miRNA Targets on ZNF395
3'UTR of ZNF395
(miRNA target sites are highlighted)
>ZNF395|NM_018660|3'UTR
   1 GCTGTGCTGCAGGTTCTACTCTGTTCCTGGCCCTGCCGGCAGCCACTGACAAGAGGCCAGTGTGTCACCAGCCCTCAGCA
  81 GAAACCGAAAGAGAAAGAACGGAAACACGGAGTTTGGGCTCTGTTGGCTAAGGTGTAACACTTAAAGCAATTTTCTCCCA
 161 TTGTGCGAACATTTTATTTTTTAAAAAAAAGAAACAAAAATATTTTTCCCCCTAAAATAGGAGAGAGCCAAAACTGACCA
 241 AGGCTATTCAGCAGTGAACCAGTGACCAAAGAATTAATTACCCTCCGTTTCCCACATCCCCACTCTCTAGGGGATTAGCT
 321 TGTGCGTGTCAAAAGAAGGAACAGCTCGTTCTGCTTCCTGCTGAGTCGGTGAATTCTTTGCTTTCTAAACTCTTCCAGAA
 401 AGGACTGTGAGCAAGATGAATTTACTTTTCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAGAGTTTCTGGCTGATGGGTGA
 481 CTCAGAGTGCAGGACTGCCTGGCCGTGGGGCAGAGGGGTTTGCCCTTCTCGGAGGGTACCTCCTGTTCCCTGTCTGAGCA
 561 TCCTGCATGGAAGTCAAAGGAAATCCCTTTCTTGGTGACGACTTAAATCTGGGTTCCCTCAGACATTGGGTTGCACCCCA
 641 ACAAATATTAAATGGCTTCTTCTTAAAGCCCAGAGAAAGAGGTTTTTTAAAAGACTGTCGCCAAATAGCTGAGCCAAAAG
 721 GCTGATCAGAATTCACTTTTTGGAATGTGGCAGTTAAACACTACCTTGATCATTCTCTCCTCTTTCCTCGAGGAACTCCT
 801 GGAGGGTTTGAGCGTCTGGAAACTCTCTGCTCTGACCCGAGGAAGCACCCTCCTGACGCCGCCTTCCTCCGGTTATTGAA
 881 AGGACGCCTCAGAAATGCTTTGTTTTCTTTTACGATGTATTCAGAAGCCTTTACTGATTAAAGTTTTCTTTTATTTGGGT
 961 GGCCGGGAGAGACCCAGGGAGGTTCTGGAGGTTCCTTTCTGTCTCCTGGCCCCACCAGGGATTTCCCCATTTCTGTTTGC
1041 TGCCTGAAAGCAGGATGAGGAAGGCCAAGGAGAGTCCTTGCACCCGTGAGCGTCAGGATGAGGAAATGACAGGAGGAAGA
1121 CGTGGGTTTGGGTTAGTGGCTGCTGGCGTTTTGGCCCTTGGTGTTTCTGGAGCCTCCAGGGATCTAGGGGAGCCTGGGCT
1201 GCGTGCATGTCGATAAGCAGAGCTGTTCTTGGGGAGAAGGAGGGAGGTCTCGGGAGTGTAGCACCATGCCAACCAGCCCT
1281 GCGCGAAGACAGAGTGAGCCACGCCCGGATGGCAGGGCATGTTTCTGTTTTGGTGTCTCACTTTCCTCCCAGCGTGACTT
1361 ATTTGGGGATTCCTCAGGGCCTACTGGAATGTGACTGCCCACTGCCCAGCTGCCTCGGGTACAAGTCCTGGCCCTATGTC
1441 CCAGCTGTCAGGGGCTCAGGGAATCCTACCCAGCCACCTGTCCTGGGATGGAGTGTCAGCATCCACCCCTTGGTTGTCAT
1521 CGAGGCCGCCCTCCCAGTCCTGGGTGAAGATATTTGGGCCACCAGGGCTCCCTTGGCCCCTTCACGTAGGAAATAGACAC
1601 GTGCTTTTTAATGCAGGACACTTTGAGTGTTACAAAATCTGTAGACCTGGCAGTAGGGTCATGATGTTGGGAAGGGTGTA
1681 GTGCCCTAGGTTGGTGACAGAAGGGACAGACACTTGTGCACAGGTGTCTTTGGTGATGGGGTTTTTTTTTTTATAACTTA
1761 GTAAAAAAAAAAAAATGTATGTGGAATTCTGTCTCTTGGTAAAGCTCAAAGCCAGGCTAGCCTGAGGTGGCGCAGGGCTC
1841 TCCTTCCTGTCCCTTCGATCTCCTTGAGAATTAAGAGCTGGCAGCTGCTGATGGTGTTTCCCAACCCCCCTCACTTCCCA
1921 AGACAACCCCCAGCTTCAGGTCCTCATGGGGAGGGGAGGGCACGTTCTTGACACATGGGAACTTCGCTCAGGAGGGCCTC
2001 CCCTTCCCCTCTCCCTCAGAGTTTTCACTGCCGTCTCGTCTTTAGAAAGCTGTTTGAATTCCCCCCGCCCCCAGTTTGGA
2081 CCGTGTAGATATAACTGGATATACGGATTTTTCTCTTTGTGCAGGCTTCTTATGCCGTTGGTATACAGGGCAGGAAAGAG
2161 AGGAATAAAGGGAGAGAGCAGTGTGGAAACCACGGTGGTTTTGCTTTGTTCTTACTAGGTTTTGGTGCCACCTTCCCTGC
2241 CTGCGCTTGTGCCCCCTCTCCTCCTTGGCACTGGCGGCCTCCTTGCCTCCCTTCCACCCGTGCTGCCATCCCGTGCCTGT
2321 CGTGTTGGTTCTTCACACGTGCTCTGTTCTCGGGGTTGTTCCATTCATGCCTTCTTGGAGGGTGAGGGTGGCTTGGGAAC
2401 CGACCCAGTGATCATGCCTACTTTCTTCTTTGTATCTCCCTCCTTCCCAGCCCACCCGGGCAGCAGACTCTGATGGAAGG
2481 AAGGTGCCGTAGGTGGGCTTTTAGAAACTAACGGGACTGGTTTTCAAAGCAGTTATCTTGGGAAACTGTTTATTCCAGCG
2561 ATGTGACTTTTTTCAGAATATTTCTTGGAATCATATTCAGAGTCTGGGGCTGTGTGTTGAGCAGCCTTAAGGATGCTAGA
2641 CACTCATTTAGTGCCCAGGGAGTCCAGCGAATGACGTCTGTGGCCAAGCGAGGTCTCAGGTGCAAAGCAAAAGGACCATT
2721 TAAAGTAAAATAGCTTGGATTCAATCATGTGACTTTTAAATTGGCTCAGAAAGCAATTTTGTAATTTCAGAGAGTGTTTT
2801 GAGCCATGGCCACGTTGTCATTGTGAGTCTATAGCTTGACTCCTTGGAGAACAATATTCATTTGGTTGTGGAGACTGATT
2881 TGCTGGGAGAAATCTGTCCTGTTACTTTCTGGTCATCCCAGGTTCTGACTTTTACCAGGGGCAAAAAAAAAAAAAGCAAG
2961 AGGGAGATAAATCCCATCTGTGAGTTTGTCTTATTGGCGCCTTTTTCCTCAGCTGTCTTCCAAGTATTATTTTTACTGTT
3041 AAAAAATTTTTTAAAAATGTGAAATGTAATGTTTTTACAGCAACAATATGAAATATATTTTATAAGGAATAAAATGGTAC
3121 CTTGTCTGATTTAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGgu 5'
            :|::|:|  |  ||||||  
Target 5' agGATGCTA--G--ACACTCat 3'
2630 - 2647 124.00 -8.00
2
miRNA  3' guUUGUGGUAA-CAGUGUGAGGu 5'
            || |  |||  |:|| |||| 
Target 5' caAAGA--ATTAATTACCCTCCg 3'
267 - 287 120.00 -9.30
3
miRNA  3' guuugugguaACAGUGUGAGgu 5'
                    ||| |||||:  
Target 5' ttggctaaggTGTAACACTTaa 3'
124 - 145 116.00 -8.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30530778 17 COSMIC
COSN30133020 35 COSMIC
COSN30171273 37 COSMIC
COSN7670140 38 COSMIC
COSN30149095 76 COSMIC
COSN19694064 100 COSMIC
COSN30494291 109 COSMIC
COSN28870598 167 COSMIC
COSN30696382 182 COSMIC
COSN31561720 182 COSMIC
COSN28861060 183 COSMIC
COSN26664761 244 COSMIC
COSN26465067 264 COSMIC
COSN15662022 326 COSMIC
COSN21011771 565 COSMIC
COSN6920439 760 COSMIC
COSN17023573 863 COSMIC
COSN8079046 1318 COSMIC
COSN5679449 1467 COSMIC
COSN24912019 1468 COSMIC
COSN25436188 1751 COSMIC
COSN17828233 2186 COSMIC
COSN31778679 2203 COSMIC
COSN15572421 2621 COSMIC
COSN17022331 2668 COSMIC
COSN26575538 2886 COSMIC
COSN20105342 2942 COSMIC
COSN28544236 2942 COSMIC
COSN31514917 2998 COSMIC
COSN30174514 3010 COSMIC
COSN26572891 3038 COSMIC
COSN31569786 3043 COSMIC
COSN31540014 3046 COSMIC
COSN21344246 3090 COSMIC
COSN31555138 3121 COSMIC
rs351779 1972 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs775161086 2 dbSNP
rs767056441 7 dbSNP
rs1283325968 10 dbSNP
rs759181714 12 dbSNP
rs1343350744 13 dbSNP
rs997018112 16 dbSNP
rs773982766 18 dbSNP
rs771005085 20 dbSNP
rs1352408645 24 dbSNP
rs1327675474 26 dbSNP
rs1042939525 29 dbSNP
rs1275817859 33 dbSNP
rs201612215 37 dbSNP
rs781030810 37 dbSNP
rs571284552 38 dbSNP
rs749169532 39 dbSNP
rs1237194085 41 dbSNP
rs1473327024 45 dbSNP
rs891431108 46 dbSNP
rs1406396958 51 dbSNP
rs1052735073 60 dbSNP
rs943728981 62 dbSNP
rs1362708119 66 dbSNP
rs1433024257 71 dbSNP
rs1356241205 74 dbSNP
rs1354015887 85 dbSNP
rs1038106563 86 dbSNP
rs551361179 87 dbSNP
rs1049500422 90 dbSNP
rs1240264945 96 dbSNP
rs1310734227 97 dbSNP
rs1345296067 98 dbSNP
rs932835615 100 dbSNP
rs939751865 100 dbSNP
rs1334564444 101 dbSNP
rs752292593 107 dbSNP
rs886874135 108 dbSNP
rs528076633 109 dbSNP
rs1364421945 116 dbSNP
rs1439561932 117 dbSNP
rs1161229654 120 dbSNP
rs1382323128 132 dbSNP
rs1421170466 133 dbSNP
rs1408400817 136 dbSNP
rs1045341135 139 dbSNP
rs1403147992 147 dbSNP
rs1415995492 151 dbSNP
rs1326547568 154 dbSNP
rs949757532 156 dbSNP
rs1447336589 158 dbSNP
rs1468520711 159 dbSNP
rs1333276869 161 dbSNP
rs915819245 163 dbSNP
rs146839651 166 dbSNP
rs371978332 167 dbSNP
rs1275113822 176 dbSNP
rs1346623824 177 dbSNP
rs961944836 178 dbSNP
rs935829029 182 dbSNP
rs182034550 183 dbSNP
rs1199890764 187 dbSNP
rs1268300860 193 dbSNP
rs960726335 208 dbSNP
rs977294366 214 dbSNP
rs1378445458 216 dbSNP
rs1479094283 218 dbSNP
rs1448998249 220 dbSNP
rs1002701480 231 dbSNP
rs1223638594 260 dbSNP
rs563295896 261 dbSNP
rs753466975 271 dbSNP
rs767806755 272 dbSNP
rs1021888736 278 dbSNP
rs1392160594 281 dbSNP
rs1021052575 283 dbSNP
rs1011467715 286 dbSNP
rs1224685403 287 dbSNP
rs891694159 292 dbSNP
rs1277168515 295 dbSNP
rs1317749179 299 dbSNP
rs1031575542 303 dbSNP
rs543313663 304 dbSNP
rs147774802 307 dbSNP
rs1007838416 312 dbSNP
rs986796763 318 dbSNP
rs1268061048 325 dbSNP
rs188954528 326 dbSNP
rs564955398 327 dbSNP
rs1172501073 331 dbSNP
rs545038442 336 dbSNP
rs1163768241 344 dbSNP
rs1401435844 347 dbSNP
rs1398434126 348 dbSNP
rs58103957 351 dbSNP
rs908782315 357 dbSNP
rs1340707271 361 dbSNP
rs992445230 367 dbSNP
rs939293947 368 dbSNP
rs1339228573 376 dbSNP
rs1244781061 382 dbSNP
rs148605418 385 dbSNP
rs1358622032 392 dbSNP
rs867206575 393 dbSNP
rs1285615621 394 dbSNP
rs1017492798 396 dbSNP
rs1253901424 398 dbSNP
rs368272157 401 dbSNP
rs553478473 406 dbSNP
rs1370083787 410 dbSNP
rs1417350588 421 dbSNP
rs1398665210 424 dbSNP
rs1404107733 425 dbSNP
rs1177015098 426 dbSNP
rs144407947 430 dbSNP
rs542746710 431 dbSNP
rs1197426213 432 dbSNP
rs1045488456 441 dbSNP
rs1300714387 458 dbSNP
rs1164030274 460 dbSNP
rs1200777175 460 dbSNP
rs1219142276 460 dbSNP
rs1254459679 460 dbSNP
rs1308540428 460 dbSNP
rs1314118010 460 dbSNP
rs1342384957 460 dbSNP
rs1342743375 460 dbSNP
rs1354496804 460 dbSNP
rs1395788474 460 dbSNP
rs1400593190 460 dbSNP
rs1437680812 460 dbSNP
rs1482826764 460 dbSNP
rs1491031079 460 dbSNP
rs398047144 460 dbSNP
rs58805614 460 dbSNP
rs949707358 460 dbSNP
rs968556048 461 dbSNP
rs980849295 461 dbSNP
rs1242981492 462 dbSNP
rs1331244191 463 dbSNP
rs71549657 468 dbSNP
rs1022400037 470 dbSNP
rs1242365777 474 dbSNP
rs149640048 485 dbSNP
rs1311772995 493 dbSNP
rs990374780 497 dbSNP
rs566541737 504 dbSNP
rs1055482370 505 dbSNP
rs935887273 508 dbSNP
rs925900350 510 dbSNP
rs977618191 511 dbSNP
rs945902196 518 dbSNP
rs1458745133 519 dbSNP
rs913980893 522 dbSNP
rs574188030 530 dbSNP
rs1411309591 531 dbSNP
rs1215880621 536 dbSNP
rs955341642 538 dbSNP
rs1177251511 539 dbSNP
rs1362041332 540 dbSNP
rs184268268 542 dbSNP
rs1170643716 544 dbSNP
rs1444484121 545 dbSNP
rs1291797228 548 dbSNP
rs1367170336 549 dbSNP
rs1428245578 562 dbSNP
rs1387632743 564 dbSNP
rs374002619 565 dbSNP
rs1360646226 567 dbSNP
rs975454069 568 dbSNP
rs1217757006 576 dbSNP
rs1337197063 577 dbSNP
rs1469210637 582 dbSNP
rs1403892934 586 dbSNP
rs1470277203 592 dbSNP
rs1231873845 597 dbSNP
rs769192019 599 dbSNP
rs1245555996 600 dbSNP
rs763448132 609 dbSNP
rs996588081 620 dbSNP
rs1420344666 625 dbSNP
rs1186107018 626 dbSNP
rs963256053 627 dbSNP
rs1192616921 633 dbSNP
rs898222026 634 dbSNP
rs1038152823 640 dbSNP
rs1193332248 645 dbSNP
rs1017191662 648 dbSNP
rs1056696488 658 dbSNP
rs1349434456 663 dbSNP
rs377492423 665 dbSNP
rs537754565 669 dbSNP
rs76623306 673 dbSNP
rs887303850 689 dbSNP
rs1023989057 699 dbSNP
rs186947810 700 dbSNP
rs773872989 706 dbSNP
rs775606608 711 dbSNP
rs1289032641 721 dbSNP
rs894237333 733 dbSNP
rs946765532 746 dbSNP
rs1207256289 756 dbSNP
rs1307521270 759 dbSNP
rs915301553 762 dbSNP
rs1264426991 768 dbSNP
rs534652382 769 dbSNP
rs6558055 783 dbSNP
rs1180678936 789 dbSNP
rs1413668054 797 dbSNP
rs769805574 798 dbSNP
rs904436016 799 dbSNP
rs1419258144 801 dbSNP
rs184458792 804 dbSNP
rs879717698 813 dbSNP
rs528933370 814 dbSNP
rs1283556776 819 dbSNP
rs1028264971 821 dbSNP
rs1247545972 822 dbSNP
rs777292999 823 dbSNP
rs1051616433 826 dbSNP
rs1216955573 829 dbSNP
rs1285892321 830 dbSNP
rs934042548 832 dbSNP
rs921369278 835 dbSNP
rs996904522 837 dbSNP
rs975783147 838 dbSNP
rs1483832463 839 dbSNP
rs1185506610 845 dbSNP
rs569853218 849 dbSNP
rs192142236 852 dbSNP
rs1169886837 854 dbSNP
rs1412566633 856 dbSNP
rs910109009 857 dbSNP
rs879298894 858 dbSNP
rs370612326 860 dbSNP
rs951648509 861 dbSNP
rs1024398439 870 dbSNP
rs781434683 871 dbSNP
rs1179424680 872 dbSNP
rs1481270989 874 dbSNP
rs1231796627 880 dbSNP
rs1003736620 881 dbSNP
rs1014382411 882 dbSNP
rs1324712145 884 dbSNP
rs1206187655 885 dbSNP
rs905428959 885 dbSNP
rs1457394158 886 dbSNP
rs770654402 913 dbSNP
rs1034141606 916 dbSNP
rs564070015 917 dbSNP
rs1477123285 919 dbSNP
rs1172206638 926 dbSNP
rs1425674441 929 dbSNP
rs189088693 935 dbSNP
rs1168499148 943 dbSNP
rs1000261658 944 dbSNP
rs1446917310 948 dbSNP
rs370721052 953 dbSNP
rs747489649 953 dbSNP
rs1329002468 955 dbSNP
rs775993210 964 dbSNP
rs141362637 965 dbSNP
rs746866002 968 dbSNP
rs1225690595 973 dbSNP
rs1010135165 977 dbSNP
rs1391872979 978 dbSNP
rs1372593010 982 dbSNP
rs1449921325 990 dbSNP
rs777676258 996 dbSNP
rs975395166 1003 dbSNP
rs1481315598 1006 dbSNP
rs962652900 1028 dbSNP
rs1466018326 1030 dbSNP
rs1051564684 1034 dbSNP
rs931839026 1041 dbSNP
rs1408000227 1042 dbSNP
rs921347942 1051 dbSNP
rs1323842093 1054 dbSNP
rs1303930892 1059 dbSNP
rs1016612634 1066 dbSNP
rs559448038 1085 dbSNP
rs1340290478 1090 dbSNP
rs1228862171 1091 dbSNP
rs1383744343 1092 dbSNP
rs1161799042 1097 dbSNP
rs113939990 1098 dbSNP
rs1420194451 1106 dbSNP
rs1292813795 1118 dbSNP
rs772160678 1121 dbSNP
rs1197338382 1143 dbSNP
rs909861400 1144 dbSNP
rs183711315 1147 dbSNP
rs1003704076 1148 dbSNP
rs376509006 1153 dbSNP
rs1195303514 1163 dbSNP
rs574014897 1163 dbSNP
rs1472190804 1178 dbSNP
rs529634517 1179 dbSNP
rs1045682222 1182 dbSNP
rs778574216 1184 dbSNP
rs992954212 1197 dbSNP
rs1297183835 1200 dbSNP
rs867067637 1202 dbSNP
rs1034495649 1203 dbSNP
rs1339181160 1206 dbSNP
rs1052405464 1207 dbSNP
rs999976511 1209 dbSNP
rs935359720 1211 dbSNP
rs76999715 1212 dbSNP
rs1238322578 1219 dbSNP
rs1304704314 1222 dbSNP
rs1285552802 1240 dbSNP
rs1225293609 1243 dbSNP
rs1486096000 1244 dbSNP
rs1206621947 1245 dbSNP
rs1019937250 1251 dbSNP
rs1441706239 1252 dbSNP
rs1184124177 1257 dbSNP
rs1437249561 1258 dbSNP
rs1284052411 1260 dbSNP
rs1009908003 1264 dbSNP
rs754500414 1269 dbSNP
rs1363975515 1272 dbSNP
rs1404546490 1277 dbSNP
rs544058351 1282 dbSNP
rs1388922180 1283 dbSNP
rs1051832545 1284 dbSNP
rs1385144420 1285 dbSNP
rs753458512 1287 dbSNP
rs1308844845 1288 dbSNP
rs766109111 1289 dbSNP
rs1240920891 1294 dbSNP
rs933815841 1302 dbSNP
rs1344016183 1306 dbSNP
rs1204277737 1307 dbSNP
rs1244858249 1308 dbSNP
rs1030285366 1314 dbSNP
rs1456090475 1317 dbSNP
rs578214793 1321 dbSNP
rs558526113 1328 dbSNP
rs534963374 1330 dbSNP
rs1177419047 1332 dbSNP
rs996396193 1333 dbSNP
rs1420439459 1334 dbSNP
rs900364217 1345 dbSNP
rs1481728283 1346 dbSNP
rs1376344119 1350 dbSNP
rs1469593050 1352 dbSNP
rs17058999 1353 dbSNP
rs1408890514 1354 dbSNP
rs941431788 1363 dbSNP
rs142877155 1367 dbSNP
rs148505795 1368 dbSNP
rs1263315337 1375 dbSNP
rs1330338965 1383 dbSNP
rs930013297 1385 dbSNP
rs1485391466 1389 dbSNP
rs569448597 1390 dbSNP
rs1205452994 1398 dbSNP
rs1251457092 1400 dbSNP
rs549446451 1401 dbSNP
rs1283990216 1409 dbSNP
rs1189147841 1411 dbSNP
rs1223056813 1416 dbSNP
rs539297301 1417 dbSNP
rs1297925454 1422 dbSNP
rs1383013922 1423 dbSNP
rs951058575 1427 dbSNP
rs1432088031 1431 dbSNP
rs1464580281 1435 dbSNP
rs570303696 1436 dbSNP
rs1319020825 1447 dbSNP
rs1471235218 1452 dbSNP
rs1463560084 1453 dbSNP
rs1292030475 1454 dbSNP
rs1407554765 1460 dbSNP
rs1405346767 1464 dbSNP
rs1284890176 1469 dbSNP
rs979356289 1471 dbSNP
rs968416617 1472 dbSNP
rs1296181706 1474 dbSNP
rs1464052777 1475 dbSNP
rs532755052 1480 dbSNP
rs1218693832 1483 dbSNP
rs1264515764 1485 dbSNP
rs1490391846 1487 dbSNP
rs1224243337 1492 dbSNP
rs1193398968 1498 dbSNP
rs1427601467 1512 dbSNP
rs1271574832 1516 dbSNP
rs61636661 1521 dbSNP
rs1185257898 1522 dbSNP
rs954398095 1527 dbSNP
rs144705002 1528 dbSNP
rs1162696121 1537 dbSNP
rs1365197647 1545 dbSNP
rs1011553560 1558 dbSNP
rs1262360198 1564 dbSNP
rs894042442 1566 dbSNP
rs996081419 1571 dbSNP
rs1201705775 1578 dbSNP
rs1289405727 1580 dbSNP
rs1342899522 1586 dbSNP
rs1031244885 1594 dbSNP
rs999475713 1597 dbSNP
rs559720710 1600 dbSNP
rs1051759390 1601 dbSNP
rs1247779960 1603 dbSNP
rs932094172 1604 dbSNP
rs1487528621 1614 dbSNP
rs775907109 1616 dbSNP
rs1016060483 1618 dbSNP
rs1243210356 1620 dbSNP
rs1180621897 1621 dbSNP
rs1487099762 1621 dbSNP
rs1295851625 1624 dbSNP
rs1384753494 1625 dbSNP
rs549142856 1627 dbSNP
rs529264360 1633 dbSNP
rs1445297011 1642 dbSNP
rs1006475513 1648 dbSNP
rs888523218 1651 dbSNP
rs1378657512 1661 dbSNP
rs376314921 1668 dbSNP
rs909792014 1671 dbSNP
rs1346740637 1686 dbSNP
rs190586715 1689 dbSNP
rs578222353 1690 dbSNP
rs1397968593 1697 dbSNP
rs1454075802 1707 dbSNP
rs1168044892 1711 dbSNP
rs1461164822 1712 dbSNP
rs927620612 1714 dbSNP
rs1285479006 1719 dbSNP
rs1057444833 1721 dbSNP
rs1202384688 1729 dbSNP
rs1243042524 1734 dbSNP
rs62502406 1738 dbSNP
rs1461853410 1739 dbSNP
rs374333186 1741 dbSNP
rs1444954522 1742 dbSNP
rs1469760437 1742 dbSNP
rs541730789 1743 dbSNP
rs1159350249 1744 dbSNP
rs1409950682 1751 dbSNP
rs1286575396 1753 dbSNP
rs1406662363 1753 dbSNP
rs1470675752 1753 dbSNP
rs35521239 1753 dbSNP
rs572614497 1754 dbSNP
rs1185278762 1757 dbSNP
rs1439534206 1758 dbSNP
rs1252738727 1759 dbSNP
rs1196525572 1761 dbSNP
rs1338828520 1762 dbSNP
rs1272679098 1763 dbSNP
rs969184994 1766 dbSNP
rs1376040382 1768 dbSNP
rs1202076943 1776 dbSNP
rs1222023473 1776 dbSNP
rs1324828098 1776 dbSNP
rs540798465 1776 dbSNP
rs1248468332 1777 dbSNP
rs1360565600 1779 dbSNP
rs1314836750 1780 dbSNP
rs1243231347 1787 dbSNP
rs1338111210 1790 dbSNP
rs1328946389 1792 dbSNP
rs1234779293 1793 dbSNP
rs11551968 1797 dbSNP
rs1479344284 1799 dbSNP
rs1198344854 1803 dbSNP
rs1481414534 1806 dbSNP
rs556011472 1807 dbSNP
rs1390246887 1812 dbSNP
rs1410013003 1816 dbSNP
rs1023831040 1817 dbSNP
rs1304531833 1820 dbSNP
rs1347707034 1822 dbSNP
rs1424938654 1823 dbSNP
rs1403506422 1826 dbSNP
rs535135846 1831 dbSNP
rs575631834 1832 dbSNP
rs1161303543 1838 dbSNP
rs958482830 1840 dbSNP
rs1471116275 1841 dbSNP
rs747189058 1842 dbSNP
rs937584521 1849 dbSNP
rs555883358 1851 dbSNP
rs1338859473 1852 dbSNP
rs1196406156 1853 dbSNP
rs1364243148 1854 dbSNP
rs1489900858 1856 dbSNP
rs368117221 1857 dbSNP
rs978918061 1860 dbSNP
rs1249749726 1863 dbSNP
rs947569002 1882 dbSNP
rs1190989120 1888 dbSNP
rs912980665 1899 dbSNP
rs1372392993 1900 dbSNP
rs1030306329 1908 dbSNP
rs1169084633 1910 dbSNP
rs1411188105 1913 dbSNP
rs1423681382 1917 dbSNP
rs1303354653 1921 dbSNP
rs996601945 1922 dbSNP
rs1407103125 1926 dbSNP
rs988591710 1927 dbSNP
rs1326292424 1928 dbSNP
rs1228247264 1931 dbSNP
rs1289602811 1938 dbSNP
rs1272066713 1940 dbSNP
rs900571709 1942 dbSNP
rs1245586359 1961 dbSNP
rs1353300560 1963 dbSNP
rs954460292 1964 dbSNP
rs1203112234 1968 dbSNP
rs1260975101 1971 dbSNP
rs351779 1972 dbSNP
rs748130610 1978 dbSNP
rs561358551 1985 dbSNP
rs1443446259 1989 dbSNP
rs1284696007 1998 dbSNP
rs888280682 2007 dbSNP
rs1046980364 2011 dbSNP
rs929890048 2014 dbSNP
rs1383325275 2019 dbSNP
rs1320820902 2021 dbSNP
rs754849353 2031 dbSNP
rs187296113 2032 dbSNP
rs964626044 2033 dbSNP
rs1321179800 2035 dbSNP
rs1316026820 2037 dbSNP
rs182660254 2038 dbSNP
rs190081216 2043 dbSNP
rs950577349 2047 dbSNP
rs958161284 2049 dbSNP
rs1261130128 2052 dbSNP
rs924120594 2059 dbSNP
rs1183601440 2063 dbSNP
rs755856507 2066 dbSNP
rs1417006137 2070 dbSNP
rs1180628016 2079 dbSNP
rs994183198 2082 dbSNP
rs1162042375 2083 dbSNP
rs749988293 2088 dbSNP
rs996184524 2089 dbSNP
rs764443933 2092 dbSNP
rs1381429997 2093 dbSNP
rs1389950017 2096 dbSNP
rs1246282704 2104 dbSNP
rs1001947409 2105 dbSNP
rs568291591 2107 dbSNP
rs1016309083 2119 dbSNP
rs906104907 2129 dbSNP
rs1197048208 2135 dbSNP
rs573839824 2136 dbSNP
rs947515814 2137 dbSNP
rs888251132 2141 dbSNP
rs1285430487 2143 dbSNP
rs1194911350 2146 dbSNP
rs1208620270 2148 dbSNP
rs913376530 2151 dbSNP
rs12543288 2153 dbSNP
rs1053302052 2156 dbSNP
rs1264452618 2161 dbSNP
rs1184715787 2166 dbSNP
rs1427826084 2167 dbSNP
rs933020139 2170 dbSNP
rs1177772807 2173 dbSNP
rs1361019300 2177 dbSNP
rs1046948346 2181 dbSNP
rs994027041 2183 dbSNP
rs147435122 2193 dbSNP
rs556520128 2194 dbSNP
rs1326770504 2198 dbSNP
rs529311072 2203 dbSNP
rs1281218827 2214 dbSNP
rs1046781457 2215 dbSNP
rs947743945 2227 dbSNP
rs747863074 2231 dbSNP
rs1455562896 2239 dbSNP
rs996689451 2242 dbSNP
rs765778013 2244 dbSNP
rs1225999074 2246 dbSNP
rs1251545124 2254 dbSNP
rs923715713 2266 dbSNP
rs868315105 2275 dbSNP
rs1267287193 2277 dbSNP
rs563630001 2294 dbSNP
rs1490283241 2296 dbSNP
rs1200834143 2297 dbSNP
rs984702158 2298 dbSNP
rs351780 2299 dbSNP
rs954908492 2300 dbSNP
rs1431924350 2302 dbSNP
rs1470313841 2303 dbSNP
rs1026080078 2304 dbSNP
rs5890409 2309 dbSNP
rs923544503 2309 dbSNP
rs1013375108 2312 dbSNP
rs377704587 2313 dbSNP
rs564683224 2321 dbSNP
rs1295752492 2322 dbSNP
rs1476536584 2338 dbSNP
rs541299182 2346 dbSNP
rs1188397850 2349 dbSNP
rs142790362 2351 dbSNP
rs1043078351 2352 dbSNP
rs577053145 2367 dbSNP
rs892057889 2371 dbSNP
rs1204887368 2379 dbSNP
rs1186430887 2381 dbSNP
rs1311061876 2382 dbSNP
rs138830631 2401 dbSNP
rs1215934143 2412 dbSNP
rs1384792924 2414 dbSNP
rs369588515 2420 dbSNP
rs993996151 2428 dbSNP
rs750803080 2431 dbSNP
rs1339726510 2432 dbSNP
rs906406833 2438 dbSNP
rs766354005 2439 dbSNP
rs1432552500 2449 dbSNP
rs1046272055 2451 dbSNP
rs542502710 2452 dbSNP
rs375572740 2457 dbSNP
rs1053881785 2458 dbSNP
rs1382978020 2458 dbSNP
rs1229668291 2459 dbSNP
rs923043522 2466 dbSNP
rs936368817 2469 dbSNP
rs575641955 2470 dbSNP
rs1451867074 2472 dbSNP
rs1261784770 2483 dbSNP
rs1466325182 2487 dbSNP
rs1181772184 2488 dbSNP
rs1042158395 2489 dbSNP
rs1445537654 2492 dbSNP
rs1183803890 2501 dbSNP
rs934342019 2501 dbSNP
rs943037383 2512 dbSNP
rs773530685 2513 dbSNP
rs1390669229 2519 dbSNP
rs1411855017 2520 dbSNP
rs1335574559 2535 dbSNP
rs974991811 2537 dbSNP
rs1449838683 2550 dbSNP
rs984439006 2559 dbSNP
rs1168211771 2574 dbSNP
rs1447992203 2578 dbSNP
rs1223526539 2585 dbSNP
rs111598269 2590 dbSNP
rs73668441 2595 dbSNP
rs984779442 2602 dbSNP
rs1483234845 2604 dbSNP
rs1235227323 2606 dbSNP
rs1262652982 2615 dbSNP
rs1443056453 2617 dbSNP
rs991943413 2618 dbSNP
rs1212566604 2625 dbSNP
rs1231358389 2630 dbSNP
rs748005980 2631 dbSNP
rs1469460391 2633 dbSNP
rs779687176 2639 dbSNP
rs1177498403 2654 dbSNP
rs1413896379 2655 dbSNP
rs960860858 2662 dbSNP
rs950730929 2665 dbSNP
rs1406223540 2668 dbSNP
rs1268925341 2671 dbSNP
rs1415645363 2673 dbSNP
rs1326469497 2675 dbSNP
rs1437912937 2676 dbSNP
rs1441941549 2687 dbSNP
rs1309091671 2689 dbSNP
rs1352701410 2695 dbSNP
rs7009041 2697 dbSNP
rs980620421 2709 dbSNP
rs1345849072 2713 dbSNP
rs1225758833 2714 dbSNP
rs1220972040 2717 dbSNP
rs1271149071 2727 dbSNP
rs1361286651 2730 dbSNP
rs553807091 2738 dbSNP
rs1206117120 2746 dbSNP
rs1315519862 2749 dbSNP
rs1227652273 2755 dbSNP
rs1253765160 2759 dbSNP
rs1489783203 2771 dbSNP
rs1198641548 2772 dbSNP
rs1021599252 2783 dbSNP
rs1478732068 2795 dbSNP
rs533793085 2797 dbSNP
rs1418163305 2798 dbSNP
rs35205485 2808 dbSNP
rs568233973 2813 dbSNP
rs1309446658 2816 dbSNP
rs970552611 2821 dbSNP
rs1403453954 2824 dbSNP
rs1011594384 2841 dbSNP
rs892046210 2845 dbSNP
rs753418963 2848 dbSNP
rs1439213247 2849 dbSNP
rs1268548368 2850 dbSNP
rs997677052 2852 dbSNP
rs1371267662 2855 dbSNP
rs1357036974 2860 dbSNP
rs1025242504 2865 dbSNP
rs1267977100 2866 dbSNP
rs1453325391 2871 dbSNP
rs1190923027 2887 dbSNP
rs1307608502 2892 dbSNP
rs1012143429 2900 dbSNP
rs1449509921 2902 dbSNP
rs1387441576 2905 dbSNP
rs1170130245 2909 dbSNP
rs902039179 2910 dbSNP
rs558501798 2912 dbSNP
rs1163415213 2920 dbSNP
rs1391888083 2922 dbSNP
rs1412171461 2928 dbSNP
rs1179481047 2929 dbSNP
rs1407617670 2932 dbSNP
rs11136045 2934 dbSNP
rs1250472429 2935 dbSNP
rs1202551573 2936 dbSNP
rs749997560 2938 dbSNP
rs1325960937 2939 dbSNP
rs1203446201 2941 dbSNP
rs374501939 2942 dbSNP
rs760887741 2942 dbSNP
rs895041382 2947 dbSNP
rs71740200 2949 dbSNP
rs1308997660 2954 dbSNP
rs1224300653 2955 dbSNP
rs11392432 2956 dbSNP
rs113930926 2956 dbSNP
rs116611887 2956 dbSNP
rs34926783 2956 dbSNP
rs200747051 2957 dbSNP
rs1189875566 2969 dbSNP
rs779693304 2973 dbSNP
rs1039216336 2974 dbSNP
rs943088569 2977 dbSNP
rs1240893438 2985 dbSNP
rs887536707 2988 dbSNP
rs986540148 2998 dbSNP
rs141703000 2999 dbSNP
rs929008186 3000 dbSNP
rs902190268 3003 dbSNP
rs1042084999 3010 dbSNP
rs933082061 3030 dbSNP
rs919171769 3033 dbSNP
rs1408213527 3034 dbSNP
rs1367759741 3036 dbSNP
rs1322720687 3045 dbSNP
rs538090320 3046 dbSNP
rs1457672300 3047 dbSNP
rs570086475 3052 dbSNP
rs1313672646 3053 dbSNP
rs1342077295 3053 dbSNP
rs1236557485 3067 dbSNP
rs1278904373 3078 dbSNP
rs1161868724 3079 dbSNP
rs1401842276 3086 dbSNP
rs1260756733 3109 dbSNP
rs1129330 3110 dbSNP
rs1460458185 3116 dbSNP
rs1257773529 3120 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Huh-7 , HepG2 , SK-Hep-1
Location of target site 3'UTR
Original Description (Extracted from the article) ... PBF, an miR-122 target, is upregulated in patients with CHB and HCC. ...

- Li C; Wang Y; Wang S; Wu B; Hao J; Fan H; et al., 2013, Journal of virology.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuuguGGUAACAGUGUGAGGu 5'
                ||||| |||||||:| 
Target 5' tgcgttCCATTTTCACACTTCa 3'
1 - 22
Article - Li C; Wang Y; Wang S; Wu B; Hao J; Fan H; et al.
- Journal of virology, 2013
As the most abundant liver-specific microRNA, miR-122 is involved in diverse aspects of hepatic function and neoplastic transformation. Our previous study showed that miR-122 levels are significantly decreased in hepatitis B virus (HBV)-infected patients, which may facilitate viral replication and persistence (S. Wang, L. Qiu, X. Yan, W. Jin, Y. Wang, L. Chen, E. Wu, X. Ye, G. F. Gao, F. Wang, Y. Chen, Z. Duan, and S. Meng, Hepatology 55:730-741, 2012). Loss of miR-122 expression in patients with hepatitis B enhances hepatitis B virus replication through cyclin G1-modulated P53 activity.). In this study, we provide evidence that all HBV mRNAs harboring an miR-122 complementary site act as sponges to bind and sequester endogenous miR-122, indicating that the highly redundant HBV transcripts are involved in HBV-mediated miR-122 suppression. We next identified pituitary tumor-transforming gene 1 (PTTG1) binding factor (PBF) as a target of miR-122 and demonstrated that HBV replication causes an obvious increase in PBF levels. Furthermore, we observed that the miR-122 levels were decreased and PBF was upregulated in chronic hepatitis B (CHB) and hepatocellular carcinoma (HCC). Overexpression and knockdown studies both revealed that PBF enhances proliferation and invasion of HCC cells, and silencing PBF resulted in a dramatic reduction of HCC tumor growth in vivo. Mechanistic analysis demonstrated that PBF interacts with PTTG1 and facilitates PTTG1 nuclear translocation, subsequently increasing its transcriptional activities. Therefore, we identified a novel HBV mRNA-miR-122-PBF regulatory pathway that facilitates malignant hepatocyte growth and invasion in CHB which may contribute to CHB-induced HCC development and progression. Our work underscores the reciprocal interplay of host miRNA sequestration and depletion by viral mRNAs, which may contribute to chronic-infection-related cancer.
LinkOut: [PMID: 23221562]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*