miRTarBase - #MIRT006801 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HMGA1   
Synonyms HMG-R, HMGA1A, HMGIY
Description high mobility group AT-hook 1
Transcript NM_002131   
Other Transcripts NM_145899 , NM_145901 , NM_145902 , NM_145903 , NM_145905   
Expression
Putative miRNA Targets on HMGA1
3'UTR of HMGA1
(miRNA target sites are highlighted)
>HMGA1|NM_002131|3'UTR
   1 CCCATGCGTGCCGCCTGCTCCTCACTGGAGGAGCAGCTTCCTTCTGGGACTGGACAGCTTTGCTCCGCTCCCACCGCCCC
  81 CACCCCTTCCCCAGGCCCACCATCACCACCGCCTCTGGCCGCCACCCCCATCTTCCACCTGTGCCCTCACCACCACACTA
 161 CACAGCACACCAGCCGCTGCAGGGCTCCCATGGGCTGAGTGGGGAGCAGTTTTCCCCTGGCCTCAGTTCCCAGCTCCCCC
 241 CGCCCACCCACGCATACACACATGCCCTCCTGGACAAGGCTAACATCCCACTTAGCCGCACCCTGCACCTGCTGCGTCCC
 321 CACTCCCTTGGTGGTGGGGACATTGCTCTCTGGGCTTTTGGTTTGGGGGCGCCCTCTCTGCTCCTTCACTGTTCCCTCTG
 401 GCTTCCCATAGTGGGGCCTGGGAGGGTTCCCCTGGCCTTAAAAGGGGCCCAAGCCCCATCTCATCCTGGCACGCCCTACT
 481 CCACTGCCCTGGCAGCAGCAGGTGTGGCCAATGGAGGGGGGTGCTGGCCCCCAGGATTCCCCCAGCCAAACTGTCTTTGT
 561 CACCACGTGGGGCTCACTTTTCATCCTTCCCCAACTTCCCTAGTCCCCGTACTAGGTTGGACAGCCCCCTTCGGTTACAG
 641 GAAGGCAGGAGGGGTGAGTCCCCTACTCCCTCTTCACTGTGGCCACAGCCCCCTTGCCCTCCGCCTGGGATCTGAGTACA
 721 TATTGTGGTGATGGAGATGCAGTCACTTATTGTCCAGGTGAGGCCCAAGAGCCCTGTGGCCGCCACCTGAGGTGGGCTGG
 801 GGCTGCTCCCCTAACCCTACTTTGCTTCCGCCACTCAGCCATTTCCCCCTCCTCAGATGGGGCACCAATAACAAGGAGCT
 881 CACCCTGCCCGCTCCCAACCCCCCTCCTGCTCCTCCCTGCCCCCCAAGGTTCTGGTTCCATTTTTCCTCTGTTCACAAAC
 961 TACCTCTGGACAGTTGTGTTGTTTTTTGTTCAATGTTCCATTCTTCGACATCCGTCATTGCTGCTGCTACCAGCGCCAAA
1041 TGTTCATCCTCATTGCCTCCTGTTCTGCCCACGATCCCCTCCCCCAAGATACTCTTTGTGGGGAAGAGGGGCTGGGGCAT
1121 GGCAGGCTGGGTGACCGACTACCCCAGTCCCAGGGAAGGTGGGGCCCTGCCCCTAGGATGCTGCAGCAGAGTGAGCAAGG
1201 GGGCCCAAATCGACCATAAAGGGTGTAGGGGCCACCTCCTCCCCCTGTTCTGTTGGGGAGGGGTAGCCATGATTTGTCCC
1281 AGCCTGGGGCTCCCTCTCTGGTTTCCTATTTGCAGTTACTTGAATAAAAAAAATATCCTTTTCTGGAAAAAAAAAAAAAA
1361 AAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              | ||:| || ||||||| 
Target 5' cgacATCCGTCAT-TGCTGCTg 3'
1006 - 1026 157.00 -16.10
2
miRNA  3' guguuUGGUAAUAC-ACGACGau 5'
               :||  || | ||||||  
Target 5' gccctGCCCCTAGGATGCTGCag 3'
1164 - 1186 129.00 -10.30
3
miRNA  3' guGUUUGGUA-AUACACGACGau 5'
            |: ||| |  |  ||||||  
Target 5' gcCGCACCCTGCACCTGCTGCgt 3'
295 - 317 128.00 -10.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM5958929 19 COSMIC
COSM9394511 32 COSMIC
COSM9847894 77 COSMIC
COSM4590304 83 COSMIC
COSM9815441 83 COSMIC
COSM7319397 88 COSMIC
COSM9848484 95 COSMIC
COSM5996992 121 COSMIC
COSM1621547 145 COSMIC
COSM5512246 252 COSMIC
COSM1621548 303 COSMIC
COSM3784535 323 COSMIC
COSM8575563 423 COSMIC
COSM9371603 437 COSMIC
COSM7259299 479 COSMIC
COSM6994698 606 COSMIC
COSM9563391 610 COSMIC
COSM4595312 636 COSMIC
COSM8434511 640 COSMIC
COSM8413371 690 COSMIC
COSM5505187 704 COSMIC
COSM7608380 719 COSMIC
COSN31560009 741 COSMIC
COSN6319046 751 COSMIC
COSN30540261 765 COSMIC
COSN31484480 770 COSMIC
COSN19703020 783 COSMIC
COSN17078344 830 COSMIC
COSN9781128 837 COSMIC
COSN26466050 947 COSMIC
COSN5629450 1096 COSMIC
COSN15974416 1108 COSMIC
COSN23391964 1299 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs773643332 5 dbSNP
rs1331211392 6 dbSNP
rs761589586 6 dbSNP
rs771892031 6 dbSNP
rs1229061581 7 dbSNP
rs766017108 8 dbSNP
rs373998742 9 dbSNP
rs1204261651 12 dbSNP
rs1264855109 13 dbSNP
rs759283212 14 dbSNP
rs1463388860 16 dbSNP
rs1204322201 19 dbSNP
rs1166110075 25 dbSNP
rs1368910793 26 dbSNP
rs1014079471 27 dbSNP
rs1262781153 28 dbSNP
rs1430492798 29 dbSNP
rs772826618 37 dbSNP
rs1428706480 39 dbSNP
rs1480780305 41 dbSNP
rs1179211858 42 dbSNP
rs1410319655 46 dbSNP
rs1453569920 48 dbSNP
rs1020054814 49 dbSNP
rs760323577 51 dbSNP
rs1289812670 52 dbSNP
rs1385270172 53 dbSNP
rs1383535196 54 dbSNP
rs1300859564 55 dbSNP
rs1183607020 56 dbSNP
rs1344328358 59 dbSNP
rs967127881 62 dbSNP
rs1285181377 63 dbSNP
rs999874702 64 dbSNP
rs1238115758 65 dbSNP
rs764643694 66 dbSNP
rs752273694 67 dbSNP
rs758268707 68 dbSNP
rs777697282 72 dbSNP
rs1268360569 74 dbSNP
rs751303861 75 dbSNP
rs757029639 76 dbSNP
rs557830810 77 dbSNP
rs781077291 78 dbSNP
rs1418971707 79 dbSNP
rs975410620 80 dbSNP
rs749447567 81 dbSNP
rs573143874 82 dbSNP
rs2780219 83 dbSNP
rs1427970886 84 dbSNP
rs1309911046 86 dbSNP
rs772659198 87 dbSNP
rs773888708 88 dbSNP
rs1304402049 89 dbSNP
rs1371159868 90 dbSNP
rs747591630 91 dbSNP
rs1390774543 93 dbSNP
rs1410721908 94 dbSNP
rs771177977 97 dbSNP
rs1318506570 99 dbSNP
rs1242257957 102 dbSNP
rs1451986512 103 dbSNP
rs1252011428 105 dbSNP
rs777114762 106 dbSNP
rs759111273 111 dbSNP
rs1360431420 112 dbSNP
rs1224870101 114 dbSNP
rs1249681940 121 dbSNP
rs574265056 122 dbSNP
rs1178286914 124 dbSNP
rs1253217889 125 dbSNP
rs1422496930 126 dbSNP
rs1183366422 127 dbSNP
rs1384273363 128 dbSNP
rs774927228 131 dbSNP
rs544847907 132 dbSNP
rs562344845 136 dbSNP
rs1460982488 140 dbSNP
rs1298688930 142 dbSNP
rs375019390 143 dbSNP
rs763975213 144 dbSNP
rs751465310 145 dbSNP
rs1383864381 149 dbSNP
rs1248470113 150 dbSNP
rs757264395 153 dbSNP
rs1307006927 155 dbSNP
rs1205294447 161 dbSNP
rs1253667799 162 dbSNP
rs767201678 170 dbSNP
rs940773178 176 dbSNP
rs368392959 177 dbSNP
rs545165232 180 dbSNP
rs560272359 181 dbSNP
rs1393918642 185 dbSNP
rs1416871355 186 dbSNP
rs1427465709 189 dbSNP
rs1455320149 190 dbSNP
rs527509695 191 dbSNP
rs1356247573 195 dbSNP
rs1468144180 197 dbSNP
rs1441505701 198 dbSNP
rs1335946017 199 dbSNP
rs1406582743 200 dbSNP
rs1454326479 202 dbSNP
rs758521351 204 dbSNP
rs949956883 208 dbSNP
rs1215283838 210 dbSNP
rs1297789891 221 dbSNP
rs548928964 222 dbSNP
rs1223477780 223 dbSNP
rs1485423938 225 dbSNP
rs1281111403 226 dbSNP
rs1264222950 229 dbSNP
rs903002981 230 dbSNP
rs1462943894 234 dbSNP
rs766225310 236 dbSNP
rs1207199789 237 dbSNP
rs1240065433 238 dbSNP
rs561103673 242 dbSNP
rs188629081 243 dbSNP
rs1421052727 246 dbSNP
rs1479147123 247 dbSNP
rs1175635525 248 dbSNP
rs1032730483 252 dbSNP
rs550002991 253 dbSNP
rs1397244084 254 dbSNP
rs753821579 256 dbSNP
rs1315927413 258 dbSNP
rs746261014 262 dbSNP
rs568959785 263 dbSNP
rs539441976 266 dbSNP
rs568187720 267 dbSNP
rs551496296 270 dbSNP
rs1284544528 271 dbSNP
rs1326269589 272 dbSNP
rs996565455 275 dbSNP
rs1435999890 277 dbSNP
rs1283978364 279 dbSNP
rs566606124 286 dbSNP
rs1216102966 287 dbSNP
rs1264798809 288 dbSNP
rs1361113836 292 dbSNP
rs1169285970 293 dbSNP
rs1489671889 294 dbSNP
rs1198062321 295 dbSNP
rs1269571609 296 dbSNP
rs773969172 298 dbSNP
rs767493668 299 dbSNP
rs1363679539 302 dbSNP
rs1258057250 303 dbSNP
rs534263154 304 dbSNP
rs987694238 305 dbSNP
rs759200105 312 dbSNP
rs1161566143 313 dbSNP
rs1363925599 315 dbSNP
rs1015102202 316 dbSNP
rs1303801600 317 dbSNP
rs1309697093 321 dbSNP
rs779484794 322 dbSNP
rs962169002 323 dbSNP
rs1279446561 324 dbSNP
rs1374514753 325 dbSNP
rs1225819529 327 dbSNP
rs1287799732 328 dbSNP
rs1280369488 329 dbSNP
rs1356788145 331 dbSNP
rs1461471303 335 dbSNP
rs1207923197 337 dbSNP
rs1245920399 339 dbSNP
rs1462167022 340 dbSNP
rs756006004 341 dbSNP
rs555690284 343 dbSNP
rs1460690370 345 dbSNP
rs796229715 346 dbSNP
rs1179584626 351 dbSNP
rs1232177977 353 dbSNP
rs766317647 354 dbSNP
rs11557700 356 dbSNP
rs752946938 362 dbSNP
rs142532394 365 dbSNP
rs1189947495 366 dbSNP
rs1383656772 367 dbSNP
rs758753247 370 dbSNP
rs777999103 371 dbSNP
rs1367559819 372 dbSNP
rs765108256 374 dbSNP
rs937401866 375 dbSNP
rs1336866794 376 dbSNP
rs1444865654 377 dbSNP
rs1313346504 382 dbSNP
rs1213487596 389 dbSNP
rs1335884980 390 dbSNP
rs1275646332 392 dbSNP
rs991533061 394 dbSNP
rs747119801 395 dbSNP
rs1244834863 397 dbSNP
rs757650780 403 dbSNP
rs1357868589 409 dbSNP
rs567797839 416 dbSNP
rs1272281739 417 dbSNP
rs1438290543 423 dbSNP
rs1378694243 424 dbSNP
rs1170885266 425 dbSNP
rs1200356634 426 dbSNP
rs781735212 428 dbSNP
rs538200876 430 dbSNP
rs1184444409 433 dbSNP
rs1370358014 435 dbSNP
rs1474506249 436 dbSNP
rs1323417720 441 dbSNP
rs1167376993 443 dbSNP
rs542568545 447 dbSNP
rs1412156502 450 dbSNP
rs949991297 451 dbSNP
rs746174678 456 dbSNP
rs1041578049 457 dbSNP
rs1363093979 462 dbSNP
rs1453766151 464 dbSNP
rs192998300 467 dbSNP
rs145863026 473 dbSNP
rs544998673 474 dbSNP
rs748922683 479 dbSNP
rs1469243015 481 dbSNP
rs1255271653 484 dbSNP
rs1339415052 485 dbSNP
rs1054693268 486 dbSNP
rs1350595760 487 dbSNP
rs1261103191 490 dbSNP
rs1460714731 494 dbSNP
rs1437904716 496 dbSNP
rs1204044050 501 dbSNP
rs1258579925 502 dbSNP
rs1319631244 504 dbSNP
rs1261783776 505 dbSNP
rs899604561 509 dbSNP
rs996988029 512 dbSNP
rs1029348192 516 dbSNP
rs1230500897 516 dbSNP
rs1445473398 517 dbSNP
rs1192685853 518 dbSNP
rs553772855 519 dbSNP
rs1289356876 522 dbSNP
rs1393344987 528 dbSNP
rs1323851926 531 dbSNP
rs1009160718 535 dbSNP
rs1397047983 539 dbSNP
rs1478807012 540 dbSNP
rs773666182 544 dbSNP
rs962604943 545 dbSNP
rs995037436 546 dbSNP
rs1470543404 547 dbSNP
rs1304923963 550 dbSNP
rs761400065 552 dbSNP
rs1380189748 553 dbSNP
rs1277550684 555 dbSNP
rs1317145382 556 dbSNP
rs1348196807 556 dbSNP
rs138006458 556 dbSNP
rs372041536 559 dbSNP
rs542666872 567 dbSNP
rs1281365376 568 dbSNP
rs11759910 569 dbSNP
rs752656250 571 dbSNP
rs1223942804 573 dbSNP
rs755474994 578 dbSNP
rs773171532 582 dbSNP
rs1204781257 583 dbSNP
rs1262627439 585 dbSNP
rs991957499 586 dbSNP
rs111748592 590 dbSNP
rs1268845000 593 dbSNP
rs1341589521 595 dbSNP
rs1481035248 596 dbSNP
rs1178804510 597 dbSNP
rs766266312 599 dbSNP
rs753754619 600 dbSNP
rs1166347548 601 dbSNP
rs1157647754 602 dbSNP
rs1360752226 605 dbSNP
rs1421061543 606 dbSNP
rs1300721007 607 dbSNP
rs1344271929 608 dbSNP
rs73419171 609 dbSNP
rs1303236518 610 dbSNP
rs372626790 620 dbSNP
rs1209563083 622 dbSNP
rs924573061 624 dbSNP
rs564825523 625 dbSNP
rs758593266 625 dbSNP
rs1238049182 626 dbSNP
rs757385064 627 dbSNP
rs1356090550 629 dbSNP
rs781165347 630 dbSNP
rs750904896 631 dbSNP
rs1054325412 632 dbSNP
rs1490521966 633 dbSNP
rs756668884 634 dbSNP
rs1150783 636 dbSNP
rs184349426 637 dbSNP
rs1418918946 639 dbSNP
rs749655115 646 dbSNP
rs1050797831 647 dbSNP
rs566486075 649 dbSNP
rs1409591117 653 dbSNP
rs1421162492 654 dbSNP
rs890870444 655 dbSNP
rs1364415129 656 dbSNP
rs1003919932 657 dbSNP
rs1457920597 660 dbSNP
rs1295284467 661 dbSNP
rs1408851095 662 dbSNP
rs375191354 664 dbSNP
rs779344492 666 dbSNP
rs1390649688 669 dbSNP
rs1309681119 670 dbSNP
rs1378769682 671 dbSNP
rs1244092864 674 dbSNP
rs1314546273 680 dbSNP
rs1360272284 682 dbSNP
rs1223846710 683 dbSNP
rs1250190345 687 dbSNP
rs527784847 689 dbSNP
rs747796445 690 dbSNP
rs1240450151 691 dbSNP
rs1443093890 697 dbSNP
rs549451959 703 dbSNP
rs145849177 704 dbSNP
rs538419054 706 dbSNP
rs1166256577 708 dbSNP
rs1371319384 710 dbSNP
rs1461436537 717 dbSNP
rs1211498946 720 dbSNP
rs1331910863 723 dbSNP
rs556924403 724 dbSNP
rs1271161001 725 dbSNP
rs777177218 725 dbSNP
rs1450118690 727 dbSNP
rs1336391651 730 dbSNP
rs1490551444 733 dbSNP
rs1380160844 739 dbSNP
rs1230140973 741 dbSNP
rs959088803 742 dbSNP
rs571991698 750 dbSNP
rs770999104 751 dbSNP
rs1219787246 753 dbSNP
rs1260485223 756 dbSNP
rs1460303905 757 dbSNP
rs563499231 762 dbSNP
rs1242186183 763 dbSNP
rs1483358119 767 dbSNP
rs1394204570 769 dbSNP
rs115929552 774 dbSNP
rs1259098295 777 dbSNP
rs1427342636 780 dbSNP
rs759430066 782 dbSNP
rs1156336595 783 dbSNP
rs144540283 786 dbSNP
rs1334493771 787 dbSNP
rs553813535 788 dbSNP
rs1180089991 797 dbSNP
rs371593640 801 dbSNP
rs1366822318 804 dbSNP
rs1221951902 809 dbSNP
rs990451434 814 dbSNP
rs1473877752 817 dbSNP
rs542405032 818 dbSNP
rs1351456495 821 dbSNP
rs2780218 825 dbSNP
rs2780217 826 dbSNP
rs932510371 828 dbSNP
rs1164058111 830 dbSNP
rs1419179458 831 dbSNP
rs537322378 837 dbSNP
rs1439006898 844 dbSNP
rs1343972827 845 dbSNP
rs1318220107 847 dbSNP
rs1310380725 848 dbSNP
rs1371755964 850 dbSNP
rs912338027 852 dbSNP
rs939736146 855 dbSNP
rs1394028695 857 dbSNP
rs1191586611 858 dbSNP
rs1240329452 862 dbSNP
rs1489329414 862 dbSNP
rs150982394 863 dbSNP
rs1214983562 864 dbSNP
rs1310491365 868 dbSNP
rs1036709872 873 dbSNP
rs1208735941 873 dbSNP
rs1448228994 879 dbSNP
rs1302186499 881 dbSNP
rs1221342075 884 dbSNP
rs1269290624 885 dbSNP
rs1270196283 886 dbSNP
rs898130342 888 dbSNP
rs1362937741 891 dbSNP
rs73419174 892 dbSNP
rs1374495084 897 dbSNP
rs1049745196 899 dbSNP
rs894721330 902 dbSNP
rs1013080232 903 dbSNP
rs1230388588 904 dbSNP
rs10947489 905 dbSNP
rs1478110198 908 dbSNP
rs1265196575 918 dbSNP
rs1185929641 920 dbSNP
rs1485373965 922 dbSNP
rs1256851945 927 dbSNP
rs907325763 928 dbSNP
rs564711337 930 dbSNP
rs1306179458 937 dbSNP
rs200521247 947 dbSNP
rs998867948 950 dbSNP
rs532281980 970 dbSNP
rs201779449 976 dbSNP
rs1219553727 977 dbSNP
rs1342967715 978 dbSNP
rs1208683436 979 dbSNP
rs1254094588 982 dbSNP
rs1412431575 982 dbSNP
rs1377804914 985 dbSNP
rs140481117 994 dbSNP
rs1188487514 997 dbSNP
rs540878901 1004 dbSNP
rs560158096 1007 dbSNP
rs527673741 1008 dbSNP
rs549245060 1011 dbSNP
rs149013137 1015 dbSNP
rs1185668147 1018 dbSNP
rs750856264 1022 dbSNP
rs1256938715 1030 dbSNP
rs1391190725 1035 dbSNP
rs986661229 1036 dbSNP
rs912368599 1038 dbSNP
rs939768653 1045 dbSNP
rs1434600337 1050 dbSNP
rs1171340564 1053 dbSNP
rs1403705803 1058 dbSNP
rs1396173989 1062 dbSNP
rs1322791829 1064 dbSNP
rs1317160117 1069 dbSNP
rs17038619 1073 dbSNP
rs1436864649 1074 dbSNP
rs1298014583 1078 dbSNP
rs879589872 1085 dbSNP
rs919612284 1088 dbSNP
rs147082929 1093 dbSNP
rs1054798737 1095 dbSNP
rs1368911696 1095 dbSNP
rs1417343306 1098 dbSNP
rs571830852 1099 dbSNP
rs1201147220 1104 dbSNP
rs1459418864 1108 dbSNP
rs1251541210 1117 dbSNP
rs1283797854 1127 dbSNP
rs991588253 1133 dbSNP
rs1213390861 1134 dbSNP
rs1489111752 1137 dbSNP
rs948960263 1138 dbSNP
rs1190786535 1144 dbSNP
rs1314583842 1150 dbSNP
rs1308161803 1155 dbSNP
rs1248961791 1159 dbSNP
rs1378582500 1161 dbSNP
rs915649170 1161 dbSNP
rs1454154546 1165 dbSNP
rs1045889755 1171 dbSNP
rs907358404 1172 dbSNP
rs539344658 1174 dbSNP
rs998899261 1188 dbSNP
rs548106813 1193 dbSNP
rs1032205407 1194 dbSNP
rs375086146 1197 dbSNP
rs1379922715 1201 dbSNP
rs1466086669 1207 dbSNP
rs1150782 1208 dbSNP
rs1012014555 1211 dbSNP
rs1193429112 1212 dbSNP
rs41269030 1213 dbSNP
rs772035549 1226 dbSNP
rs1270146273 1229 dbSNP
rs1196988716 1230 dbSNP
rs1458431537 1235 dbSNP
rs1484639376 1238 dbSNP
rs1284701543 1239 dbSNP
rs554398196 1246 dbSNP
rs3197257 1251 dbSNP
rs1393436175 1254 dbSNP
rs1232319039 1261 dbSNP
rs1274343165 1264 dbSNP
rs879394138 1268 dbSNP
rs576111157 1270 dbSNP
rs1359750789 1271 dbSNP
rs536715260 1272 dbSNP
rs961165424 1279 dbSNP
rs1172183849 1283 dbSNP
rs1379717805 1284 dbSNP
rs1238268806 1286 dbSNP
rs780882116 1289 dbSNP
rs1191411376 1294 dbSNP
rs2797 1296 dbSNP
rs972585859 1300 dbSNP
rs919712523 1309 dbSNP
rs1193776147 1315 dbSNP
rs1277793552 1318 dbSNP
rs1488970005 1318 dbSNP
rs1199520328 1323 dbSNP
rs1257548693 1326 dbSNP
rs931062273 1326 dbSNP
rs558332304 1327 dbSNP
rs1269084103 1334 dbSNP
rs576622661 1337 dbSNP
rs777562460 1339 dbSNP
rs1401969353 1345 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions MEG-01
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... This analysis identified miR-15ab, miR-16,miR-26ab, miR-196ab and Let-7a as potential HMGA-targeting miRNAs. Interestingly, the targeting sites of these HMGA-targeting miRNAs on the 3'UTR of HMGA1 and HMGA2 are extremely conserved in human, mouse and rat. ...

- Palmieri D; D'Angelo D; Valentino T; De et al., 2012, Oncogene.

Article - Palmieri D; D'Angelo D; Valentino T; De et al.
- Oncogene, 2012
Previous studies have demonstrated that high mobility group A proteins have a critical role on the onset of human pituitary adenomas. Indeed, both high mobility group A (HMGA) genes are overexpressed in pituitary adenomas, and consistently transgenic mice overexpressing either the Hmga1 or the Hmga2 gene develop mixed growth hormone/prolactin (GH-PRL)-secreting pituitary adenomas. Trisomy of chromosome 12, where HMGA2 is located, and/or amplification of the HMGA2 gene locus account for the HMGA2 overexpression in most human prolactinomas. Conversely, HMGA1 overexpression is not associated to any rearrangement or amplification of the HMGA1 locus. We have first identified micro RNAs (miRNAs) able to target both HMGA1 and HMGA2 messenger RNAs. Then, all of these miRNAs have been found downregulated in pituitary adenomas of different histotypes, compared with normal pituitary. Interestingly, their downregulation was also observed in nonfunctioning pituitary adenomas where HMGA2 overexpression is not associated to any alteration of the HMGA2 locus. Functional studies show that all these HMGA-targeting miRNAs inhibit the proliferation of the rat pituitary adenoma cell line GH3. Therefore, these results indicate that the downregulation of the miRNAs able to target the HMGA genes could contribute to increase HMGA protein levels in human pituitary adenomas, and then to pituitary tumorigenesis.
LinkOut: [PMID: 22139073]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*