miRTarBase - #MIRT006181 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MN1   
Synonyms MGCR, MGCR1, MGCR1-PEN, dJ353E16.2
Description MN1 proto-oncogene, transcriptional regulator
Transcript NM_002430   
Expression
Putative miRNA Targets on MN1
3'UTR of MN1
(miRNA target sites are highlighted)
>MN1|NM_002430|3'UTR
   1 ATGACAAGAAAGATCCCCTCCTCTACCAGGCCCTTCCTCTCCCCCTGTCTGTTTCCTTCCCCCTCAACCTTACCCCACCC
  81 CTCTGTTAATTTGAAAGGGCCACTATTGCTGAGTGGATGAGTTTTTTTTTTTTCTCTAGGTTGGTACCTGCTTAGTGGCA
 161 TATGGACCGGAAAGGGTTAATTTAAAGGGGGGGAACCTCAAAAGTTTTTTTAAAAAAGAAACTTGTCTGCCACAGTATGT
 241 TACCAGTGTTAACCCTTCTGCAGTTAGCAAACTTTTGCTTAAGCCTTTTTCCTCTAGATACTCCCCATGTTTCGGTAATC
 321 TTGGCATACATTTTTTAGATGACCTCTTTCCTTGTTTTGTTTTCATGCTGCTGTATGTCCAAGTATTGTTATTTCATAAT
 401 AAGACAAGAGTTGCTTTCTTTTTTATTCTTTTTCCTTTTCTTACCCCCTCCCCTTTTATTTTCTTTTTGCTTTGTTCACT
 481 GCTTATTAAAATGGAAATCCTGGAGAATAGTAGTTCTGGAATATTGCCGGGTGAAAGTCCAATTGTCATCACAATGTTAT
 561 ATATTGACACCCCAGTGTCATCAGTCAGGCAGGAGCCAAACAATGAATGCCCCTCTTAGGTATTCCGCCTGGGATTTTGT
 641 TTTGTCTGTTCCCTAAGAAAATATATTTTCATTCCTGCAAACACAGTGCTCAGCCTTCAGTTCCCTTCCACTTGAGTTCT
 721 CTCTTCTCCTGCTGGAAGCCGCCCCTCTCTGCGATGGACGTGAGGACGTGTCCAGCTCTGCTCTGTGGGAAGGAGTTGGA
 801 ATGTTCGACAGCAGTGTTTTCTCTCCTTTTCTGGGCCTCCTCGCAAATGCCCAGGCCCTGCATTTTCACGCTGTGCTAAG
 881 CAGCCTTTGGTCTGCATGGGGGATGGTGTGCTCCCAGCCTGCAGTCTTTGGAGCAAGGCTGCTGCCCGTGCCTTGGGTGC
 961 TGGAGTTGGAGGAGGCTGTTCTCAGCCCTTTCCCTTTTCTGAAAGCTGTTCCTGGCCGGGCATCCCAGGGAAGAAGGAGG
1041 GGACTGCGTGTATCTCCTCCACCTCTCCCATTCCATCCCCAGTCCAGCCTGGGCAACCCCACCCCTGGGAGGGATGAGGC
1121 ACCCTCTTGCTCAGCCTGCTCAGCCTTCTCTGAGCCTTTGCAGGGATCTGCAGACTCCTGAGGGCTAGAGGACAGAGAAA
1201 GAGAATAGAATGAAATGACTTTGATTCCTGCGCCTTTTAGTTTTGAACTCTGGAATTCCTCTGCCCCCTCCCCAACATTT
1281 TTTTGGAATCTCACCCTGTTGCAAAACTAGAGCCATGTCCCAAGCATCTCACAAAGGAATAACTGCTCTGAGCAGAGATG
1361 AGTGGTGGTTGGCAGGGGCAGGCAACTTTGGGTGCTGCTGATGCCTGCAAAAGCCATTTATGGCTTGTGGTGGGGGGCAC
1441 ATAGATTCCCCGGTGGGTTAGACAGGAAGTAACTGATATCACTTCACCCAAATATATAACCGTGATGGTTATCTATTTAA
1521 TTTCAGTTTTTGTTAACGAGCGTGTCTTACTAAAACGCTCCACTTTGAGCTCCCCCACCCCCTCCAGGTCCTCAGAGTTT
1601 GCAGATCTGGGCTTTCTAAAGCAAGTGACCTGAAGGCTCTGGGCTCACCATACAACACCCACGTTGTTTATTTCAAAGAA
1681 CTTTTCAGCGAAGGGAGAGGAGCTTTCAGAAAAACCTCACTCTTTCCCCTCCCTTCTCCCCTCTTTCCTTCTGCCGGTCC
1761 TTTTGGCTGGGGTCTGAGTCTGCGGTTCTCGCCTGGGCAGTCTTGACGAGGAGCAAACCCCGCCTTCAGAGGGCAGACAA
1841 AGCAGGTGGCATGAATTGATCAGCGAGAAAGGTGTGAGCCGAGGCAGTTCCTGCGTTCTGCTACAAAAGGAATGGAAAGG
1921 GAAGGGAATTTCCCCCCACCATGGGCTGTGGGAGAGTTGACCGTATTCTGGGCAAGACTCCATGACCCCTCTGATTCTGC
2001 AGTGTACAGCTGTTTGAGAGCCTCATCATTTTACTTTTGAAACAGGAATGATTTCTCCTTAATTGCTTAAGGCCGGGGAG
2081 CAAAGTGTCTTAACTTCTGTCTTTGACTTTCCCAGCGTTGAGTCATCAACACTTTGCCAATTAGCTCATGGTCCTGGCAA
2161 CCTCAGAAACCCCTGAAGTTTTAAAAACTTTCTCGCTCCCCACGACCCCAGAATGAAACAGCTTTAAAAATAGCCTTAAG
2241 CAAAAGGATGTTATTTCATTAAATTTGGTTTAATGGAAAGAATAAAAGTAAATGAAAAACACACCCTACACACTAGACTC
2321 CGAACACTGGTAATCAGTACTGCATAGCAAACTCTTTGGGAAAGAAAACGAAAATGTTATTGCACATGTAAAATATGAAA
2401 ACTTAACTCTGCTGTGTGTTAGGCAATCCTGTAATCTTTTTTGACTCTTAAAAGAAATTCATTTCTGAAATGCTTGGTTG
2481 GAAGACTGTGACAATAGCTCATGAAATTGAGTGTTATTTTTTTCTTTCTTTTTTAAAAAAATATGTAAAGTGCAGTCTTC
2561 TGTATTCCTGCATATTGTATATACCTGTATATGTTTTCCTGAGCAGTTAAATAACAATAAATATGACGTTAATGGTGAAA
2641 AAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUG--GUAAUACACGACGAu 5'
            ||::|  | ||: |||||||| 
Target 5' ggCAGGCAACTTTGGGTGCTGCTg 3'
1377 - 1400 162.00 -18.70
2
miRNA  3' guguuuGGUAAUA-CACGACGAu 5'
                :::|| |  ||||||| 
Target 5' cttgttTTGTTTTCATGCTGCTg 3'
351 - 373 144.00 -10.70
3
miRNA  3' guGUUUGGUAAUAC-ACGACGau 5'
            :::| ||  | | ||||||  
Target 5' ttTGGAGCA--AGGCTGCTGCcc 3'
927 - 947 124.00 -11.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26984827 21 COSMIC
COSN31492783 51 COSMIC
COSN30487420 55 COSMIC
COSN17168873 59 COSMIC
COSN28846381 59 COSMIC
COSN30502361 64 COSMIC
COSN16131175 83 COSMIC
COSN29015321 121 COSMIC
COSN27378493 122 COSMIC
COSN30123171 132 COSMIC
COSN20117318 133 COSMIC
COSN25941327 133 COSMIC
COSN27366142 212 COSMIC
COSN19575689 241 COSMIC
COSN23527988 297 COSMIC
COSN25106921 325 COSMIC
COSN31959842 413 COSMIC
COSN31961958 661 COSMIC
COSN14862813 714 COSMIC
COSN26655971 824 COSMIC
COSN19190021 896 COSMIC
COSN211220 1200 COSMIC
COSN32063737 1212 COSMIC
COSN8997235 1376 COSMIC
COSN26240538 1607 COSMIC
COSN16005692 1642 COSMIC
COSN21684948 1651 COSMIC
COSN9163542 1881 COSMIC
COSN8997234 2117 COSMIC
COSN26602314 2163 COSMIC
COSN26566592 2219 COSMIC
COSN28437811 2226 COSMIC
COSN31485555 2262 COSMIC
COSN31583370 2333 COSMIC
COSN31483288 2536 COSMIC
COSN31606838 2540 COSMIC
COSN31522114 2592 COSMIC
COSN30540830 2593 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1319217281 5 dbSNP
rs757952218 7 dbSNP
rs1383744163 12 dbSNP
rs773674938 14 dbSNP
rs1445710929 15 dbSNP
rs376684410 17 dbSNP
rs538423426 18 dbSNP
rs754613102 24 dbSNP
rs1238735751 25 dbSNP
rs1292118268 26 dbSNP
rs1373845723 27 dbSNP
rs1299637563 28 dbSNP
rs980987291 30 dbSNP
rs1212077368 31 dbSNP
rs1241216175 31 dbSNP
rs754170598 33 dbSNP
rs766702643 41 dbSNP
rs751011817 43 dbSNP
rs762012410 44 dbSNP
rs548324895 45 dbSNP
rs942746927 46 dbSNP
rs1359984523 47 dbSNP
rs1158099520 51 dbSNP
rs1356807266 53 dbSNP
rs1283317656 56 dbSNP
rs915279944 62 dbSNP
rs989884543 63 dbSNP
rs1447158693 68 dbSNP
rs1374547980 72 dbSNP
rs1445457283 76 dbSNP
rs1242972195 77 dbSNP
rs956645390 79 dbSNP
rs1242180193 82 dbSNP
rs1264429840 84 dbSNP
rs1321361279 97 dbSNP
rs1334648415 102 dbSNP
rs1434424360 107 dbSNP
rs1030865973 113 dbSNP
rs1456798689 117 dbSNP
rs1178179235 120 dbSNP
rs45463901 121 dbSNP
rs200292564 122 dbSNP
rs566668379 127 dbSNP
rs551552845 132 dbSNP
rs28501997 133 dbSNP
rs1308468851 134 dbSNP
rs1403592037 134 dbSNP
rs377485634 134 dbSNP
rs11379447 135 dbSNP
rs752475755 135 dbSNP
rs1161818634 136 dbSNP
rs1403726022 136 dbSNP
rs1393751063 144 dbSNP
rs1311598273 156 dbSNP
rs533084659 158 dbSNP
rs1023852114 161 dbSNP
rs45583937 168 dbSNP
rs753288042 169 dbSNP
rs1374410637 187 dbSNP
rs765470413 188 dbSNP
rs183597798 189 dbSNP
rs992280372 193 dbSNP
rs1004536204 194 dbSNP
rs528862786 194 dbSNP
rs138215345 204 dbSNP
rs951564851 206 dbSNP
rs1025699266 211 dbSNP
rs1477334835 212 dbSNP
rs1176747301 215 dbSNP
rs995349372 219 dbSNP
rs898295310 222 dbSNP
rs886077896 231 dbSNP
rs1018244863 238 dbSNP
rs1288951559 241 dbSNP
rs1006805687 265 dbSNP
rs1207821035 268 dbSNP
rs890816562 278 dbSNP
rs1051219435 284 dbSNP
rs1302609618 290 dbSNP
rs1314427834 291 dbSNP
rs1231244514 292 dbSNP
rs1341784381 294 dbSNP
rs1488625642 305 dbSNP
rs539932327 307 dbSNP
rs1219079618 309 dbSNP
rs150439563 313 dbSNP
rs1040269791 314 dbSNP
rs945701257 316 dbSNP
rs1427229133 317 dbSNP
rs1431365267 327 dbSNP
rs891544519 328 dbSNP
rs1174815415 330 dbSNP
rs1054171136 333 dbSNP
rs1420911334 337 dbSNP
rs1363131803 338 dbSNP
rs1305633729 343 dbSNP
rs936880689 346 dbSNP
rs1294488159 360 dbSNP
rs1370438389 364 dbSNP
rs1385609006 365 dbSNP
rs1303229744 367 dbSNP
rs925445623 373 dbSNP
rs915293559 378 dbSNP
rs1437885773 380 dbSNP
rs1331016998 387 dbSNP
rs989468871 396 dbSNP
rs1222114133 397 dbSNP
rs935349776 405 dbSNP
rs1192934706 408 dbSNP
rs923922569 408 dbSNP
rs1238667078 416 dbSNP
rs981999083 418 dbSNP
rs1156279505 434 dbSNP
rs971018799 444 dbSNP
rs1371508928 448 dbSNP
rs981016979 457 dbSNP
rs907375902 458 dbSNP
rs1168855856 460 dbSNP
rs1023505762 462 dbSNP
rs1045967675 463 dbSNP
rs1166405134 471 dbSNP
rs1351990942 475 dbSNP
rs45517941 491 dbSNP
rs1325854714 504 dbSNP
rs1387859721 512 dbSNP
rs1378271209 514 dbSNP
rs41277853 519 dbSNP
rs1449138953 522 dbSNP
rs1194944852 523 dbSNP
rs918154125 528 dbSNP
rs1246025946 529 dbSNP
rs992581004 531 dbSNP
rs1258684141 533 dbSNP
rs951380004 542 dbSNP
rs567831892 550 dbSNP
rs974154600 554 dbSNP
rs1472804289 559 dbSNP
rs1275009278 562 dbSNP
rs1411120450 570 dbSNP
rs1474460627 571 dbSNP
rs1204708709 572 dbSNP
rs1164623288 580 dbSNP
rs1401745109 583 dbSNP
rs1329836401 589 dbSNP
rs886109044 589 dbSNP
rs1354016185 596 dbSNP
rs1448795377 609 dbSNP
rs962572354 619 dbSNP
rs1018108670 620 dbSNP
rs41277851 626 dbSNP
rs111847128 627 dbSNP
rs891049330 627 dbSNP
rs1319669875 629 dbSNP
rs1196683754 639 dbSNP
rs1272159359 648 dbSNP
rs1219860862 655 dbSNP
rs1211594797 656 dbSNP
rs753943916 657 dbSNP
rs1039896605 661 dbSNP
rs376435864 674 dbSNP
rs1010318015 679 dbSNP
rs1474673171 682 dbSNP
rs891457372 685 dbSNP
rs45498506 690 dbSNP
rs1424803264 691 dbSNP
rs1478968007 695 dbSNP
rs1444924197 700 dbSNP
rs528276867 710 dbSNP
rs1351495933 711 dbSNP
rs893947741 712 dbSNP
rs999889166 722 dbSNP
rs904053250 723 dbSNP
rs1415157762 731 dbSNP
rs1408905917 738 dbSNP
rs1045228169 739 dbSNP
rs557605198 740 dbSNP
rs918173037 741 dbSNP
rs1298963784 742 dbSNP
rs923953545 743 dbSNP
rs1013501356 752 dbSNP
rs541893236 753 dbSNP
rs574765813 755 dbSNP
rs141654379 759 dbSNP
rs1345594198 760 dbSNP
rs535125225 763 dbSNP
rs570916198 764 dbSNP
rs974185707 767 dbSNP
rs139193986 768 dbSNP
rs1216889165 769 dbSNP
rs1423799264 770 dbSNP
rs146816063 774 dbSNP
rs569083040 781 dbSNP
rs1489485977 787 dbSNP
rs983206591 788 dbSNP
rs867449729 793 dbSNP
rs1242085400 802 dbSNP
rs985297160 803 dbSNP
rs1174771874 806 dbSNP
rs1393355891 810 dbSNP
rs1434145690 816 dbSNP
rs955193105 823 dbSNP
rs1362667236 830 dbSNP
rs186354250 832 dbSNP
rs1030032075 839 dbSNP
rs528925237 843 dbSNP
rs567717379 850 dbSNP
rs1317371770 861 dbSNP
rs1010145349 866 dbSNP
rs955927055 870 dbSNP
rs770244751 877 dbSNP
rs1181172712 899 dbSNP
rs760733476 900 dbSNP
rs1301074563 905 dbSNP
rs182108513 907 dbSNP
rs1211034863 908 dbSNP
rs905634244 911 dbSNP
rs1311697097 912 dbSNP
rs1287773240 913 dbSNP
rs528183804 920 dbSNP
rs1226046682 934 dbSNP
rs1044091299 947 dbSNP
rs373570532 948 dbSNP
rs189765612 955 dbSNP
rs1057153142 958 dbSNP
rs893971356 964 dbSNP
rs1179302851 965 dbSNP
rs1226909082 969 dbSNP
rs879061018 970 dbSNP
rs930233213 974 dbSNP
rs6519725 978 dbSNP
rs1158151315 988 dbSNP
rs1391190632 1001 dbSNP
rs1406836876 1006 dbSNP
rs1038390090 1018 dbSNP
rs1370123469 1020 dbSNP
rs1046408890 1021 dbSNP
rs1310802522 1040 dbSNP
rs763985497 1045 dbSNP
rs949424609 1047 dbSNP
rs563866931 1048 dbSNP
rs1211985721 1056 dbSNP
rs1055454323 1060 dbSNP
rs1331618568 1062 dbSNP
rs941923985 1063 dbSNP
rs1199416091 1069 dbSNP
rs909078906 1074 dbSNP
rs983280956 1088 dbSNP
rs1181398068 1092 dbSNP
rs542504822 1100 dbSNP
rs950471584 1102 dbSNP
rs911310523 1103 dbSNP
rs370029353 1113 dbSNP
rs376047808 1118 dbSNP
rs765286235 1129 dbSNP
rs985537597 1137 dbSNP
rs1454209058 1141 dbSNP
rs955418272 1142 dbSNP
rs762833908 1143 dbSNP
rs922446161 1161 dbSNP
rs1313054629 1166 dbSNP
rs1341861645 1169 dbSNP
rs1235603043 1174 dbSNP
rs1412587692 1199 dbSNP
rs1291804899 1200 dbSNP
rs975829337 1203 dbSNP
rs1199824785 1206 dbSNP
rs1253555397 1212 dbSNP
rs1471504025 1224 dbSNP
rs1415629748 1227 dbSNP
rs575137643 1231 dbSNP
rs6005607 1232 dbSNP
rs1032862186 1236 dbSNP
rs1483047468 1237 dbSNP
rs1478004621 1253 dbSNP
rs1172763537 1266 dbSNP
rs1371248539 1267 dbSNP
rs1461084659 1270 dbSNP
rs1302915488 1272 dbSNP
rs999825688 1274 dbSNP
rs969656963 1278 dbSNP
rs1403981530 1289 dbSNP
rs1235866905 1294 dbSNP
rs1022711026 1296 dbSNP
rs541400049 1297 dbSNP
rs17476776 1298 dbSNP
rs1207333577 1301 dbSNP
rs1337424956 1314 dbSNP
rs1256649630 1317 dbSNP
rs551878959 1336 dbSNP
rs1209037425 1342 dbSNP
rs559069347 1345 dbSNP
rs897417432 1352 dbSNP
rs1195537362 1353 dbSNP
rs1259659074 1354 dbSNP
rs1427840168 1357 dbSNP
rs1038591376 1360 dbSNP
rs1378868665 1368 dbSNP
rs151125627 1369 dbSNP
rs902657829 1376 dbSNP
rs1360736489 1378 dbSNP
rs1046481441 1388 dbSNP
rs45605632 1398 dbSNP
rs1360559962 1414 dbSNP
rs1281971568 1426 dbSNP
rs887421454 1427 dbSNP
rs1050298405 1429 dbSNP
rs895145942 1430 dbSNP
rs1055124564 1431 dbSNP
rs934071504 1432 dbSNP
rs1232154657 1434 dbSNP
rs1354678767 1437 dbSNP
rs1047472418 1438 dbSNP
rs532851580 1451 dbSNP
rs988674702 1452 dbSNP
rs1485385655 1454 dbSNP
rs1191734972 1459 dbSNP
rs1254759361 1462 dbSNP
rs934454778 1466 dbSNP
rs887676131 1467 dbSNP
rs925876241 1476 dbSNP
rs1380599187 1478 dbSNP
rs1421125265 1480 dbSNP
rs1156417644 1483 dbSNP
rs978647444 1483 dbSNP
rs866030804 1485 dbSNP
rs535746042 1491 dbSNP
rs1022575648 1493 dbSNP
rs1294683059 1494 dbSNP
rs993012903 1502 dbSNP
rs1438886512 1504 dbSNP
rs1047625350 1515 dbSNP
rs1165205312 1527 dbSNP
rs1377672570 1527 dbSNP
rs1423513317 1534 dbSNP
rs1411859154 1537 dbSNP
rs1190711165 1538 dbSNP
rs1316142262 1540 dbSNP
rs959837578 1541 dbSNP
rs923077079 1547 dbSNP
rs1026447308 1552 dbSNP
rs559592936 1556 dbSNP
rs769417654 1557 dbSNP
rs1017229745 1565 dbSNP
rs1247434683 1570 dbSNP
rs745680315 1573 dbSNP
rs41277849 1576 dbSNP
rs142497819 1577 dbSNP
rs1221262183 1578 dbSNP
rs933956024 1580 dbSNP
rs554922651 1581 dbSNP
rs1053573768 1586 dbSNP
rs1287337934 1589 dbSNP
rs958309858 1594 dbSNP
rs1230093690 1595 dbSNP
rs546155970 1597 dbSNP
rs925782940 1611 dbSNP
rs1365307844 1612 dbSNP
rs978678703 1616 dbSNP
rs948624232 1630 dbSNP
rs1294888504 1633 dbSNP
rs1332333691 1640 dbSNP
rs1232607089 1642 dbSNP
rs915792461 1646 dbSNP
rs978287679 1647 dbSNP
rs1201788900 1648 dbSNP
rs1232020212 1648 dbSNP
rs1483365538 1649 dbSNP
rs45451602 1650 dbSNP
rs1420484542 1653 dbSNP
rs1025106980 1658 dbSNP
rs570241659 1662 dbSNP
rs1014121295 1663 dbSNP
rs895227617 1664 dbSNP
rs1293936073 1665 dbSNP
rs1411764369 1667 dbSNP
rs1326925516 1670 dbSNP
rs1354221723 1671 dbSNP
rs1449049101 1675 dbSNP
rs371015212 1678 dbSNP
rs1347856218 1686 dbSNP
rs45619034 1689 dbSNP
rs531057439 1694 dbSNP
rs373520564 1695 dbSNP
rs1271697347 1699 dbSNP
rs1312199511 1712 dbSNP
rs1017094464 1715 dbSNP
rs1186736648 1722 dbSNP
rs1484925262 1739 dbSNP
rs1005699326 1742 dbSNP
rs1243263925 1747 dbSNP
rs5752632 1755 dbSNP
rs1166605191 1756 dbSNP
rs530431242 1759 dbSNP
rs975965072 1760 dbSNP
rs1435374142 1765 dbSNP
rs1175781289 1772 dbSNP
rs1028959410 1775 dbSNP
rs1373836894 1776 dbSNP
rs1487721854 1781 dbSNP
rs998199456 1783 dbSNP
rs901167534 1784 dbSNP
rs929170025 1790 dbSNP
rs181801322 1791 dbSNP
rs1273348352 1792 dbSNP
rs1269486170 1793 dbSNP
rs148836234 1807 dbSNP
rs1313403306 1808 dbSNP
rs1346695389 1809 dbSNP
rs1040200504 1810 dbSNP
rs904390566 1817 dbSNP
rs577291927 1821 dbSNP
rs190562335 1822 dbSNP
rs990275535 1833 dbSNP
rs948529925 1845 dbSNP
rs915831171 1864 dbSNP
rs1195578284 1865 dbSNP
rs935685165 1880 dbSNP
rs532206175 1881 dbSNP
rs978320401 1887 dbSNP
rs569454948 1891 dbSNP
rs938393334 1892 dbSNP
rs758005567 1894 dbSNP
rs1317617909 1895 dbSNP
rs748546950 1901 dbSNP
rs1175991874 1905 dbSNP
rs1431875031 1909 dbSNP
rs868709649 1910 dbSNP
rs145466523 1915 dbSNP
rs1369532347 1920 dbSNP
rs1240426607 1924 dbSNP
rs1353314165 1932 dbSNP
rs1183322141 1933 dbSNP
rs1483202443 1938 dbSNP
rs186824463 1946 dbSNP
rs1469296499 1950 dbSNP
rs959750164 1959 dbSNP
rs1453832291 1962 dbSNP
rs1182833693 1963 dbSNP
rs1033783361 1967 dbSNP
rs1468448517 1968 dbSNP
rs963140639 1978 dbSNP
rs1418556453 1987 dbSNP
rs908933235 1989 dbSNP
rs776317787 1993 dbSNP
rs1026286637 2001 dbSNP
rs993448938 2003 dbSNP
rs779483397 2005 dbSNP
rs1333590143 2009 dbSNP
rs954314846 2011 dbSNP
rs41277847 2018 dbSNP
rs535261762 2022 dbSNP
rs1232529596 2027 dbSNP
rs117679774 2036 dbSNP
rs1335826145 2040 dbSNP
rs998836708 2052 dbSNP
rs1235712714 2057 dbSNP
rs965438235 2058 dbSNP
rs1040637035 2063 dbSNP
rs1253010373 2071 dbSNP
rs1032073198 2074 dbSNP
rs1181283693 2075 dbSNP
rs888921006 2081 dbSNP
rs1476040427 2085 dbSNP
rs998791186 2087 dbSNP
rs1162731694 2098 dbSNP
rs1054213351 2115 dbSNP
rs1462085431 2116 dbSNP
rs904631623 2117 dbSNP
rs1349603336 2118 dbSNP
rs1306426587 2123 dbSNP
rs1041361373 2126 dbSNP
rs552828118 2132 dbSNP
rs534356667 2138 dbSNP
rs1043081019 2139 dbSNP
rs549450628 2140 dbSNP
rs992791850 2143 dbSNP
rs369499761 2147 dbSNP
rs867191920 2148 dbSNP
rs1321641349 2152 dbSNP
rs1414794818 2161 dbSNP
rs1228316689 2163 dbSNP
rs537158553 2173 dbSNP
rs1472483910 2185 dbSNP
rs1337449485 2190 dbSNP
rs894290064 2192 dbSNP
rs569613787 2195 dbSNP
rs1486557880 2201 dbSNP
rs767532248 2203 dbSNP
rs1256801664 2204 dbSNP
rs754288899 2207 dbSNP
rs1195160682 2208 dbSNP
rs548785183 2215 dbSNP
rs1199364381 2219 dbSNP
rs1459953563 2226 dbSNP
rs1269970297 2231 dbSNP
rs1209225051 2233 dbSNP
rs1461001631 2238 dbSNP
rs1173937351 2246 dbSNP
rs1328238861 2246 dbSNP
rs575803233 2248 dbSNP
rs530292649 2250 dbSNP
rs1378821184 2251 dbSNP
rs1383269046 2268 dbSNP
rs5762340 2279 dbSNP
rs1247341709 2283 dbSNP
rs1341272412 2292 dbSNP
rs1312150086 2296 dbSNP
rs548102688 2300 dbSNP
rs532600841 2302 dbSNP
rs985876016 2309 dbSNP
rs1390866005 2311 dbSNP
rs565286951 2312 dbSNP
rs1227731260 2321 dbSNP
rs1321828192 2322 dbSNP
rs954272588 2337 dbSNP
rs921421247 2345 dbSNP
rs1208929025 2352 dbSNP
rs1255198728 2357 dbSNP
rs774260216 2360 dbSNP
rs768281411 2369 dbSNP
rs1007848560 2370 dbSNP
rs888961384 2374 dbSNP
rs1193713973 2383 dbSNP
rs966034717 2383 dbSNP
rs1473601497 2388 dbSNP
rs1358977777 2396 dbSNP
rs1452197955 2396 dbSNP
rs1368651210 2410 dbSNP
rs1186346676 2414 dbSNP
rs1383395085 2417 dbSNP
rs752479356 2428 dbSNP
rs543413370 2431 dbSNP
rs6005606 2436 dbSNP
rs1031856930 2442 dbSNP
rs576497527 2443 dbSNP
rs561198256 2446 dbSNP
rs1249283679 2451 dbSNP
rs369504730 2453 dbSNP
rs1189142857 2454 dbSNP
rs1054210086 2455 dbSNP
rs1373201739 2458 dbSNP
rs1464382985 2458 dbSNP
rs1232409010 2476 dbSNP
rs1281957527 2482 dbSNP
rs977403177 2494 dbSNP
rs1317350655 2500 dbSNP
rs968685232 2507 dbSNP
rs765964141 2514 dbSNP
rs77660482 2516 dbSNP
rs1464380302 2517 dbSNP
rs76859781 2517 dbSNP
rs3216407 2524 dbSNP
rs397840242 2524 dbSNP
rs398081717 2524 dbSNP
rs1211381956 2526 dbSNP
rs1356738910 2528 dbSNP
rs1190293332 2532 dbSNP
rs1021696020 2534 dbSNP
rs1243983695 2535 dbSNP
rs1041392772 2540 dbSNP
rs949761780 2542 dbSNP
rs916877217 2544 dbSNP
rs1298421122 2545 dbSNP
rs1327116934 2550 dbSNP
rs181742570 2551 dbSNP
rs1396814388 2554 dbSNP
rs756366308 2557 dbSNP
rs1012939610 2558 dbSNP
rs545033533 2560 dbSNP
rs1325173792 2571 dbSNP
rs938229293 2574 dbSNP
rs1325991004 2577 dbSNP
rs1304622163 2580 dbSNP
rs1406345517 2585 dbSNP
rs1274917050 2593 dbSNP
rs1390402568 2600 dbSNP
rs926847523 2606 dbSNP
rs529806743 2609 dbSNP
rs1220144609 2610 dbSNP
rs1162296267 2621 dbSNP
rs1422292126 2627 dbSNP
rs1391550532 2628 dbSNP
rs189741873 2634 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions CMK , HEL , K-562 , Kasumi-1 , KG-1 , M-07e , ME-1 , MONO-MAC-1 MV4-11 , NB-4 , OCI-AML2 , OCI-AML5 , THP-1 , UT-7 HeLa
Disease acute myeloid leukemia
Location of target site 3'UTR
Tools used in this research MicroCosm , miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... NPM1 mutant associated miRNAs target and regulate a large number of NPM1 mutant associated genes with known or potential implication in leukemogenesis ...

- Russ AC; Sander S; Luck SC; Lang KM; Bauer et al., 2011, Haematologica.

Article - Russ AC; Sander S; Luck SC; Lang KM; Bauer et al.
- Haematologica, 2011
BACKGROUND: MicroRNAs are regulators of gene expression, which act mainly by decreasing mRNA levels of their multiple targets. Deregulated microRNA expression has been shown for acute myeloid leukemia, a disease also characterized by altered gene expression associated with distinct genomic aberrations such as nucleophosmin (NPM1) mutations. To shed further light on the role of deregulated microRNA and gene expression in cytogenetically normal acute myeloid leukemia with NPM1 mutation we performed an integrative analysis of microRNA and mRNA expression data sets. DESIGN AND METHODS: Both microRNA and gene expression profiles were investigated in samples from a cohort of adult cytogenetically normal acute myeloid leukemia patients (n=43; median age 46 years, range 23-60 years) with known NPM1 mutation status (n=23 mutated, n=20 wild-type) and the data were integratively analyzed. Putative microRNA-mRNA interactions were validated by quantitative reverse transcriptase polymerase chain reaction, western blotting and luciferase reporter assays. For selected microRNAs, sensitivity of microRNA-overexpressing cells to cytarabine treatment was tested by FACS viability and cell proliferation assays. RESULTS: Our integrative approach of analyzing both microRNA- and gene expression profiles in parallel resulted in a refined list of putative target genes affected by NPM1 mutation-associated microRNA deregulation. Of 177 putative microRNA - target mRNA interactions we identified and validated 77 novel candidates with known or potential involvement in leukemogenesis, such as IRF2-miR-20a, KIT-miR-20a and MN1-miR-15a. Furthermore, our data showed that deregulated expression of tumor suppressor microRNAs, such as miR-29a and miR-30c, might contribute to sensitivity to cytarabine, which is observed in NPM1 mutated acute myeloid leukemia. CONCLUSIONS: Overall, our observations highlight that integrative data analysis approaches can improve insights into leukemia biology, and lead to the identification of novel microRNA - target gene interactions of potential relevance for acute myeloid leukemia treatment.
LinkOut: [PMID: 21880628]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*