miRTarBase - #MIRT004879 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ADAM10   
Synonyms AD10, AD18, CD156c, CDw156, HsT18717, MADM, RAK, kuz
Description ADAM metallopeptidase domain 10
Transcript NM_001110   
Expression
Putative miRNA Targets on ADAM10
3'UTR of ADAM10
(miRNA target sites are highlighted)
>ADAM10|NM_001110|3'UTR
   1 CTGCAGCTTTTGCCTTGGTTCTTCCTAGTGCCTACAATGGGAAAACTTCACTCCAAAGAGAAACCTATTAAGTCATCATC
  81 TCCAAACTAAACCCTCACAAGTAACAGTTGAAGAAAAAATGGCAAGAGATCATATCCTCAGACCAGGTGGAATTACTTAA
 161 ATTTTAAAGCCTGAAAATTCCAATTTGGGGGTGGGAGGTGGAAAAGGAACCCAATTTTCTTATGAACAGATATTTTTAAC
 241 TTAATGGCACAAAGTCTTAGAATATTATTATGTGCCCCGTGTTCCCTGTTCTTCGTTGCTGCATTTTCTTCACTTGCAGG
 321 CAAACTTGGCTCTCAATAAACTTTTACCACAAATTGAAATAAATATATTTTTTTCAACTGCCAATCAAGGCTAGGAGGCT
 401 CGACCACCTCAACATTGGAGACATCACTTGCCAATGTACATACCTTGTTATATGCAGACATGTATTTCTTACGTACACTG
 481 TACTTCTGTGTGCAATTGTAAACAGAAATTGCAATATGGATGTTTCTTTGTATTATAAAATTTTTCCGCTCTTAATTAAA
 561 AATTACTGTTTAATTGACATACTCAGGATAACAGAGAATGGTGGTATTCAGTGGTCCAGGATTCTGTAATGCTTTACACA
 641 GGCAGTTTTGAAATGAAAATCAATTTACCTTTCTGTTACGATGGAGTTGGTTTTGATACTCATTTTTTCTTTATCACATG
 721 GCTGCTACGGGCACAAGTGACTATACTGAAGAACACAGTTAAGTGTTGTGCAAACTGGACATAGCAGCACATACTACTTC
 801 AGAGTTCATGATGTAGATGTCTGGTTTCTGCTTACGTCTTTTAAACTTTCTAATTCAATTCCATTTTTCAATTAATAGGT
 881 GAAATTTTATTCATGCTTTGATAGAAATTATGTCAATGAAATGATTCTTTTTATTTGTAGCCTACTTATTTGTGTTTTTC
 961 ATATATCTGAAATATGCTAATTATGTTTTCTGTCTGATATGGAAAAGAAAAGCTGTGTCTTTATCAAAATATTTAAACGG
1041 TTTTTTCAGCATATCATCACTGATCATTGGTAACCACTAAAGATGAGTAATTTGCTTAAGTAGTAGTTAAAATTGTAGAT
1121 AGGCCTTCTGACATTTTTTTTCCTAAAATTTTTAACAGCATTGAAGGTGAAACAGCACAATGTCCCATTCCAAATTTATT
1201 TTTGAAACAGATGTAAATAATTGGCATTTTAAAGAGAAAGCAAAAACATTTAATGTATTAACAGGCTTATTGCTATGCAG
1281 GAAATAGAAGGGGCATTACAAAAATTGAAGCTTGTGACATATTTATTGCTTCTGTTTTCCAACTACATCACTTCAACTAG
1361 AAGTAAAGCTATGATTTTCCTGACTTCACATAGGAGGCAAATTTAGAGAAAGTTGTAAAGATTTCTATGTTTTGGGTTTT
1441 TTTTTTTCCTTTTTTTTTTTAAGAGTATAAGGTTTACACAATCATTCTCATAATGTGACGCAAGCCAGCAAGGCCAAAAA
1521 TGCTAGAGAAAATAACGGGATCTCTTCCTTGTAAACTTGTACAGTATGTGGTGACTTTTTCAAAATACAGCTTTTTGTAC
1601 ATGATTTAGAGACAAATTTTGTACATGAAACCCCAGATAGACTATAAATAATTCTAAACAAACAAGTAGGTAGATATGTA
1681 TGTAATTGCTTTTAAATCATTTAAATGCCTTTGTTTTTGGACTGTGCAAAGGTTGGAAGTGGGTTTGCATTTCTAAAATG
1761 GTGACTTTTATTCTGCAAGAGTTCTTAGTAACTTCTTGAGTGTGGTAGACTTTGGAACATGTAAATTTTTTGCTTGTAAT
1841 GTTATCCTGTGGTAGGATTTTGGCAGGTACACACACTGCCCTATTTTATTTTGAGTCTAAGTTAAATGTTTTCTGAAAAG
1921 AGATACATGCACTGAACTCTTTCCACTGCGAATCAAGATGTGGTAATATAAAAGGATCAAGACAAATGAGATCTAATACT
2001 ACTGTCAGTTTTAATGTCCACTGTGTTTTATACAGTATCTTTTTTTGTTCACTTTGGAAATTTTTACTAAAAATTGCAAA
2081 AAATAAAGTATTGTGCAAAGATGTAAGGTTTTTTGAAACTTGAAATGCATTAATAAATAGACGATTAAATCAACTTGAAG
2161 GTTCTATACTCTTTGAACTCTGAGAACTATCACAAGAAGCTTCCCACAAGGCAGTGTTTTCTTACAGTTGTCTCTTCCTA
2241 CAAAAGTATAGATTATCTTTATTCTTAATACTTTGGAATCCATGTAGAAAATTTCCAGTTAGATACTCTGCGTACACACA
2321 ATAAACCTTTTTAAAACACCCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGU-G-GUAACAGUGUGAGGu 5'
            |||| | || |||| ||:||| 
Target 5' gaAACAGCACAATGTCCCATTCCa 3'
1169 - 1192 128.00 -18.50
2
miRNA  3' guuuguggUAACAGUGUGAGgu 5'
                  |||| ||:||||  
Target 5' actgtttaATTGACATACTCag 3'
565 - 586 126.00 -10.80
3
miRNA  3' guuugugguaacaguGUGAGGu 5'
                         |||||| 
Target 5' acaatgggaaaacttCACTCCa 3'
34 - 55 120.00 -11.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31567327 14 COSMIC
COSN30489875 32 COSMIC
COSN26965037 49 COSMIC
COSN15623039 60 COSMIC
COSN31602378 113 COSMIC
COSN32074821 145 COSMIC
COSN30142204 160 COSMIC
COSN31492591 186 COSMIC
COSN31488309 224 COSMIC
COSN30161610 473 COSMIC
COSN31516632 485 COSMIC
COSN8389708 522 COSMIC
COSN31539509 566 COSMIC
COSN31583198 624 COSMIC
COSN31779074 728 COSMIC
COSN8748081 778 COSMIC
COSN31529116 887 COSMIC
COSN28815621 918 COSMIC
COSN31583331 1038 COSMIC
COSN31535546 1040 COSMIC
COSN31566455 1149 COSMIC
COSN31488387 1169 COSMIC
COSN31544894 1214 COSMIC
COSN25578486 1499 COSMIC
COSN2501842 1846 COSMIC
COSN6276866 1968 COSMIC
COSN32011457 2085 COSMIC
COSN25482005 2507 COSMIC
COSN25482004 2527 COSMIC
COSN9627027 2531 COSMIC
COSN16836792 2611 COSMIC
COSN1680799 2666 COSMIC
COSN29444381 2906 COSMIC
COSN28956518 3684 COSMIC
COSN29336103 3744 COSMIC
COSN7049597 4398 COSMIC
COSN22527822 4535 COSMIC
COSN19294494 5271 COSMIC
COSN7049596 5528 COSMIC
COSN17198709 5755 COSMIC
COSN15333565 5801 COSMIC
COSN29804949 6212 COSMIC
COSN23035591 6385 COSMIC
COSN6642245 7155 COSMIC
COSN21296311 7268 COSMIC
COSN9627026 7486 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs775976909 2 dbSNP
rs200653119 5 dbSNP
rs961796184 9 dbSNP
rs1376006781 12 dbSNP
rs1463400587 12 dbSNP
rs375044581 13 dbSNP
rs1336077724 15 dbSNP
rs1204276114 17 dbSNP
rs755108582 26 dbSNP
rs772689668 28 dbSNP
rs746440332 35 dbSNP
rs199855504 36 dbSNP
rs201169297 39 dbSNP
rs1429857069 44 dbSNP
rs1415901047 49 dbSNP
rs1187683386 50 dbSNP
rs757422892 51 dbSNP
rs1239776928 55 dbSNP
rs1180280868 56 dbSNP
rs749475715 58 dbSNP
rs192051972 61 dbSNP
rs756398175 62 dbSNP
rs751288849 63 dbSNP
rs375375156 67 dbSNP
rs766228835 68 dbSNP
rs1400679912 70 dbSNP
rs747099779 70 dbSNP
rs549746482 72 dbSNP
rs758266611 74 dbSNP
rs1339864978 75 dbSNP
rs1335049504 76 dbSNP
rs868013756 80 dbSNP
rs200550328 85 dbSNP
rs1467187021 88 dbSNP
rs764680235 89 dbSNP
rs1475232187 93 dbSNP
rs761262019 94 dbSNP
rs776248693 98 dbSNP
rs1416369635 103 dbSNP
rs1176033058 104 dbSNP
rs1470093180 106 dbSNP
rs763634968 108 dbSNP
rs1387595663 109 dbSNP
rs1178731381 111 dbSNP
rs1458705159 113 dbSNP
rs760437613 114 dbSNP
rs1212652805 115 dbSNP
rs1034055079 119 dbSNP
rs757201375 120 dbSNP
rs775988367 121 dbSNP
rs772565323 122 dbSNP
rs1349871017 123 dbSNP
rs1309811079 128 dbSNP
rs199528143 129 dbSNP
rs1326915880 130 dbSNP
rs775018743 131 dbSNP
rs1325526973 132 dbSNP
rs1441886654 135 dbSNP
rs1351784786 136 dbSNP
rs201533601 137 dbSNP
rs200636698 143 dbSNP
rs1198414340 144 dbSNP
rs759698636 147 dbSNP
rs1485726692 158 dbSNP
rs1189379674 159 dbSNP
rs1410411552 160 dbSNP
rs1419075335 175 dbSNP
rs199709319 177 dbSNP
rs201547564 182 dbSNP
rs1365958024 183 dbSNP
rs200247666 185 dbSNP
rs539251007 191 dbSNP
rs1173279422 195 dbSNP
rs202149244 202 dbSNP
rs1416714056 208 dbSNP
rs1306187001 209 dbSNP
rs1372694749 210 dbSNP
rs201085268 214 dbSNP
rs1281927334 216 dbSNP
rs1390797625 223 dbSNP
rs1412373247 224 dbSNP
rs1394155138 227 dbSNP
rs200261664 230 dbSNP
rs1231744988 239 dbSNP
rs1279181547 240 dbSNP
rs1348075758 241 dbSNP
rs1212579173 247 dbSNP
rs1249063370 248 dbSNP
rs1480010785 252 dbSNP
rs1193704058 258 dbSNP
rs201938359 260 dbSNP
rs1178322169 271 dbSNP
rs1455249133 272 dbSNP
rs1253232118 275 dbSNP
rs1255375404 277 dbSNP
rs201001402 279 dbSNP
rs1395923594 281 dbSNP
rs200206795 290 dbSNP
rs80217108 291 dbSNP
rs1354052183 292 dbSNP
rs1010504546 293 dbSNP
rs1298702570 295 dbSNP
rs550499786 302 dbSNP
rs1375364408 303 dbSNP
rs1480486837 308 dbSNP
rs201813060 316 dbSNP
rs1438444037 321 dbSNP
rs1302489424 329 dbSNP
rs1371440654 334 dbSNP
rs201175636 336 dbSNP
rs1252217108 340 dbSNP
rs878972034 346 dbSNP
rs1270415035 347 dbSNP
rs199904841 348 dbSNP
rs1306448657 351 dbSNP
rs1204552574 352 dbSNP
rs1207122590 357 dbSNP
rs1253611638 358 dbSNP
rs201580885 361 dbSNP
rs1193555566 362 dbSNP
rs1254085761 363 dbSNP
rs1310650146 365 dbSNP
rs200586511 366 dbSNP
rs537435255 367 dbSNP
rs1279964531 375 dbSNP
rs1429212317 376 dbSNP
rs200093520 383 dbSNP
rs77874096 384 dbSNP
rs1348197434 398 dbSNP
rs1459860544 401 dbSNP
rs200652268 402 dbSNP
rs199811425 404 dbSNP
rs201478481 412 dbSNP
rs779472227 415 dbSNP
rs1268073398 416 dbSNP
rs200591788 423 dbSNP
rs1390782541 427 dbSNP
rs1297185523 428 dbSNP
rs139993855 430 dbSNP
rs1299649457 431 dbSNP
rs201464728 432 dbSNP
rs117553441 439 dbSNP
rs1445622441 440 dbSNP
rs202102515 453 dbSNP
rs1241749043 454 dbSNP
rs201542585 455 dbSNP
rs1188488177 459 dbSNP
rs200242211 460 dbSNP
rs1474901348 470 dbSNP
rs150654398 473 dbSNP
rs201096661 488 dbSNP
rs199955909 490 dbSNP
rs201795170 495 dbSNP
rs772308773 507 dbSNP
rs1344385209 512 dbSNP
rs1431086468 519 dbSNP
rs200791690 529 dbSNP
rs1157780147 530 dbSNP
rs1418979329 536 dbSNP
rs200156559 547 dbSNP
rs532802971 548 dbSNP
rs1222557950 549 dbSNP
rs563963898 551 dbSNP
rs201808731 559 dbSNP
rs1179313204 565 dbSNP
rs1284073942 570 dbSNP
rs1447914259 579 dbSNP
rs1218256596 580 dbSNP
rs543796191 582 dbSNP
rs1255625497 588 dbSNP
rs757599588 596 dbSNP
rs1188680993 597 dbSNP
rs200801371 597 dbSNP
rs1258147593 600 dbSNP
rs951809935 604 dbSNP
rs926932154 611 dbSNP
rs979787636 613 dbSNP
rs879623249 621 dbSNP
rs1257004731 627 dbSNP
rs199821564 634 dbSNP
rs1350094173 635 dbSNP
rs1160869382 637 dbSNP
rs202044609 641 dbSNP
rs1373180705 649 dbSNP
rs1413634591 658 dbSNP
rs1313027124 661 dbSNP
rs187230231 663 dbSNP
rs1024656527 675 dbSNP
rs199752233 679 dbSNP
rs183277108 680 dbSNP
rs1351884339 682 dbSNP
rs1225786404 686 dbSNP
rs1278479725 687 dbSNP
rs1347345415 690 dbSNP
rs1211867154 697 dbSNP
rs1282637339 700 dbSNP
rs1436132557 703 dbSNP
rs1179626414 709 dbSNP
rs1309146652 712 dbSNP
rs1010037970 716 dbSNP
rs777756253 717 dbSNP
rs1180203634 724 dbSNP
rs1226336944 728 dbSNP
rs1354601992 731 dbSNP
rs201370993 740 dbSNP
rs956072206 746 dbSNP
rs1173848735 750 dbSNP
rs1313062373 753 dbSNP
rs1376785064 754 dbSNP
rs561499332 755 dbSNP
rs200538989 756 dbSNP
rs1000682091 768 dbSNP
rs1328805924 768 dbSNP
rs567776722 770 dbSNP
rs541818743 773 dbSNP
rs141954383 776 dbSNP
rs1301784809 778 dbSNP
rs1453926735 778 dbSNP
rs889898917 779 dbSNP
rs1364812870 787 dbSNP
rs1049691670 788 dbSNP
rs998153042 793 dbSNP
rs1282701325 796 dbSNP
rs1337567439 800 dbSNP
rs1195244295 802 dbSNP
rs1272208165 803 dbSNP
rs1438390679 808 dbSNP
rs201475098 815 dbSNP
rs1250958608 829 dbSNP
rs1453538113 834 dbSNP
rs1193906772 835 dbSNP
rs1378949855 836 dbSNP
rs1474150911 840 dbSNP
rs148149857 841 dbSNP
rs201930901 843 dbSNP
rs201063269 849 dbSNP
rs147057242 850 dbSNP
rs201844970 854 dbSNP
rs1189147083 861 dbSNP
rs200864099 871 dbSNP
rs1305915814 877 dbSNP
rs747879929 879 dbSNP
rs1324838980 880 dbSNP
rs143161744 891 dbSNP
rs927048881 896 dbSNP
rs1341530294 901 dbSNP
rs1220434335 902 dbSNP
rs529010095 903 dbSNP
rs1467883598 909 dbSNP
rs1214032212 912 dbSNP
rs1486240542 916 dbSNP
rs1192012575 921 dbSNP
rs1444994038 921 dbSNP
rs1262363918 927 dbSNP
rs1231407627 931 dbSNP
rs1417714483 937 dbSNP
rs1462297096 943 dbSNP
rs1295723607 949 dbSNP
rs1383242294 952 dbSNP
rs953908048 961 dbSNP
rs202232181 963 dbSNP
rs1319190794 965 dbSNP
rs201093287 966 dbSNP
rs1231472323 967 dbSNP
rs199969973 972 dbSNP
rs1291376817 973 dbSNP
rs1333992184 973 dbSNP
rs1293654841 975 dbSNP
rs1267057247 978 dbSNP
rs139025368 984 dbSNP
rs536917457 987 dbSNP
rs1204227604 989 dbSNP
rs1234966709 994 dbSNP
rs1261950092 996 dbSNP
rs201730332 1000 dbSNP
rs1185067262 1003 dbSNP
rs1256188455 1005 dbSNP
rs200911563 1006 dbSNP
rs1167498517 1023 dbSNP
rs1294412060 1023 dbSNP
rs192599028 1032 dbSNP
rs535022549 1035 dbSNP
rs200115242 1038 dbSNP
rs956019081 1039 dbSNP
rs1362625541 1040 dbSNP
rs1033248043 1043 dbSNP
rs201808603 1051 dbSNP
rs200605130 1052 dbSNP
rs1413021311 1053 dbSNP
rs1312426465 1060 dbSNP
rs1386522737 1066 dbSNP
rs1396589619 1070 dbSNP
rs1291104682 1076 dbSNP
rs954097732 1077 dbSNP
rs115794657 1079 dbSNP
rs202043306 1081 dbSNP
rs1394461371 1082 dbSNP
rs1166089294 1098 dbSNP
rs998100060 1098 dbSNP
rs901177442 1100 dbSNP
rs1279050787 1107 dbSNP
rs1476430976 1108 dbSNP
rs1015629545 1118 dbSNP
rs1371487772 1119 dbSNP
rs1418872340 1120 dbSNP
rs1182893316 1125 dbSNP
rs1192769462 1128 dbSNP
rs200915506 1129 dbSNP
rs1173226302 1131 dbSNP
rs199737611 1132 dbSNP
rs1376187998 1133 dbSNP
rs201141555 1141 dbSNP
rs1371019666 1142 dbSNP
rs201470833 1142 dbSNP
rs888726158 1145 dbSNP
rs1263901723 1149 dbSNP
rs746146012 1156 dbSNP
rs1309783710 1159 dbSNP
rs1049015550 1167 dbSNP
rs938174833 1176 dbSNP
rs200216827 1178 dbSNP
rs1231673346 1179 dbSNP
rs199842028 1182 dbSNP
rs552748001 1183 dbSNP
rs1302183995 1184 dbSNP
rs1467964010 1185 dbSNP
rs567169965 1187 dbSNP
rs201166012 1193 dbSNP
rs751215016 1199 dbSNP
rs1211540055 1210 dbSNP
rs200377369 1211 dbSNP
rs1250129926 1223 dbSNP
rs201925736 1238 dbSNP
rs1480632113 1248 dbSNP
rs1273806230 1252 dbSNP
rs905578379 1254 dbSNP
rs1044172828 1257 dbSNP
rs949822556 1260 dbSNP
rs1395869561 1269 dbSNP
rs1337218303 1272 dbSNP
rs201127414 1274 dbSNP
rs1434994437 1277 dbSNP
rs1364065945 1279 dbSNP
rs916896493 1281 dbSNP
rs1227749884 1284 dbSNP
rs1353996617 1291 dbSNP
rs1461463064 1298 dbSNP
rs1327870915 1319 dbSNP
rs1402230895 1325 dbSNP
rs1438376287 1328 dbSNP
rs988525523 1329 dbSNP
rs187918989 1331 dbSNP
rs182506038 1342 dbSNP
rs1439600742 1345 dbSNP
rs1220590146 1348 dbSNP
rs1292898395 1349 dbSNP
rs1370907740 1351 dbSNP
rs1306394797 1356 dbSNP
rs1219830134 1360 dbSNP
rs1260510627 1363 dbSNP
rs1467434011 1370 dbSNP
rs925903721 1371 dbSNP
rs1253874130 1377 dbSNP
rs978529818 1380 dbSNP
rs1184976289 1389 dbSNP
rs1418945581 1392 dbSNP
rs1429158014 1398 dbSNP
rs1171322971 1399 dbSNP
rs1425611009 1407 dbSNP
rs953880837 1410 dbSNP
rs1028149908 1413 dbSNP
rs1459681032 1425 dbSNP
rs1327172890 1428 dbSNP
rs563900705 1429 dbSNP
rs200798400 1437 dbSNP
rs74016945 1447 dbSNP
rs1233207687 1448 dbSNP
rs1333247234 1448 dbSNP
rs1400028727 1448 dbSNP
rs61708648 1448 dbSNP
rs796557510 1448 dbSNP
rs74016944 1449 dbSNP
rs1323845249 1450 dbSNP
rs1213954619 1451 dbSNP
rs1241693866 1453 dbSNP
rs1375056328 1454 dbSNP
rs561760137 1458 dbSNP
rs1015990473 1461 dbSNP
rs1164105032 1461 dbSNP
rs1270394222 1461 dbSNP
rs1488663837 1461 dbSNP
rs1191819865 1467 dbSNP
rs1004234588 1476 dbSNP
rs1253483500 1481 dbSNP
rs1344180473 1483 dbSNP
rs530289163 1499 dbSNP
rs888667576 1500 dbSNP
rs1271985814 1501 dbSNP
rs1027248673 1511 dbSNP
rs1002333875 1513 dbSNP
rs1353008835 1516 dbSNP
rs1414755763 1526 dbSNP
rs114263914 1528 dbSNP
rs1341023602 1531 dbSNP
rs1381825193 1532 dbSNP
rs761537475 1535 dbSNP
rs949772298 1536 dbSNP
rs1232843525 1546 dbSNP
rs895591518 1547 dbSNP
rs1347997586 1552 dbSNP
rs1053177164 1553 dbSNP
rs1278351133 1559 dbSNP
rs774154553 1562 dbSNP
rs1485369277 1575 dbSNP
rs1186795449 1587 dbSNP
rs934349292 1591 dbSNP
rs1175198015 1602 dbSNP
rs1379449865 1603 dbSNP
rs925821975 1607 dbSNP
rs1439987094 1609 dbSNP
rs1042948919 1615 dbSNP
rs1160050417 1617 dbSNP
rs1373123978 1625 dbSNP
rs1433507597 1627 dbSNP
rs1304751930 1629 dbSNP
rs932602641 1631 dbSNP
rs1440638127 1632 dbSNP
rs1279396702 1634 dbSNP
rs1378077197 1635 dbSNP
rs1439178903 1635 dbSNP
rs1242641021 1636 dbSNP
rs1301477605 1637 dbSNP
rs1347277413 1638 dbSNP
rs1334559444 1642 dbSNP
rs768302224 1644 dbSNP
rs541456783 1648 dbSNP
rs192507322 1656 dbSNP
rs762532746 1660 dbSNP
rs1328583930 1669 dbSNP
rs965819092 1673 dbSNP
rs1392400205 1675 dbSNP
rs1398820956 1677 dbSNP
rs146382035 1677 dbSNP
rs1180145710 1681 dbSNP
rs1172021359 1685 dbSNP
rs186417111 1686 dbSNP
rs1477409346 1688 dbSNP
rs868054698 1691 dbSNP
rs1172720093 1694 dbSNP
rs1434132067 1696 dbSNP
rs564373084 1703 dbSNP
rs545519071 1704 dbSNP
rs576550911 1709 dbSNP
rs1232292076 1713 dbSNP
rs1401523618 1721 dbSNP
rs775109355 1736 dbSNP
rs1324157378 1749 dbSNP
rs865814077 1768 dbSNP
rs1182255067 1770 dbSNP
rs1276749030 1773 dbSNP
rs1337509206 1776 dbSNP
rs1439350302 1778 dbSNP
rs1254890192 1779 dbSNP
rs1209743274 1795 dbSNP
rs754389763 1798 dbSNP
rs1200223132 1813 dbSNP
rs1250899582 1815 dbSNP
rs952747414 1821 dbSNP
rs769357626 1824 dbSNP
rs1450737156 1826 dbSNP
rs745349842 1827 dbSNP
rs1474119785 1832 dbSNP
rs1485692305 1832 dbSNP
rs1281809805 1833 dbSNP
rs1221630809 1836 dbSNP
rs1349152908 1838 dbSNP
rs1279491178 1839 dbSNP
rs1240132848 1841 dbSNP
rs556841433 1844 dbSNP
rs1027027342 1845 dbSNP
rs1467519336 1852 dbSNP
rs113045012 1854 dbSNP
rs969659384 1866 dbSNP
rs1414365702 1867 dbSNP
rs1376345396 1868 dbSNP
rs1325741182 1871 dbSNP
rs781594844 1872 dbSNP
rs1430036349 1878 dbSNP
rs183255741 1883 dbSNP
rs1318597669 1892 dbSNP
rs1220372815 1907 dbSNP
rs78252339 1913 dbSNP
rs79362280 1916 dbSNP
rs1407077678 1917 dbSNP
rs1355336416 1932 dbSNP
rs1210097902 1934 dbSNP
rs895520228 1936 dbSNP
rs1159090100 1937 dbSNP
rs1444797263 1938 dbSNP
rs1192224199 1939 dbSNP
rs1471013417 1942 dbSNP
rs554897995 1943 dbSNP
rs1415440226 1949 dbSNP
rs540269232 1950 dbSNP
rs760021670 1956 dbSNP
rs904187684 1958 dbSNP
rs1458687820 1965 dbSNP
rs1485784701 1967 dbSNP
rs764624327 1968 dbSNP
rs535010681 1969 dbSNP
rs1212949472 1970 dbSNP
rs1419324371 1982 dbSNP
rs1445928793 2000 dbSNP
rs566113996 2001 dbSNP
rs932551615 2003 dbSNP
rs1342424057 2021 dbSNP
rs1206272326 2025 dbSNP
rs921197988 2029 dbSNP
rs1040826606 2032 dbSNP
rs1331893453 2034 dbSNP
rs747342967 2057 dbSNP
rs1339682274 2060 dbSNP
rs1245178557 2075 dbSNP
rs1266852407 2080 dbSNP
rs1348187186 2084 dbSNP
rs1233120127 2085 dbSNP
rs1215425786 2089 dbSNP
rs1356334566 2093 dbSNP
rs1286181484 2095 dbSNP
rs1428654842 2108 dbSNP
rs527401266 2115 dbSNP
rs1209397834 2122 dbSNP
rs778229155 2125 dbSNP
rs982885921 2140 dbSNP
rs559073222 2142 dbSNP
rs1190132089 2144 dbSNP
rs1362408122 2153 dbSNP
rs1439367283 2158 dbSNP
rs1159439205 2166 dbSNP
rs1362569195 2168 dbSNP
rs1432892951 2180 dbSNP
rs1301030450 2184 dbSNP
rs539109377 2189 dbSNP
rs190660516 2191 dbSNP
rs1396536639 2195 dbSNP
rs1314680387 2199 dbSNP
rs1374357150 2201 dbSNP
rs1239031697 2207 dbSNP
rs1309480712 2225 dbSNP
rs980792761 2226 dbSNP
rs1208013401 2227 dbSNP
rs1254897030 2227 dbSNP
rs74601249 2234 dbSNP
rs1163936309 2238 dbSNP
rs1025246777 2248 dbSNP
rs1014129452 2250 dbSNP
rs1419494796 2251 dbSNP
rs956889538 2254 dbSNP
rs1452667623 2277 dbSNP
rs1031619845 2282 dbSNP
rs1474771192 2283 dbSNP
rs1378268725 2284 dbSNP
rs1466533609 2286 dbSNP
rs1304484064 2294 dbSNP
rs998600288 2296 dbSNP
rs904303944 2302 dbSNP
rs1042679990 2309 dbSNP
rs530363849 2311 dbSNP
rs567853430 2312 dbSNP
rs1312225629 2315 dbSNP
rs548103501 2321 dbSNP
rs1236105556 2326 dbSNP
rs1194760346 2341 dbSNP
rs185984309 2342 dbSNP
rs1466629714 2345 dbSNP
rs528052264 2363 dbSNP
rs753038728 2367 dbSNP
rs1040969814 2373 dbSNP
rs1190806851 2374 dbSNP
rs16940574 2380 dbSNP
rs1434945100 2382 dbSNP
rs761274683 2386 dbSNP
rs753059233 2387 dbSNP
rs1421305529 2392 dbSNP
rs1292236213 2393 dbSNP
rs1171194511 2395 dbSNP
rs114000795 2411 dbSNP
rs1433899190 2416 dbSNP
rs931397533 2420 dbSNP
rs1367719259 2422 dbSNP
rs372699552 2426 dbSNP
rs1276863445 2429 dbSNP
rs1317906223 2442 dbSNP
rs1348771969 2449 dbSNP
rs145116425 2452 dbSNP
rs1260448475 2470 dbSNP
rs948036235 2471 dbSNP
rs1221155711 2474 dbSNP
rs917961107 2476 dbSNP
rs1489515162 2477 dbSNP
rs992414251 2482 dbSNP
rs753907264 2486 dbSNP
rs370472923 2488 dbSNP
rs574618509 2498 dbSNP
rs1194251245 2499 dbSNP
rs1425547567 2501 dbSNP
rs752228473 2505 dbSNP
rs150340630 2509 dbSNP
rs1163649833 2519 dbSNP
rs980026560 2526 dbSNP
rs1350043198 2529 dbSNP
rs1408988540 2533 dbSNP
rs968410544 2534 dbSNP
rs1339250526 2540 dbSNP
rs1401191525 2541 dbSNP
rs554555299 2545 dbSNP
rs1021336958 2549 dbSNP
rs181453133 2550 dbSNP
rs754653827 2553 dbSNP
rs1313874919 2554 dbSNP
rs1323789062 2557 dbSNP
rs1214693530 2561 dbSNP
rs545394043 2565 dbSNP
rs1452039056 2571 dbSNP
rs899505957 2572 dbSNP
rs1251615989 2577 dbSNP
rs544609975 2581 dbSNP
rs1471689352 2589 dbSNP
rs761743440 2592 dbSNP
rs1181136333 2611 dbSNP
rs1414239645 2615 dbSNP
rs1469158612 2622 dbSNP
rs1156426198 2628 dbSNP
rs1008133969 2644 dbSNP
rs887049985 2646 dbSNP
rs376962791 2650 dbSNP
rs1300606327 2652 dbSNP
rs1357867716 2656 dbSNP
rs1447925384 2659 dbSNP
rs1046871328 2666 dbSNP
rs1303838444 2677 dbSNP
rs140279885 2678 dbSNP
rs1307128962 2687 dbSNP
rs1273976602 2692 dbSNP
rs1238282042 2698 dbSNP
rs751325304 2701 dbSNP
rs1354519367 2702 dbSNP
rs1345883067 2716 dbSNP
rs1242320395 2724 dbSNP
rs1276586180 2727 dbSNP
rs1440688444 2729 dbSNP
rs1302551945 2732 dbSNP
rs1209310922 2734 dbSNP
rs3764196 2736 dbSNP
rs1462459315 2750 dbSNP
rs1369668715 2756 dbSNP
rs1176422101 2760 dbSNP
rs1296180601 2764 dbSNP
rs372266932 2764 dbSNP
rs1441212405 2765 dbSNP
rs1439780120 2766 dbSNP
rs1159850048 2770 dbSNP
rs1422415535 2776 dbSNP
rs751201013 2778 dbSNP
rs1414436285 2780 dbSNP
rs1335392829 2783 dbSNP
rs1361282988 2784 dbSNP
rs1354747037 2787 dbSNP
rs539037415 2793 dbSNP
rs866528462 2795 dbSNP
rs948150244 2804 dbSNP
rs570048387 2822 dbSNP
rs1330936986 2827 dbSNP
rs1378009831 2833 dbSNP
rs917910284 2836 dbSNP
rs189512518 2839 dbSNP
rs1273208096 2840 dbSNP
rs992589242 2845 dbSNP
rs935572847 2852 dbSNP
rs1393994580 2854 dbSNP
rs536428505 2859 dbSNP
rs924200145 2861 dbSNP
rs151202828 2865 dbSNP
rs1457970724 2866 dbSNP
rs968189086 2867 dbSNP
rs1244504190 2889 dbSNP
rs1029157548 2890 dbSNP
rs1173686286 2900 dbSNP
rs1480546179 2916 dbSNP
rs1431997775 2922 dbSNP
rs1464515077 2924 dbSNP
rs1170482898 2932 dbSNP
rs1233648121 2933 dbSNP
rs1207611741 2935 dbSNP
rs1321783777 2936 dbSNP
rs1467417762 2936 dbSNP
rs562115699 2937 dbSNP
rs1330625561 2942 dbSNP
rs975125481 2944 dbSNP
rs1275375891 2950 dbSNP
rs1347394347 2958 dbSNP
rs1216695520 2963 dbSNP
rs1257231343 2966 dbSNP
rs1318277647 2967 dbSNP
rs186203267 2989 dbSNP
rs1279641496 3002 dbSNP
rs527942780 3007 dbSNP
rs1199035393 3012 dbSNP
rs571614349 3021 dbSNP
rs11071391 3037 dbSNP
rs1222981878 3042 dbSNP
rs1373845456 3044 dbSNP
rs887004057 3052 dbSNP
rs1309434612 3057 dbSNP
rs1390210025 3064 dbSNP
rs1025992496 3068 dbSNP
rs564106826 3069 dbSNP
rs1358664884 3084 dbSNP
rs1398101804 3088 dbSNP
rs563230333 3090 dbSNP
rs1277426577 3101 dbSNP
rs1340907519 3105 dbSNP
rs758986818 3113 dbSNP
rs543540917 3114 dbSNP
rs1355275059 3117 dbSNP
rs1210040600 3119 dbSNP
rs1012317271 3123 dbSNP
rs896581074 3124 dbSNP
rs1322120603 3127 dbSNP
rs1430673140 3129 dbSNP
rs1185955909 3131 dbSNP
rs1368243928 3136 dbSNP
rs1473270419 3143 dbSNP
rs1165660914 3151 dbSNP
rs1378566791 3164 dbSNP
rs1419108310 3166 dbSNP
rs1056439229 3167 dbSNP
rs867600175 3170 dbSNP
rs1402847865 3177 dbSNP
rs1385664208 3186 dbSNP
rs924176806 3192 dbSNP
rs115634583 3199 dbSNP
rs561109055 3208 dbSNP
rs1245108473 3218 dbSNP
rs1316655182 3220 dbSNP
rs947004035 3221 dbSNP
rs1238711751 3224 dbSNP
rs1286109999 3237 dbSNP
rs1487172241 3239 dbSNP
rs1184817555 3240 dbSNP
rs1199226689 3243 dbSNP
rs1474316484 3246 dbSNP
rs922091345 3250 dbSNP
rs1185666310 3254 dbSNP
rs974906034 3256 dbSNP
rs1159389157 3258 dbSNP
rs1365583318 3262 dbSNP
rs1257083823 3265 dbSNP
rs180841361 3269 dbSNP
rs776163178 3270 dbSNP
rs1201104672 3275 dbSNP
rs1401262961 3279 dbSNP
rs541245323 3281 dbSNP
rs1453027828 3294 dbSNP
rs1484310487 3295 dbSNP
rs1338303659 3301 dbSNP
rs1374290112 3302 dbSNP
rs1445568581 3307 dbSNP
rs1307149767 3309 dbSNP
rs1318153877 3316 dbSNP
rs1231732157 3321 dbSNP
rs143266474 3321 dbSNP
rs558938104 3332 dbSNP
rs1206039881 3341 dbSNP
rs1236716623 3342 dbSNP
rs1317476884 3355 dbSNP
rs951124872 3357 dbSNP
rs1231238681 3358 dbSNP
rs189479970 3363 dbSNP
rs1196684294 3371 dbSNP
rs867024646 3375 dbSNP
rs1376933256 3376 dbSNP
rs1470254336 3381 dbSNP
rs1178402004 3383 dbSNP
rs1397824210 3384 dbSNP
rs1464818140 3388 dbSNP
rs866338561 3389 dbSNP
rs1374892959 3405 dbSNP
rs962641994 3407 dbSNP
rs1299979546 3412 dbSNP
rs1346758334 3416 dbSNP
rs1023447493 3428 dbSNP
rs1256602533 3437 dbSNP
rs1158034571 3443 dbSNP
rs1317634821 3447 dbSNP
rs1205520787 3455 dbSNP
rs1253236625 3456 dbSNP
rs1487550206 3470 dbSNP
rs1190755727 3471 dbSNP
rs1455326995 3475 dbSNP
rs1012099500 3481 dbSNP
rs1268134222 3482 dbSNP
rs1480753918 3483 dbSNP
rs1201467268 3484 dbSNP
rs184739052 3488 dbSNP
rs1477337796 3491 dbSNP
rs879554433 3491 dbSNP
rs1170712149 3492 dbSNP
rs116385350 3493 dbSNP
rs1365625261 3496 dbSNP
rs762796784 3496 dbSNP
rs1407330859 3498 dbSNP
rs879805822 3498 dbSNP
rs192310237 3501 dbSNP
rs902505415 3509 dbSNP
rs748502821 3511 dbSNP
rs1340312458 3516 dbSNP
rs1390039111 3518 dbSNP
rs35811746 3528 dbSNP
rs1460267557 3541 dbSNP
rs553906075 3543 dbSNP
rs1221085522 3544 dbSNP
rs1188567459 3545 dbSNP
rs1490850562 3551 dbSNP
rs1224640935 3555 dbSNP
rs1425597299 3557 dbSNP
rs1487917671 3565 dbSNP
rs1186945569 3574 dbSNP
rs1421359452 3578 dbSNP
rs1421727595 3581 dbSNP
rs922206474 3582 dbSNP
rs1039152001 3583 dbSNP
rs16940573 3590 dbSNP
rs1425942591 3591 dbSNP
rs1465243859 3594 dbSNP
rs1269942668 3599 dbSNP
rs1432095750 3600 dbSNP
rs1291051819 3601 dbSNP
rs1211580840 3604 dbSNP
rs1333959228 3609 dbSNP
rs1377396708 3615 dbSNP
rs753866980 3618 dbSNP
rs1246488568 3619 dbSNP
rs1324346528 3624 dbSNP
rs986944636 3627 dbSNP
rs951188831 3631 dbSNP
rs1361682581 3636 dbSNP
rs1294166719 3637 dbSNP
rs918236575 3640 dbSNP
rs780122963 3641 dbSNP
rs973751181 3651 dbSNP
rs76116319 3652 dbSNP
rs1394255200 3656 dbSNP
rs1023563519 3663 dbSNP
rs1243301676 3664 dbSNP
rs1446078848 3666 dbSNP
rs1156367777 3669 dbSNP
rs1012047524 3675 dbSNP
rs1244965542 3680 dbSNP
rs551700027 3684 dbSNP
rs377018889 3686 dbSNP
rs1401841481 3690 dbSNP
rs756132728 3691 dbSNP
rs1161870187 3695 dbSNP
rs1459592958 3699 dbSNP
rs796393905 3703 dbSNP
rs1337792617 3705 dbSNP
rs1385330700 3711 dbSNP
rs1169742885 3712 dbSNP
rs1308670167 3713 dbSNP
rs1351441273 3716 dbSNP
rs1224293731 3722 dbSNP
rs1286189853 3725 dbSNP
rs1310224094 3737 dbSNP
rs1450237516 3739 dbSNP
rs1202873684 3740 dbSNP
rs1462416166 3742 dbSNP
rs1249796856 3749 dbSNP
rs555554123 3763 dbSNP
rs1470158646 3772 dbSNP
rs1191715554 3783 dbSNP
rs1179464227 3792 dbSNP
rs1423758416 3793 dbSNP
rs1468005298 3795 dbSNP
rs1469724253 3802 dbSNP
rs146409937 3809 dbSNP
rs1408717025 3810 dbSNP
rs763985303 3813 dbSNP
rs1330874595 3815 dbSNP
rs143989632 3821 dbSNP
rs1444384398 3826 dbSNP
rs1022230843 3829 dbSNP
rs1273149289 3831 dbSNP
rs1365478185 3832 dbSNP
rs549534724 3834 dbSNP
rs1222802796 3839 dbSNP
rs1283736233 3840 dbSNP
rs752435529 3841 dbSNP
rs900731247 3843 dbSNP
rs1039265836 3847 dbSNP
rs1250477434 3851 dbSNP
rs945019860 3853 dbSNP
rs1343738368 3854 dbSNP
rs1244449626 3856 dbSNP
rs890604339 3863 dbSNP
rs1047914766 3872 dbSNP
rs1200730876 3878 dbSNP
rs1439292354 3889 dbSNP
rs1431930239 3890 dbSNP
rs1477013035 3891 dbSNP
rs1167560987 3894 dbSNP
rs1370934672 3898 dbSNP
rs1397565480 3905 dbSNP
rs115390969 3916 dbSNP
rs1388889001 3917 dbSNP
rs1349343965 3929 dbSNP
rs1394595109 3930 dbSNP
rs1404292949 3938 dbSNP
rs918351148 3938 dbSNP
rs1283797271 3941 dbSNP
rs764825062 3945 dbSNP
rs1216638925 3952 dbSNP
rs536602194 3954 dbSNP
rs560977064 3957 dbSNP
rs1215927189 3958 dbSNP
rs148789207 3984 dbSNP
rs1490029333 3990 dbSNP
rs1223899505 3991 dbSNP
rs991136926 4000 dbSNP
rs759174244 4013 dbSNP
rs566765464 4014 dbSNP
rs1430456890 4018 dbSNP
rs1392059574 4044 dbSNP
rs1487591762 4048 dbSNP
rs776138938 4051 dbSNP
rs527522019 4052 dbSNP
rs1476537428 4053 dbSNP
rs1378141790 4059 dbSNP
rs565161842 4063 dbSNP
rs1161641603 4064 dbSNP
rs1200729237 4066 dbSNP
rs1384714821 4071 dbSNP
rs1425319926 4072 dbSNP
rs1303697677 4073 dbSNP
rs1367431668 4076 dbSNP
rs746663755 4083 dbSNP
rs1380432404 4088 dbSNP
rs1317423244 4092 dbSNP
rs977970286 4095 dbSNP
rs1432485027 4096 dbSNP
rs1282005858 4102 dbSNP
rs867362618 4104 dbSNP
rs966737881 4111 dbSNP
rs374085826 4122 dbSNP
rs1010824781 4135 dbSNP
rs1483849080 4136 dbSNP
rs1293305609 4140 dbSNP
rs900510093 4141 dbSNP
rs1205028101 4149 dbSNP
rs1262906911 4150 dbSNP
rs576277285 4153 dbSNP
rs1009543006 4154 dbSNP
rs1445445641 4160 dbSNP
rs1165601197 4162 dbSNP
rs1378515314 4165 dbSNP
rs1344839863 4169 dbSNP
rs1276026677 4170 dbSNP
rs890730398 4172 dbSNP
rs1385418685 4174 dbSNP
rs1048330995 4178 dbSNP
rs369391358 4179 dbSNP
rs896868056 4182 dbSNP
rs574216218 4187 dbSNP
rs554210461 4189 dbSNP
rs941123061 4190 dbSNP
rs542663078 4195 dbSNP
rs574029824 4199 dbSNP
rs1373963277 4200 dbSNP
rs990525477 4204 dbSNP
rs376105866 4210 dbSNP
rs1261770590 4211 dbSNP
rs189011988 4212 dbSNP
rs553897679 4215 dbSNP
rs1199171851 4218 dbSNP
rs534119054 4233 dbSNP
rs978296608 4243 dbSNP
rs577854441 4244 dbSNP
rs1022126111 4246 dbSNP
rs1185610165 4247 dbSNP
rs989517937 4252 dbSNP
rs1236456210 4253 dbSNP
rs1362967410 4254 dbSNP
rs964787083 4256 dbSNP
rs1017996956 4258 dbSNP
rs1473333863 4259 dbSNP
rs1254962962 4264 dbSNP
rs558009575 4265 dbSNP
rs1209518250 4272 dbSNP
rs1405044899 4275 dbSNP
rs4258547 4275 dbSNP
rs1442548318 4280 dbSNP
rs1338242419 4282 dbSNP
rs185027463 4285 dbSNP
rs1026568148 4286 dbSNP
rs1202664769 4296 dbSNP
rs1349193737 4298 dbSNP
rs60679293 4300 dbSNP
rs538502712 4301 dbSNP
rs1229401226 4303 dbSNP
rs534699820 4306 dbSNP
rs1291727673 4307 dbSNP
rs899323215 4308 dbSNP
rs1037901930 4314 dbSNP
rs1447361547 4327 dbSNP
rs1005287441 4332 dbSNP
rs1341186117 4333 dbSNP
rs549711687 4334 dbSNP
rs1336279777 4335 dbSNP
rs904323489 4336 dbSNP
rs1384177119 4337 dbSNP
rs1159538022 4340 dbSNP
rs1043867775 4343 dbSNP
rs1011030901 4344 dbSNP
rs1178152503 4345 dbSNP
rs1458676698 4346 dbSNP
rs58814924 4347 dbSNP
rs1415187598 4348 dbSNP
rs1352473111 4350 dbSNP
rs770201370 4359 dbSNP
rs1186839155 4363 dbSNP
rs1472942450 4365 dbSNP
rs1238656553 4368 dbSNP
rs1190419572 4369 dbSNP
rs1445715121 4370 dbSNP
rs1397957371 4373 dbSNP
rs1268125153 4374 dbSNP
rs1209736709 4375 dbSNP
rs112380476 4376 dbSNP
rs1271472931 4377 dbSNP
rs1227916859 4378 dbSNP
rs1357346790 4379 dbSNP
rs1285969563 4387 dbSNP
rs1428725070 4388 dbSNP
rs1364364372 4389 dbSNP
rs1321199543 4390 dbSNP
rs1436974844 4392 dbSNP
rs894916438 4394 dbSNP
rs28415643 4396 dbSNP
rs939039912 4397 dbSNP
rs1157507013 4398 dbSNP
rs1162365044 4398 dbSNP
rs1162420444 4398 dbSNP
rs1170664187 4398 dbSNP
rs1186758047 4398 dbSNP
rs1220164529 4398 dbSNP
rs1223615558 4398 dbSNP
rs1224255317 4398 dbSNP
rs1245408004 4398 dbSNP
rs1253170225 4398 dbSNP
rs1263482852 4398 dbSNP
rs1268019258 4398 dbSNP
rs1287537638 4398 dbSNP
rs1292579507 4398 dbSNP
rs1297910344 4398 dbSNP
rs1357384973 4398 dbSNP
rs1360116905 4398 dbSNP
rs1361638674 4398 dbSNP
rs1366811094 4398 dbSNP
rs1374300892 4398 dbSNP
rs1383020038 4398 dbSNP
rs1385289727 4398 dbSNP
rs1407263810 4398 dbSNP
rs1417082779 4398 dbSNP
rs1422155064 4398 dbSNP
rs1427135387 4398 dbSNP
rs1427582545 4398 dbSNP
rs1442390057 4398 dbSNP
rs1445363758 4398 dbSNP
rs1485385230 4398 dbSNP
rs1489868248 4398 dbSNP
rs1490488399 4398 dbSNP
rs766149223 4398 dbSNP
rs779642916 4398 dbSNP
rs1344361537 4399 dbSNP
rs1454576857 4399 dbSNP
rs746199762 4399 dbSNP
rs1290982352 4401 dbSNP
rs1452144996 4402 dbSNP
rs1315876539 4403 dbSNP
rs1042306367 4405 dbSNP
rs1229968097 4406 dbSNP
rs945331964 4412 dbSNP
rs1316258087 4415 dbSNP
rs758070104 4417 dbSNP
rs1269752735 4427 dbSNP
rs1459740656 4430 dbSNP
rs1433486755 4431 dbSNP
rs1474829860 4432 dbSNP
rs1247926974 4435 dbSNP
rs915065290 4442 dbSNP
rs1243253383 4446 dbSNP
rs1473454670 4450 dbSNP
rs1175998760 4452 dbSNP
rs1407964273 4454 dbSNP
rs1420197301 4456 dbSNP
rs772659383 4463 dbSNP
rs192976584 4469 dbSNP
rs745316556 4472 dbSNP
rs1408410830 4474 dbSNP
rs1440189252 4475 dbSNP
rs867001242 4478 dbSNP
rs987837310 4482 dbSNP
rs1372575690 4486 dbSNP
rs1221311896 4493 dbSNP
rs1290010665 4495 dbSNP
rs1322483317 4515 dbSNP
rs1292369555 4517 dbSNP
rs1321100781 4518 dbSNP
rs28584993 4520 dbSNP
rs1201908054 4521 dbSNP
rs1231783367 4523 dbSNP
rs1481272568 4527 dbSNP
rs1026766503 4534 dbSNP
rs1298199672 4536 dbSNP
rs993736851 4538 dbSNP
rs1480283477 4540 dbSNP
rs1177587885 4543 dbSNP
rs963648508 4543 dbSNP
rs1230462207 4544 dbSNP
rs1328332314 4544 dbSNP
rs1222729500 4554 dbSNP
rs1343423971 4554 dbSNP
rs1355139584 4554 dbSNP
rs1433292015 4554 dbSNP
rs771338523 4554 dbSNP
rs1368722415 4555 dbSNP
rs1346729009 4557 dbSNP
rs1212412732 4559 dbSNP
rs1271702211 4561 dbSNP
rs1437842663 4568 dbSNP
rs1292666468 4577 dbSNP
rs1437017062 4580 dbSNP
rs547548980 4584 dbSNP
rs1013104958 4585 dbSNP
rs1428505439 4591 dbSNP
rs1390211920 4594 dbSNP
rs773164517 4594 dbSNP
rs1169961435 4596 dbSNP
rs1474562546 4606 dbSNP
rs1167516927 4618 dbSNP
rs1420320571 4620 dbSNP
rs894854740 4621 dbSNP
rs1363707838 4622 dbSNP
rs1404222476 4626 dbSNP
rs1303585946 4630 dbSNP
rs1332553084 4631 dbSNP
rs1423690698 4638 dbSNP
rs1190970040 4640 dbSNP
rs868122471 4641 dbSNP
rs1288924089 4642 dbSNP
rs1359423284 4644 dbSNP
rs113794906 4657 dbSNP
rs1292508953 4662 dbSNP
rs1445572980 4665 dbSNP
rs1192765215 4669 dbSNP
rs1242970102 4698 dbSNP
rs183018915 4699 dbSNP
rs1181865300 4701 dbSNP
rs1003744586 4703 dbSNP
rs28457680 4711 dbSNP
rs1042478021 4712 dbSNP
rs945269640 4715 dbSNP
rs1275371968 4717 dbSNP
rs1392638149 4719 dbSNP
rs1207393721 4725 dbSNP
rs1398799198 4727 dbSNP
rs1345639527 4732 dbSNP
rs1300577716 4736 dbSNP
rs1312309362 4738 dbSNP
rs915169528 4741 dbSNP
rs1219565224 4742 dbSNP
rs1381352677 4743 dbSNP
rs1369516359 4747 dbSNP
rs1277589067 4749 dbSNP
rs1349145893 4756 dbSNP
rs531590797 4757 dbSNP
rs1053515512 4759 dbSNP
rs1285351938 4763 dbSNP
rs753294513 4769 dbSNP
rs1242639187 4773 dbSNP
rs11637365 4774 dbSNP
rs1413455918 4774 dbSNP
rs1491284425 4775 dbSNP
rs200549578 4776 dbSNP
rs1157834706 4778 dbSNP
rs543003722 4778 dbSNP
rs1357911039 4784 dbSNP
rs573992564 4789 dbSNP
rs1458518584 4792 dbSNP
rs954986954 4793 dbSNP
rs1314241829 4795 dbSNP
rs1396164413 4795 dbSNP
rs560199257 4795 dbSNP
rs71888561 4795 dbSNP
rs72085374 4795 dbSNP
rs796940791 4795 dbSNP
rs1491530763 4796 dbSNP
rs542089216 4802 dbSNP
rs972078326 4802 dbSNP
rs1436032942 4807 dbSNP
rs1180950613 4813 dbSNP
rs540357994 4815 dbSNP
rs59544406 4816 dbSNP
rs963595743 4831 dbSNP
rs557896505 4838 dbSNP
rs1180492390 4839 dbSNP
rs544488525 4850 dbSNP
rs60903445 4851 dbSNP
rs1472349940 4858 dbSNP
rs1173970728 4861 dbSNP
rs58602942 4863 dbSNP
rs58837355 4866 dbSNP
rs1466202731 4870 dbSNP
rs1184426166 4871 dbSNP
rs1393628379 4872 dbSNP
rs1391352488 4874 dbSNP
rs1309095026 4887 dbSNP
rs1484760787 4889 dbSNP
rs1283011750 4900 dbSNP
rs1255308987 4901 dbSNP
rs1313052350 4910 dbSNP
rs369811028 4921 dbSNP
rs1249724299 4925 dbSNP
rs1338755302 4927 dbSNP
rs1195171876 4928 dbSNP
rs1252521317 4935 dbSNP
rs1483992389 4942 dbSNP
rs1197057964 4945 dbSNP
rs1267890320 4949 dbSNP
rs1313902039 4971 dbSNP
rs749581979 4973 dbSNP
rs1370844188 4974 dbSNP
rs1460988771 4977 dbSNP
rs1168672901 4987 dbSNP
rs1036304915 4988 dbSNP
rs1403615914 4993 dbSNP
rs1350725865 4994 dbSNP
rs1003284268 5000 dbSNP
rs906301750 5004 dbSNP
rs1377858348 5008 dbSNP
rs1302949742 5014 dbSNP
rs1229315861 5019 dbSNP
rs780133462 5021 dbSNP
rs751959064 5026 dbSNP
rs893683214 5032 dbSNP
rs756256968 5038 dbSNP
rs1220096398 5044 dbSNP
rs943314359 5048 dbSNP
rs888941764 5050 dbSNP
rs1361413057 5066 dbSNP
rs1259299266 5067 dbSNP
rs191469065 5071 dbSNP
rs186614661 5072 dbSNP
rs1412946421 5075 dbSNP
rs1350847928 5080 dbSNP
rs1459823168 5086 dbSNP
rs1184661737 5087 dbSNP
rs553825604 5088 dbSNP
rs533835422 5098 dbSNP
rs1182532927 5100 dbSNP
rs1436060238 5107 dbSNP
rs758289338 5122 dbSNP
rs1484154918 5126 dbSNP
rs1311844246 5129 dbSNP
rs972019429 5130 dbSNP
rs183470930 5136 dbSNP
rs1223548912 5138 dbSNP
rs1258718961 5141 dbSNP
rs909245421 5143 dbSNP
rs1207863499 5144 dbSNP
rs1329664137 5152 dbSNP
rs1269590903 5153 dbSNP
rs1249352659 5158 dbSNP
rs991735919 5164 dbSNP
rs571115003 5168 dbSNP
rs1231029409 5172 dbSNP
rs1320765036 5173 dbSNP
rs1312729756 5175 dbSNP
rs1397340266 5181 dbSNP
rs190906409 5187 dbSNP
rs1415244444 5190 dbSNP
rs959235466 5192 dbSNP
rs1381958631 5193 dbSNP
rs1157436995 5201 dbSNP
rs1344925943 5205 dbSNP
rs1457993613 5207 dbSNP
rs1322728234 5209 dbSNP
rs765140741 5212 dbSNP
rs1319196666 5218 dbSNP
rs1434786216 5219 dbSNP
rs754726850 5220 dbSNP
rs970466019 5235 dbSNP
rs1441972372 5242 dbSNP
rs1328152072 5260 dbSNP
rs1161856041 5268 dbSNP
rs187122132 5269 dbSNP
rs1368118210 5270 dbSNP
rs1208868500 5279 dbSNP
rs1237527252 5280 dbSNP
rs1484538417 5281 dbSNP
rs753570465 5284 dbSNP
rs1473087643 5286 dbSNP
rs893471901 5287 dbSNP
rs142444830 5288 dbSNP
rs1388221365 5302 dbSNP
rs1031992209 5304 dbSNP
rs114552735 5310 dbSNP
rs1465313186 5312 dbSNP
rs1249609244 5316 dbSNP
rs889045255 5326 dbSNP
rs1207849289 5328 dbSNP
rs1360929738 5332 dbSNP
rs569125758 5333 dbSNP
rs745958148 5338 dbSNP
rs1450137540 5346 dbSNP
rs1051581543 5349 dbSNP
rs530896240 5350 dbSNP
rs80209080 5354 dbSNP
rs1036438884 5369 dbSNP
rs942130059 5370 dbSNP
rs909193001 5372 dbSNP
rs149648501 5376 dbSNP
rs1296271193 5379 dbSNP
rs529230135 5385 dbSNP
rs768145223 5387 dbSNP
rs879334740 5395 dbSNP
rs560090517 5398 dbSNP
rs139358714 5400 dbSNP
rs540248888 5408 dbSNP
rs1366577627 5409 dbSNP
rs1483664281 5411 dbSNP
rs762351656 5416 dbSNP
rs533213714 5419 dbSNP
rs548733425 5421 dbSNP
rs8027688 5423 dbSNP
rs544789445 5429 dbSNP
rs987832787 5431 dbSNP
rs550835501 5432 dbSNP
rs575781919 5437 dbSNP
rs1459478019 5440 dbSNP
rs1169820585 5442 dbSNP
rs1388355158 5445 dbSNP
rs1369920034 5448 dbSNP
rs35243340 5449 dbSNP
rs528564100 5452 dbSNP
rs556003212 5463 dbSNP
rs542128685 5465 dbSNP
rs1435311857 5467 dbSNP
rs1392025150 5468 dbSNP
rs559329904 5469 dbSNP
rs1031940058 5470 dbSNP
rs1196468695 5486 dbSNP
rs1007655559 5488 dbSNP
rs1207872346 5488 dbSNP
rs1290056093 5493 dbSNP
rs1200010084 5500 dbSNP
rs183345120 5500 dbSNP
rs1432437786 5517 dbSNP
rs1267579406 5518 dbSNP
rs1474532405 5522 dbSNP
rs1188063682 5523 dbSNP
rs1390810881 5527 dbSNP
rs1030670295 5528 dbSNP
rs1170337263 5529 dbSNP
rs1388325764 5531 dbSNP
rs1211225400 5534 dbSNP
rs1323960231 5536 dbSNP
rs553758605 5539 dbSNP
rs1428187652 5549 dbSNP
rs191605066 5550 dbSNP
rs1205260861 5554 dbSNP
rs775827671 5556 dbSNP
rs1006294749 5560 dbSNP
rs1210855004 5568 dbSNP
rs1292444756 5570 dbSNP
rs1445520328 5577 dbSNP
rs887873068 5578 dbSNP
rs1248727150 5580 dbSNP
rs1451346860 5583 dbSNP
rs1055762362 5585 dbSNP
rs1181810033 5591 dbSNP
rs8027344 5594 dbSNP
rs1472406677 5596 dbSNP
rs928688673 5600 dbSNP
rs1415646321 5610 dbSNP
rs1455324015 5611 dbSNP
rs1330924325 5620 dbSNP
rs1388908487 5621 dbSNP
rs1046403578 5633 dbSNP
rs1302443714 5634 dbSNP
rs1388689420 5640 dbSNP
rs143067506 5641 dbSNP
rs1307498845 5654 dbSNP
rs1430550988 5655 dbSNP
rs1348902660 5657 dbSNP
rs1228029425 5666 dbSNP
rs1372310142 5680 dbSNP
rs1466416359 5684 dbSNP
rs1170794526 5686 dbSNP
rs1201892202 5687 dbSNP
rs186310656 5688 dbSNP
rs1441789672 5697 dbSNP
rs745976637 5704 dbSNP
rs1239004799 5705 dbSNP
rs561797023 5718 dbSNP
rs1471522898 5723 dbSNP
rs1158149381 5730 dbSNP
rs1412308400 5732 dbSNP
rs1200752665 5739 dbSNP
rs74531432 5740 dbSNP
rs1170324155 5741 dbSNP
rs757319684 5742 dbSNP
rs1397123931 5743 dbSNP
rs1336651849 5749 dbSNP
rs1250700625 5763 dbSNP
rs1182250085 5764 dbSNP
rs925036563 5766 dbSNP
rs549184561 5769 dbSNP
rs1331546100 5774 dbSNP
rs953153403 5776 dbSNP
rs1221858267 5783 dbSNP
rs1255497332 5791 dbSNP
rs1030035933 5801 dbSNP
rs1345742328 5801 dbSNP
rs997823743 5802 dbSNP
rs776611879 5803 dbSNP
rs1482014627 5804 dbSNP
rs961982129 5807 dbSNP
rs529120210 5808 dbSNP
rs1252215067 5810 dbSNP
rs1473387842 5812 dbSNP
rs1225737005 5817 dbSNP
rs768497552 5826 dbSNP
rs1196222595 5829 dbSNP
rs1376587779 5845 dbSNP
rs1466154820 5848 dbSNP
rs1173816120 5849 dbSNP
rs1014734847 5851 dbSNP
rs1006073949 5854 dbSNP
rs545968989 5867 dbSNP
rs369108858 5869 dbSNP
rs1300922658 5873 dbSNP
rs1410485634 5881 dbSNP
rs181113940 5886 dbSNP
rs1340001242 5887 dbSNP
rs1204303764 5891 dbSNP
rs1275097228 5892 dbSNP
rs907180522 5893 dbSNP
rs539939303 5900 dbSNP
rs1413781543 5902 dbSNP
rs1207828409 5910 dbSNP
rs946274189 5912 dbSNP
rs1433377683 5928 dbSNP
rs1200428973 5932 dbSNP
rs1402830433 5943 dbSNP
rs1387730651 5944 dbSNP
rs913504198 5951 dbSNP
rs1169721677 5957 dbSNP
rs1174104327 5959 dbSNP
rs1372936056 5978 dbSNP
rs1054514388 5981 dbSNP
rs1455494332 5982 dbSNP
rs1293272147 5984 dbSNP
rs1391793373 5986 dbSNP
rs936179773 5988 dbSNP
rs1295541354 5990 dbSNP
rs1364467538 5992 dbSNP
rs1227588764 5993 dbSNP
rs1298308536 5995 dbSNP
rs911427614 6000 dbSNP
rs986280238 6002 dbSNP
rs775364053 6005 dbSNP
rs1159496759 6006 dbSNP
rs1488615479 6007 dbSNP
rs1211223009 6014 dbSNP
rs931772065 6015 dbSNP
rs1464096718 6016 dbSNP
rs1188636090 6019 dbSNP
rs1392615319 6022 dbSNP
rs1422559627 6024 dbSNP
rs1235188381 6025 dbSNP
rs1186238767 6031 dbSNP
rs1459647251 6039 dbSNP
rs1318722487 6041 dbSNP
rs1442280197 6041 dbSNP
rs1388160807 6045 dbSNP
rs1435989716 6054 dbSNP
rs1297446440 6060 dbSNP
rs1364045302 6064 dbSNP
rs1226486941 6065 dbSNP
rs922914745 6079 dbSNP
rs771572394 6084 dbSNP
rs774487884 6091 dbSNP
rs1267932795 6098 dbSNP
rs1229193364 6099 dbSNP
rs1353126668 6100 dbSNP
rs1282435773 6101 dbSNP
rs1447480725 6104 dbSNP
rs975785497 6105 dbSNP
rs1226715250 6110 dbSNP
rs1243300032 6113 dbSNP
rs1157386240 6116 dbSNP
rs1181723855 6116 dbSNP
rs1257323769 6116 dbSNP
rs139579969 6116 dbSNP
rs1425984086 6116 dbSNP
rs1482582895 6116 dbSNP
rs775531774 6116 dbSNP
rs1338675106 6120 dbSNP
rs1385403137 6123 dbSNP
rs1161490473 6127 dbSNP
rs188156015 6131 dbSNP
rs1445736483 6142 dbSNP
rs116306466 6143 dbSNP
rs1320998812 6148 dbSNP
rs577067955 6152 dbSNP
rs146320183 6154 dbSNP
rs1416434422 6162 dbSNP
rs12901902 6163 dbSNP
rs1286204163 6164 dbSNP
rs1328073569 6173 dbSNP
rs1228585430 6183 dbSNP
rs951858703 6185 dbSNP
rs1411182487 6186 dbSNP
rs1034211806 6187 dbSNP
rs1257163343 6188 dbSNP
rs1162120827 6189 dbSNP
rs531055985 6193 dbSNP
rs1002013019 6195 dbSNP
rs1369525362 6202 dbSNP
rs1180527607 6204 dbSNP
rs1185927149 6217 dbSNP
rs907298775 6218 dbSNP
rs867469890 6228 dbSNP
rs1024704838 6232 dbSNP
rs1473059148 6235 dbSNP
rs1010196326 6244 dbSNP
rs1179100933 6247 dbSNP
rs1423167765 6256 dbSNP
rs562107971 6261 dbSNP
rs1359723493 6262 dbSNP
rs1436454135 6271 dbSNP
rs892013732 6271 dbSNP
rs1054627425 6276 dbSNP
rs543030030 6288 dbSNP
rs1209756716 6289 dbSNP
rs889932488 6300 dbSNP
rs542448485 6307 dbSNP
rs1227787163 6310 dbSNP
rs1365042484 6312 dbSNP
rs1357190576 6314 dbSNP
rs1049952608 6315 dbSNP
rs1301327895 6319 dbSNP
rs573528009 6321 dbSNP
rs779786798 6323 dbSNP
rs184968778 6329 dbSNP
rs1274375959 6332 dbSNP
rs1483552503 6334 dbSNP
rs1207046449 6335 dbSNP
rs923061544 6339 dbSNP
rs755762545 6342 dbSNP
rs749968125 6347 dbSNP
rs528155935 6348 dbSNP
rs767192487 6353 dbSNP
rs940333277 6356 dbSNP
rs1320899564 6357 dbSNP
rs1166580998 6359 dbSNP
rs907582365 6364 dbSNP
rs1330601141 6367 dbSNP
rs1347805213 6371 dbSNP
rs577602251 6382 dbSNP
rs1293634217 6384 dbSNP
rs1372457747 6386 dbSNP
rs952027336 6388 dbSNP
rs1347736857 6390 dbSNP
rs1343462309 6394 dbSNP
rs1216741392 6398 dbSNP
rs1288110298 6400 dbSNP
rs1322527050 6401 dbSNP
rs10603934 6403 dbSNP
rs1188006145 6403 dbSNP
rs1357016707 6403 dbSNP
rs1451284237 6403 dbSNP
rs759009580 6403 dbSNP
rs1389521018 6404 dbSNP
rs1475686492 6409 dbSNP
rs1169446177 6410 dbSNP
rs1411302785 6415 dbSNP
rs1034570278 6424 dbSNP
rs141847588 6433 dbSNP
rs1319277752 6434 dbSNP
rs1432341605 6434 dbSNP
rs1366590996 6446 dbSNP
rs148095869 6451 dbSNP
rs1282795434 6453 dbSNP
rs1356024521 6458 dbSNP
rs1166188970 6459 dbSNP
rs1024401056 6465 dbSNP
rs1275361576 6476 dbSNP
rs1010311016 6485 dbSNP
rs1208238498 6492 dbSNP
rs1248667351 6493 dbSNP
rs891793966 6500 dbSNP
rs1032997378 6503 dbSNP
rs1472377163 6515 dbSNP
rs77497333 6525 dbSNP
rs1419624405 6535 dbSNP
rs555231432 6536 dbSNP
rs1455274896 6541 dbSNP
rs752148367 6548 dbSNP
rs535273351 6556 dbSNP
rs1189599693 6563 dbSNP
rs1050324677 6567 dbSNP
rs1332839853 6571 dbSNP
rs998364736 6573 dbSNP
rs1245169106 6574 dbSNP
rs1449271449 6575 dbSNP
rs1295474197 6580 dbSNP
rs1221056010 6585 dbSNP
rs901373651 6594 dbSNP
rs1348885145 6598 dbSNP
rs1452430353 6600 dbSNP
rs1268852814 6613 dbSNP
rs566427144 6615 dbSNP
rs1198789291 6619 dbSNP
rs1276497876 6620 dbSNP
rs1293964141 6633 dbSNP
rs1203112613 6636 dbSNP
rs1188421262 6637 dbSNP
rs1259309102 6643 dbSNP
rs1341360976 6645 dbSNP
rs1180934244 6659 dbSNP
rs1364010436 6665 dbSNP
rs1040146466 6666 dbSNP
rs1454957855 6668 dbSNP
rs1402183694 6670 dbSNP
rs1315220697 6676 dbSNP
rs1298308711 6678 dbSNP
rs1369023504 6678 dbSNP
rs1337749492 6690 dbSNP
rs1231208242 6696 dbSNP
rs1274310816 6697 dbSNP
rs1216079096 6701 dbSNP
rs140649519 6703 dbSNP
rs1274054834 6735 dbSNP
rs940446882 6736 dbSNP
rs181920499 6737 dbSNP
rs907526614 6744