>VEGFA|NM_001025369|3'UTR
   1 CAAGCCGAGGCGGTGAGCCGGGCAGGAGGAAGGAGCCTCCCTCAGGGTTTCGGGAACCAGATCTCTCACCAGGAAAGACT
  81 GATACAGAACGATCGATACAGAAACCACGCTGCCGCCACCACACCATCACCATCGACAGAACAGTCCTTAATCCAGAAAC
 161 CTGAAATGAAGGAAGAGGAGACTCTGCGCAGAGCACTTTGGGTCCGGAGGGCGAGACTCCGGCGGAAGCATTCCCGGGCG
 241 GGTGACCCAGCACGGTCCCTCTTGGAATTGGATTCGCCATTTTATTTTTCTTGCTGCTAAATCACCGAGCCCGGAAGATT
 321 AGAGAGTTTTATTTCTGGGATTCCTGTAGACACACCCACCCACATACATACATTTATATATATATATATTATATATATAT
 401 AAAAATAAATATCTCTATTTTATATATATAAAATATATATATTCTTTTTTTAAATTAACAGTGCTAATGTTATTGGTGTC
 481 TTCACTGGATGTATTTGACTGCTGTGGACTTGAGTTGGGAGGGGAATGTTCCCACTCAGATCCTGACAGGGAAGAGGAGG
 561 AGATGAGAGACTCTGGCATGATCTTTTTTTTGTCCCACTTGGTGGGGCCAGGGTCCTCTCCCCTGCCCAGGAATGTGCAA
 641 GGCCAGGGCATGGGGGCAAATATGACCCAGTTTTGGGAACACCGACAAACCCAGCCCTGGCGCTGAGCCTCTCTACCCCA
 721 GGTCAGACGGACAGAAAGACAGATCACAGGTACAGGGATGAGGACACCGGCTCTGACCAGGAGTTTGGGGAGCTTCAGGA
 801 CATTGCTGTGCTTTGGGGATTCCCTCCACATGCTGCACGCGCATCTCGCCCCCAGGGGCACTGCCTGGAAGATTCAGGAG
 881 CCTGGGCGGCCTTCGCTTACTCTCACCTGCTTCTGAGTTGCCCAGGAGACCACTGGCAGATGTCCCGGCGAAGAGAAGAG
 961 ACACATTGTTGGAAGAAGCAGCCCATGACAGCTCCCCTTCCTGGGACTCGCCCTCATCCTCTTCCTGCTCCCCTTCCTGG
1041 GGTGCAGCCTAAAAGGACCTATGTCCTCACACCATTGAAACCACTAGTTCTGTCCCCCCAGGAGACCTGGTTGTGTGTGT
1121 GTGAGTGGTTGACCTTCCTCCATCCCCTGGTCCTTCCCTTCCCTTCCCGAGGCACAGAGAGACAGGGCAGGATCCACGTG
1201 CCCATTGTGGAGGCAGAGAAAAGAGAAAGTGTTTTATATACGGTACTTATTTAATATCCCTTTTTAATTAGAAATTAAAA
1281 CAGTTAATTTAATTAAAGAGTAGGGTTTTTTTTCAGTATTCTTGGTTAATATTTAATTTCAACTATTTATGAGATGTATC
1361 TTTTGCTCTCTCTTGCTCTCTTATTTGTACCGGTTTTTGTATATAAAATTCATGTTTCCAATCTCTCTCTCCCTGATCGG
1441 TGACAGTCACTAGCTTATCTTGAACAGATATTTAATTTTGCTAACACTCAGCTCTGCCCTCCCCGATCCCCTGGCTCCCC
1521 AGCACACATTCCTTTGAAATAAGGTTTCAATATACATCTACATACTATATATATATTTGGCAACTTGTATTTGTGTGTAT
1601 ATATATATATATATGTTTATGTATATATGTGATTCTGATAAAATAGACATTGCTATTCTGTTTTTTATATGTAAAAACAA
1681 AACAAGAAAAAATAGAGAATTCTACATACTAAATCTCTCTCCTTTTTTAATTTTAATATTTGTTATCATTTATTTATTGG
1761 TGCTACTGTTTATCCGTAATAATTGTGGGGAAAAGATATTAACATCACGTCTTTGTCTCTAGTGCAGTTTTTCGAGATAT
1841 TCCGTAGTACATATTTATTTTTAAACAACGACAAAGAAATACAGATATATCTTAAAAAAAAAAAAGCATTTTGTATTAAA
1921 GAATTTAATTCTGATCTCAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' guGUUUGGUAAUA--CACGACGAu 5' || ::||| | ||||||| Target 5' gcCATTTTATTTTTCTTGCTGCTa 3'	276 - 299	150.00	-12.82
2	miRNA 3' guguUUGGUAAUACACGACGAu 5' | ::|||: ||||| || Target 5' atttATTTATTG-GTGCTACTg 3'	1748 - 1768	125.00	-9.20
3	miRNA 3' guguuUGG--UA-AUACAC-GACGAu 5' ||: || ||| || ||||| Target 5' tcttcACTGGATGTATTTGACTGCTg 3'	479 - 504	123.00	-10.02

Mutant ID	Mutant Position	Mutant Source
COSM6846710	7	COSMIC
COSM6819794	11	COSMIC
COSM7497899	13	COSMIC
COSM7701081	13	COSMIC
COSM3627761	14	COSMIC
COSM7659088	16	COSMIC
COSN26958505	21	COSMIC
COSN30524014	29	COSMIC
COSN27004587	41	COSMIC
COSM9012089	52	COSMIC
COSM3352182	64	COSMIC
COSM3411133	77	COSMIC
COSM7974398	79	COSMIC
COSN30143001	88	COSMIC
COSN30102404	95	COSMIC
COSN31508134	96	COSMIC
COSN31596624	99	COSMIC
COSN30455964	114	COSMIC
COSN4893933	129	COSMIC
COSN30153771	136	COSMIC
COSN30476233	148	COSMIC
COSN30456378	154	COSMIC
COSN30133882	169	COSMIC
COSN30171185	169	COSMIC
COSN30584487	207	COSMIC
COSN31567017	221	COSMIC
COSN30158763	245	COSMIC
COSN167777	254	COSMIC
COSN30632779	277	COSMIC
COSN31485413	294	COSMIC
COSN31564704	314	COSMIC
COSN30541187	426	COSMIC
COSN31593685	466	COSMIC
COSN31522262	489	COSMIC
COSN31594835	539	COSMIC
COSN20274509	584	COSMIC
COSN21290319	729	COSMIC
COSN28703738	769	COSMIC
COSN30164957	927	COSMIC
COSN31545074	950	COSMIC
COSN2162691	1024	COSMIC
COSN24614414	1129	COSMIC
COSN31533515	1166	COSMIC
COSN31524418	1170	COSMIC
COSN31563310	1188	COSMIC
COSN28249886	1314	COSMIC
COSN31606167	1314	COSMIC
COSN7883560	1375	COSMIC
COSN8514383	1428	COSMIC
COSN31548668	1559	COSMIC
COSN28017862	1576	COSMIC
COSN7883561	1598	COSMIC
COSN23225630	1614	COSMIC
COSN31486284	1638	COSMIC
COSN31530820	1667	COSMIC
COSN31480000	1720	COSMIC
COSN31610033	1741	COSMIC
COSN31516478	1759	COSMIC
COSN30175512	1810	COSMIC
COSN19503017	1819	COSMIC
COSN20213960	1825	COSMIC
COSN31522645	1827	COSMIC
COSN31551365	1870	COSMIC
COSN27224860	1906	COSMIC
COSN31568751	1922	COSMIC
rs3025053	1043	GWAS

Mutant ID	Mutant Position	Mutant Source
rs748984440	1	dbSNP
rs371208770	4	dbSNP
rs1272402969	6	dbSNP
rs768366559	7	dbSNP
rs778358844	8	dbSNP
rs144772480	11	dbSNP
rs771561387	12	dbSNP
rs374253522	13	dbSNP
rs367809801	20	dbSNP
rs201575061	21	dbSNP
rs1159309955	27	dbSNP
rs769516531	28	dbSNP
rs1410335572	29	dbSNP
rs1046219704	37	dbSNP
rs1423738097	39	dbSNP
rs1459938559	39	dbSNP
rs1383348581	40	dbSNP
rs1169570968	41	dbSNP
rs775856114	42	dbSNP
rs1395831641	44	dbSNP
rs775012448	45	dbSNP
rs374044063	52	dbSNP
rs1335475234	56	dbSNP
rs917813568	62	dbSNP
rs202125661	64	dbSNP
rs774432825	65	dbSNP
rs1269130764	67	dbSNP
rs762001063	68	dbSNP
rs767672556	72	dbSNP
rs750489567	75	dbSNP
rs756142052	84	dbSNP
rs1249577551	87	dbSNP
rs1438175455	88	dbSNP
rs201001455	91	dbSNP
rs753667339	92	dbSNP
rs200439877	95	dbSNP
rs201676874	96	dbSNP
rs1418611973	99	dbSNP
rs1404175496	100	dbSNP
rs1347884113	106	dbSNP
rs372384354	108	dbSNP
rs770300127	109	dbSNP
rs775795841	110	dbSNP
rs111933757	112	dbSNP
rs1330516915	113	dbSNP
rs369043844	115	dbSNP
rs1413732811	116	dbSNP
rs1481115447	123	dbSNP
rs1293381502	126	dbSNP
rs1336225539	130	dbSNP
rs1216787567	131	dbSNP
rs774672415	132	dbSNP
rs376707517	135	dbSNP
rs1234890403	136	dbSNP
rs1205870489	140	dbSNP
rs753429817	143	dbSNP
rs931623857	146	dbSNP
rs187429037	156	dbSNP
rs891362263	166	dbSNP
rs1284892129	175	dbSNP
rs987423086	176	dbSNP
rs1222127052	182	dbSNP
rs578148161	186	dbSNP
rs112005313	187	dbSNP
rs1182403544	188	dbSNP
rs1377053612	196	dbSNP
rs1353903332	199	dbSNP
rs965161532	206	dbSNP
rs978846445	207	dbSNP
rs1406104557	209	dbSNP
rs112256643	213	dbSNP
rs936479141	214	dbSNP
rs988080022	218	dbSNP
rs1210630136	219	dbSNP
rs149179279	221	dbSNP
rs913819452	222	dbSNP
rs563703669	224	dbSNP
rs1232786789	225	dbSNP
rs1461834731	234	dbSNP
rs578064053	236	dbSNP
rs543089337	237	dbSNP
rs561490568	239	dbSNP
rs937769907	240	dbSNP
rs529074549	241	dbSNP
rs3025039	254	dbSNP
rs559522706	255	dbSNP
rs963141368	260	dbSNP
rs1382924269	263	dbSNP
rs1335433160	265	dbSNP
rs993623699	269	dbSNP
rs1026557481	276	dbSNP
rs973226910	277	dbSNP
rs1159368851	279	dbSNP
rs1400549113	282	dbSNP
rs1378787222	289	dbSNP
rs1185964647	290	dbSNP
rs778163655	307	dbSNP
rs890715188	308	dbSNP
rs533046584	313	dbSNP
rs551692177	314	dbSNP
rs1479430148	316	dbSNP
rs570044029	318	dbSNP
rs964713658	321	dbSNP
rs1215263426	323	dbSNP
rs537491073	325	dbSNP
rs1042624192	339	dbSNP
rs1033082420	343	dbSNP
rs549490546	345	dbSNP
rs902787596	349	dbSNP
rs1333377740	351	dbSNP
rs936794448	361	dbSNP
rs1363433630	372	dbSNP
rs1053987330	375	dbSNP
rs1289097615	375	dbSNP
rs895212897	375	dbSNP
rs567722917	377	dbSNP
rs1425661285	381	dbSNP
rs368441324	389	dbSNP
rs1186179862	390	dbSNP
rs1262436004	390	dbSNP
rs371875161	390	dbSNP
rs535119313	391	dbSNP
rs553262626	392	dbSNP
rs578135072	400	dbSNP
rs982021226	403	dbSNP
rs538948863	414	dbSNP
rs963275334	416	dbSNP
rs973196202	423	dbSNP
rs1028824123	430	dbSNP
rs1295623940	432	dbSNP
rs1213458290	434	dbSNP
rs1304581618	440	dbSNP
rs937671499	440	dbSNP
rs1238203994	443	dbSNP
rs1467779736	445	dbSNP
rs557256799	445	dbSNP
rs987593914	452	dbSNP
rs1191406667	462	dbSNP
rs1037894818	463	dbSNP
rs757492858	464	dbSNP
rs1169886788	467	dbSNP
rs1476863432	477	dbSNP
rs1378985785	479	dbSNP
rs1478270034	500	dbSNP
rs911648535	502	dbSNP
rs1266320765	506	dbSNP
rs1208019685	510	dbSNP
rs945680828	516	dbSNP
rs1251789402	522	dbSNP
rs1226146309	526	dbSNP
rs1315522300	528	dbSNP
rs929023157	540	dbSNP
rs1047886858	543	dbSNP
rs1299582804	568	dbSNP
rs1401171836	574	dbSNP
rs36001252	575	dbSNP
rs924176625	581	dbSNP
rs1440234937	583	dbSNP
rs1324204022	584	dbSNP
rs890601547	594	dbSNP
rs1333044240	601	dbSNP
rs1009117670	609	dbSNP
rs1437635641	611	dbSNP
rs559477981	617	dbSNP
rs1376875253	626	dbSNP
rs936930305	636	dbSNP
rs1039274565	643	dbSNP
rs560963332	644	dbSNP
rs1420652852	649	dbSNP
rs1251234417	650	dbSNP
rs1053956091	660	dbSNP
rs111590525	661	dbSNP
rs1203931487	663	dbSNP
rs1259234032	665	dbSNP
rs1000200646	684	dbSNP
rs1211266484	700	dbSNP
rs1269022481	702	dbSNP
rs185294556	703	dbSNP
rs956118182	710	dbSNP
rs1385119736	712	dbSNP
rs747321252	723	dbSNP
rs1187263279	728	dbSNP
rs771331791	729	dbSNP
rs906635173	730	dbSNP
rs1240099342	732	dbSNP
rs573628689	735	dbSNP
rs1364096972	742	dbSNP
rs530287018	745	dbSNP
rs1171357298	746	dbSNP
rs1437697716	748	dbSNP
rs1244871227	752	dbSNP
rs541137949	767	dbSNP
rs3025040	769	dbSNP
rs899086791	770	dbSNP
rs1206466612	771	dbSNP
rs1351851092	778	dbSNP
rs926554562	779	dbSNP
rs528762513	795	dbSNP
rs1238634262	803	dbSNP
rs750478984	806	dbSNP
rs959332666	808	dbSNP
rs973099534	816	dbSNP
rs920222087	826	dbSNP
rs1338721383	836	dbSNP
rs533184854	839	dbSNP
rs746442886	840	dbSNP
rs1019082216	841	dbSNP
rs912091383	842	dbSNP
rs769164425	848	dbSNP
rs1417601085	852	dbSNP
rs1039732235	853	dbSNP
rs114607160	855	dbSNP
rs563616137	859	dbSNP
rs1194914456	862	dbSNP
rs1447164963	869	dbSNP
rs1165908869	881	dbSNP
rs530836187	886	dbSNP
rs1054465756	888	dbSNP
rs891771619	889	dbSNP
rs778009175	892	dbSNP
rs1266641860	895	dbSNP
rs1228190758	896	dbSNP
rs1354375361	908	dbSNP
rs958268348	909	dbSNP
rs989696266	915	dbSNP
rs1204225098	920	dbSNP
rs190588351	921	dbSNP
rs1281668721	929	dbSNP
rs10434	930	dbSNP
rs1194111230	933	dbSNP
rs1046569871	935	dbSNP
rs1024374658	939	dbSNP
rs1474152384	947	dbSNP
rs970585789	948	dbSNP
rs1370228735	950	dbSNP
rs762477558	951	dbSNP
rs940800585	956	dbSNP
rs528542280	959	dbSNP
rs1802040	965	dbSNP
rs780389723	965	dbSNP
rs1458449719	966	dbSNP
rs542812735	967	dbSNP
rs1033895355	969	dbSNP
rs1158265666	984	dbSNP
rs959320221	985	dbSNP
rs41430645	994	dbSNP
rs1421982497	996	dbSNP
rs571724503	1010	dbSNP
rs1196527327	1011	dbSNP
rs889053103	1013	dbSNP
rs539264549	1015	dbSNP
rs1375393155	1025	dbSNP
rs950374975	1032	dbSNP
rs983187952	1033	dbSNP
rs911639125	1034	dbSNP
rs1347195644	1042	dbSNP
rs3025053	1043	dbSNP
rs1315397399	1049	dbSNP
rs1018802888	1052	dbSNP
rs1330804662	1060	dbSNP
rs1465703676	1061	dbSNP
rs1398840917	1066	dbSNP
rs1168139170	1073	dbSNP
rs1340601909	1074	dbSNP
rs1237683119	1076	dbSNP
rs182317842	1082	dbSNP
rs967528845	1082	dbSNP
rs1355323511	1083	dbSNP
rs1235155844	1085	dbSNP
rs974949193	1092	dbSNP
rs780075986	1095	dbSNP
rs536572716	1096	dbSNP
rs936286611	1099	dbSNP
rs1054700031	1101	dbSNP
rs1278142103	1107	dbSNP
rs1218494807	1110	dbSNP
rs747174244	1112	dbSNP
rs750140926	1112	dbSNP
rs891823874	1114	dbSNP
rs554910999	1117	dbSNP
rs946026389	1118	dbSNP
rs1045881192	1129	dbSNP
rs1328747281	1133	dbSNP
rs916787221	1141	dbSNP
rs552833857	1147	dbSNP
rs969693893	1152	dbSNP
rs907293552	1156	dbSNP
rs1424533026	1162	dbSNP
rs1001985161	1167	dbSNP
rs573618781	1169	dbSNP
rs1236857244	1176	dbSNP
rs1185538685	1177	dbSNP
rs767407432	1178	dbSNP
rs1378708490	1181	dbSNP
rs894943055	1191	dbSNP
rs994796268	1198	dbSNP
rs540750016	1199	dbSNP
rs1286032880	1205	dbSNP
rs1027510808	1224	dbSNP
rs950427338	1229	dbSNP
rs1305169953	1237	dbSNP
rs930617155	1239	dbSNP
rs1403528948	1242	dbSNP
rs553079671	1243	dbSNP
rs183460308	1261	dbSNP
rs188186771	1266	dbSNP
rs1301900924	1282	dbSNP
rs563477755	1282	dbSNP
rs1445303928	1284	dbSNP
rs889012828	1288	dbSNP
rs781756914	1289	dbSNP
rs1379071045	1295	dbSNP
rs1419446054	1295	dbSNP
rs1040602724	1306	dbSNP
rs540841861	1306	dbSNP
rs902983990	1306	dbSNP
rs1240373198	1315	dbSNP
rs1302201612	1316	dbSNP
rs1310273438	1317	dbSNP
rs1235131035	1319	dbSNP
rs1256590703	1322	dbSNP
rs1480233272	1325	dbSNP
rs1195320768	1326	dbSNP
rs530796133	1328	dbSNP
rs1242885426	1344	dbSNP
rs1217153992	1362	dbSNP
rs141683858	1366	dbSNP
rs1487833118	1367	dbSNP
rs566144283	1375	dbSNP
rs998690665	1377	dbSNP
rs1236385878	1384	dbSNP
rs561110106	1392	dbSNP
rs1179547642	1393	dbSNP
rs1394687532	1404	dbSNP
rs974876708	1412	dbSNP
rs1012981736	1420	dbSNP
rs1022651742	1422	dbSNP
rs1399841886	1428	dbSNP
rs922150020	1430	dbSNP
rs936146834	1431	dbSNP
rs866177519	1433	dbSNP
rs1035686035	1434	dbSNP
rs990438125	1439	dbSNP
rs41282644	1440	dbSNP
rs1378733321	1447	dbSNP
rs1424680592	1447	dbSNP
rs1461877796	1455	dbSNP
rs373941416	1458	dbSNP
rs1260712972	1495	dbSNP
rs972219770	1500	dbSNP
rs946247119	1502	dbSNP
rs920667200	1505	dbSNP
rs1049160	1506	dbSNP
rs1251883361	1511	dbSNP
rs986535970	1516	dbSNP
rs1217593105	1517	dbSNP
rs1338934938	1522	dbSNP
rs1285640131	1523	dbSNP
rs910587281	1526	dbSNP
rs907173870	1527	dbSNP
rs1390734609	1529	dbSNP
rs1292281454	1532	dbSNP
rs1463605064	1535	dbSNP
rs1401040618	1537	dbSNP
rs944711139	1544	dbSNP
rs181069410	1548	dbSNP
rs796446173	1551	dbSNP
rs895003063	1556	dbSNP
rs934450906	1557	dbSNP
rs1054316295	1563	dbSNP
rs1189338814	1568	dbSNP
rs1458715708	1570	dbSNP
rs1258090828	1590	dbSNP
rs1216761169	1592	dbSNP
rs994627281	1595	dbSNP
rs1259885197	1596	dbSNP
rs34241255	1598	dbSNP
rs370654536	1598	dbSNP
rs532477681	1598	dbSNP
rs147035281	1600	dbSNP
rs1377770130	1608	dbSNP
rs3025054	1613	dbSNP
rs549547019	1616	dbSNP
rs150363719	1618	dbSNP
rs995961655	1628	dbSNP
rs1173361780	1630	dbSNP
rs1466371933	1631	dbSNP
rs1029155433	1634	dbSNP
rs972188375	1639	dbSNP
rs1428258842	1653	dbSNP
rs1441524268	1657	dbSNP
rs553136985	1661	dbSNP
rs952122946	1669	dbSNP
rs1456063452	1670	dbSNP
rs1257856744	1676	dbSNP
rs1426397353	1679	dbSNP
rs1344793774	1681	dbSNP
rs957591908	1684	dbSNP
rs1242737371	1687	dbSNP
rs1355091784	1692	dbSNP
rs1309159530	1705	dbSNP
rs990322138	1707	dbSNP
rs1385009536	1709	dbSNP
rs1335108170	1714	dbSNP
rs1395626761	1715	dbSNP
rs913363312	1729	dbSNP
rs1163501700	1740	dbSNP
rs967640594	1744	dbSNP
rs796725834	1745	dbSNP
rs1380903852	1747	dbSNP
rs910629028	1749	dbSNP
rs1459081462	1766	dbSNP
rs944700713	1769	dbSNP
rs1187844012	1774	dbSNP
rs1293719095	1776	dbSNP
rs1253602433	1777	dbSNP
rs773067982	1786	dbSNP
rs778075982	1796	dbSNP
rs1219330561	1807	dbSNP
rs866951594	1809	dbSNP
rs937321687	1810	dbSNP
rs1280090418	1811	dbSNP
rs934586127	1812	dbSNP
rs1284907566	1818	dbSNP
rs567150308	1824	dbSNP
rs371781236	1834	dbSNP
rs931363788	1835	dbSNP
rs1401635629	1844	dbSNP
rs1048886254	1849	dbSNP
rs1320176024	1855	dbSNP
rs1360859863	1864	dbSNP
rs1297542595	1869	dbSNP
rs1417734801	1870	dbSNP
rs948564402	1871	dbSNP
rs1266240172	1888	dbSNP
rs1044129922	1894	dbSNP
rs1366408341	1894	dbSNP
rs869136464	1894	dbSNP
rs886252251	1895	dbSNP
rs1191952751	1896	dbSNP
rs1004772225	1897	dbSNP
rs1262868047	1899	dbSNP
rs1040674850	1900	dbSNP
rs1215113355	1901	dbSNP
rs901547945	1902	dbSNP
rs76989981	1905	dbSNP
rs534658089	1914	dbSNP
rs1209378776	1921	dbSNP

- PloS one, 2008

MicroRNAs (miRNAs) guide posttranscriptional repression of mRNAs. Hundreds of miRNAs have been identified but the target identification of mammalian mRNAs is still a difficult task due to a poor understanding of the interaction between miRNAs and the miRNA recognizing element (MRE). In recent research, the importance of the 5' end of the miRNA:MRE duplex has been emphasized and the effect of the tail region addressed, but the role of the central loop has largely remained unexplored. Here we examined the effect of the loop region in miRNA:MRE duplexes and found that the location of the central loop is one of the important factors affecting the efficiency of gene regulation mediated by miRNAs. It was further determined that the addition of a loop score combining both location and size as a new criterion for predicting MREs and their cognate miRNAs significantly decreased the false positive rates and increased the specificity of MRE prediction.

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Genes & development, 2011

MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.

- The EMBO journal, 2012

Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.

- Carcinogenesis, 2013

Deregulated microRNAs (miRNAs) and their roles in cancer development have attracted much attention. Two miRNAs, miR-15a and miR-16, which act as putative tumor suppressor by targeting the oncogene BCL2, have been implicated in cell cycle, apoptosis and proliferation. In this study, we investigated the possible role of miR-15a/16 in the angiogenesis of multiple myeloma (MM). Using a stem-loop quantitative reverse transcription-PCR, we analyzed miR-15a/16 expressions in bone marrow samples from newly diagnosed MM patients and a panel of MM cell lines. miRNA transfection, western blotting analysis and assay of luciferase activity were used to examine whether vascular endothelial growth factor (VEGF) is the target of miR-15a/16. The functional roles of miR-15a/16 on tumorigenesis and angiogenesis were examined by in vitro angiogenesis models and in vivo tumor xenograft model. We showed that miR-15a and miR-16 were significantly underexpressed in primary MM cells as well as in MM cell lines. The aberrant expression of miR-15a/16 was detected especially in advanced stage MM. In human MM cell lines and normal plasma cells, expression of miR-15a/16 inversely correlated with the expression of VEGF-A. Western blotting combined with the luciferase reporter assay demonstrated that VEGF-A was a direct target of miR-15a/16. Ectopic overexpression of miR-15a/16 led to decreased pro-angiogenic activity of MM cells. Finally, infection of lentivirus-miR-15a or lentivirus-miR-16 resulted in significant inhibition of tumor growth and angiogenesis in nude mice. This study suggest that miR-15a/16 could play a role in the tumorigenesis of MM at least in part by modulation of angiogenesis through targeting VEGF-A.

- Circulation research, 2013

RATIONALE: Circulating proangiogenic cells (PACs) support postischemic neovascularization. Cardiovascular disease and diabetes mellitus impair PAC regenerative capacities via molecular mechanisms that are not fully known. We hypothesize a role for microRNAs (miRs). Circulating miRs are currently investigated as potential diagnostic and prognostic biomarkers. OBJECTIVE: The objectives were the following: (1) to profile miR expression in PACs from critical limb ischemia (CLI) patients; (2) to demonstrate that miR-15a and miR-16 regulate PAC functions; and (3) to characterize circulating miR-15a and miR-16 and to investigate their potential biomarker value. METHODS AND RESULTS: Twenty-eight miRs potentially able to modulate angiogenesis were measured in PACs from CLI patients with and without diabetes mellitus and controls. miR-15a and miR-16 were further analyzed. CLI-PACs expressed higher level of mature miR-15a and miR-16 and of the primary transcript pri-miR-15a/16-1. miR-15a/16 overexpression impaired healthy PAC survival and migration. Conversely, miR-15a/16 inhibition improved CLI-PAC-defective migration. Vascular endothelial growth factor-A and AKT-3 were validated as direct targets of the 2 miRs, and their protein levels were reduced in miR-15a/16-overexpressing healthy PACs and in CLI-PACs. Transplantation of healthy PACs ex vivo-engineered with anti-miR-15a/16 improved postischemic blood flow recovery and muscular arteriole density in immunodeficient mice. miR-15a and miR-16 were present in human blood, including conjugated to argonaute-2 and in exosomes. Both miRs were increased in the serum of CLI patients and positively correlated with amputation after restenosis at 12 months postrevascularization of CLI type 2 diabetes mellitus patients. Serum miR-15a additionally correlated with restenosis at follow-up. CONCLUSIONS: Ex vivo miR-15a/16 inhibition enhances PAC therapeutic potential, and circulating miR-15a and miR-16 deserves further investigation as a prognostic biomarker in CLI patients undergoing revascularization.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome biology, 2014

BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.

- Oncotarget, 2016

Prostaglandin E-2 (PGE-2) promotes tumor angiogenesis via paracrine secretion of pro-angiogenic growth factors, such as vascular endothelial growth factor (VEGF). Since miRNAs regulate several cell processes, including angiogenesis, we sought to determine whether they would influence PGE-2-induced VEGF. We compared DU145 and PC3 prostate cancer cells bearing the mPGES-1 enzyme (mPGES-1+/+) and producing PGE-2, with those in which the enzyme was silenced or deleted (mPGES-1-/-). We demonstrated that mPGES-1/PGE-2 signaling decreased Dicer expression and miRNA biogenesis. Genome-wide sequencing of miRNAs revealed that miR-15a and miR-186, associated with expression of VEGF and hypoxia inducible factor-1alpha (HIF-1alpha), were down-regulated in mPGES-1+/+ cells. As a consequence, mPGES-1+/+ tumor cells expressed high levels of VEGF and HIF-1alpha, induced endothelial cells activation and formed highly vascularized tumors. Mir-186 mimic inhibited VEGF expression in mPGES-1+/+ tumor xenografts and reduced tumor growth. In human prostate cancer specimens, mPGES-1 was over-expressed in tumors with high Gleason score, elevated expression of VEGF and HIF-1alpha, high microvessel density and decreased expression of Dicer, miR15a and miR-186. Thus, clear evidence for regulating miRNA processing and VEGF output by intrinsic PGE-2 production provides a means to distinguish between aggressive and indolent prostate tumors and suggests a potential target for controlling tumor progression.