miRTarBase - #MIRT004275 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol VEGFA   
Synonyms MVCD1, VEGF, VPF
Description vascular endothelial growth factor A
Transcript NM_001025369   
Other Transcripts NM_001025367 , NM_001025368 , NM_001025366 , NM_001025370 , NM_001033756 , NM_001171622 , NM_001171623 , NM_001171624 , NM_001171625 , NM_001171626 , NM_001171627 , NM_001171628 , NM_001171629 , NM_001171630 , NM_003376   
Expression
Putative miRNA Targets on VEGFA
3'UTR of VEGFA
(miRNA target sites are highlighted)		 
>VEGFA|NM_001025369|3'UTR
   1 CAAGCCGAGGCGGTGAGCCGGGCAGGAGGAAGGAGCCTCCCTCAGGGTTTCGGGAACCAGATCTCTCACCAGGAAAGACT
  81 GATACAGAACGATCGATACAGAAACCACGCTGCCGCCACCACACCATCACCATCGACAGAACAGTCCTTAATCCAGAAAC
 161 CTGAAATGAAGGAAGAGGAGACTCTGCGCAGAGCACTTTGGGTCCGGAGGGCGAGACTCCGGCGGAAGCATTCCCGGGCG
 241 GGTGACCCAGCACGGTCCCTCTTGGAATTGGATTCGCCATTTTATTTTTCTTGCTGCTAAATCACCGAGCCCGGAAGATT
 321 AGAGAGTTTTATTTCTGGGATTCCTGTAGACACACCCACCCACATACATACATTTATATATATATATATTATATATATAT
 401 AAAAATAAATATCTCTATTTTATATATATAAAATATATATATTCTTTTTTTAAATTAACAGTGCTAATGTTATTGGTGTC
 481 TTCACTGGATGTATTTGACTGCTGTGGACTTGAGTTGGGAGGGGAATGTTCCCACTCAGATCCTGACAGGGAAGAGGAGG
 561 AGATGAGAGACTCTGGCATGATCTTTTTTTTGTCCCACTTGGTGGGGCCAGGGTCCTCTCCCCTGCCCAGGAATGTGCAA
 641 GGCCAGGGCATGGGGGCAAATATGACCCAGTTTTGGGAACACCGACAAACCCAGCCCTGGCGCTGAGCCTCTCTACCCCA
 721 GGTCAGACGGACAGAAAGACAGATCACAGGTACAGGGATGAGGACACCGGCTCTGACCAGGAGTTTGGGGAGCTTCAGGA
 801 CATTGCTGTGCTTTGGGGATTCCCTCCACATGCTGCACGCGCATCTCGCCCCCAGGGGCACTGCCTGGAAGATTCAGGAG
 881 CCTGGGCGGCCTTCGCTTACTCTCACCTGCTTCTGAGTTGCCCAGGAGACCACTGGCAGATGTCCCGGCGAAGAGAAGAG
 961 ACACATTGTTGGAAGAAGCAGCCCATGACAGCTCCCCTTCCTGGGACTCGCCCTCATCCTCTTCCTGCTCCCCTTCCTGG
1041 GGTGCAGCCTAAAAGGACCTATGTCCTCACACCATTGAAACCACTAGTTCTGTCCCCCCAGGAGACCTGGTTGTGTGTGT
1121 GTGAGTGGTTGACCTTCCTCCATCCCCTGGTCCTTCCCTTCCCTTCCCGAGGCACAGAGAGACAGGGCAGGATCCACGTG
1201 CCCATTGTGGAGGCAGAGAAAAGAGAAAGTGTTTTATATACGGTACTTATTTAATATCCCTTTTTAATTAGAAATTAAAA
1281 CAGTTAATTTAATTAAAGAGTAGGGTTTTTTTTCAGTATTCTTGGTTAATATTTAATTTCAACTATTTATGAGATGTATC
1361 TTTTGCTCTCTCTTGCTCTCTTATTTGTACCGGTTTTTGTATATAAAATTCATGTTTCCAATCTCTCTCTCCCTGATCGG
1441 TGACAGTCACTAGCTTATCTTGAACAGATATTTAATTTTGCTAACACTCAGCTCTGCCCTCCCCGATCCCCTGGCTCCCC
1521 AGCACACATTCCTTTGAAATAAGGTTTCAATATACATCTACATACTATATATATATTTGGCAACTTGTATTTGTGTGTAT
1601 ATATATATATATATGTTTATGTATATATGTGATTCTGATAAAATAGACATTGCTATTCTGTTTTTTATATGTAAAAACAA
1681 AACAAGAAAAAATAGAGAATTCTACATACTAAATCTCTCTCCTTTTTTAATTTTAATATTTGTTATCATTTATTTATTGG
1761 TGCTACTGTTTATCCGTAATAATTGTGGGGAAAAGATATTAACATCACGTCTTTGTCTCTAGTGCAGTTTTTCGAGATAT
1841 TCCGTAGTACATATTTATTTTTAAACAACGACAAAGAAATACAGATATATCTTAAAAAAAAAAAAGCATTTTGTATTAAA
1921 GAATTTAATTCTGATCTCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1 
miRNA  3' guGUUUGGUAAUA--CACGACGAu 5'
            ||  ::||| |   ||||||| 
Target 5' gcCATTTTATTTTTCTTGCTGCTa 3'
 		276 - 299 150.00 -12.82
2 
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              | ::|||: ||||| || 
Target 5' atttATTTATTG-GTGCTACTg 3'
 		1748 - 1768 125.00 -9.20
3 
miRNA  3' guguuUGG--UA-AUACAC-GACGAu 5'
               ||:  || ||| || ||||| 
Target 5' tcttcACTGGATGTATTTGACTGCTg 3'
 		479 - 504 123.00 -10.02
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM6846710 7 COSMIC
COSM6819794 11 COSMIC
COSM7497899 13 COSMIC
COSM7701081 13 COSMIC
COSM3627761 14 COSMIC
COSM7659088 16 COSMIC
COSN26958505 21 COSMIC
COSN30524014 29 COSMIC
COSN27004587 41 COSMIC
COSM9012089 52 COSMIC
COSM3352182 64 COSMIC
COSM3411133 77 COSMIC
COSM7974398 79 COSMIC
COSN30143001 88 COSMIC
COSN30102404 95 COSMIC
COSN31508134 96 COSMIC
COSN31596624 99 COSMIC
COSN30455964 114 COSMIC
COSN4893933 129 COSMIC
COSN30153771 136 COSMIC
COSN30476233 148 COSMIC
COSN30456378 154 COSMIC
COSN30133882 169 COSMIC
COSN30171185 169 COSMIC
COSN30584487 207 COSMIC
COSN31567017 221 COSMIC
COSN30158763 245 COSMIC
COSN167777 254 COSMIC
COSN30632779 277 COSMIC
COSN31485413 294 COSMIC
COSN31564704 314 COSMIC
COSN30541187 426 COSMIC
COSN31593685 466 COSMIC
COSN31522262 489 COSMIC
COSN31594835 539 COSMIC
COSN20274509 584 COSMIC
COSN21290319 729 COSMIC
COSN28703738 769 COSMIC
COSN30164957 927 COSMIC
COSN31545074 950 COSMIC
COSN2162691 1024 COSMIC
COSN24614414 1129 COSMIC
COSN31533515 1166 COSMIC
COSN31524418 1170 COSMIC
COSN31563310 1188 COSMIC
COSN28249886 1314 COSMIC
COSN31606167 1314 COSMIC
COSN7883560 1375 COSMIC
COSN8514383 1428 COSMIC
COSN31548668 1559 COSMIC
COSN28017862 1576 COSMIC
COSN7883561 1598 COSMIC
COSN23225630 1614 COSMIC
COSN31486284 1638 COSMIC
COSN31530820 1667 COSMIC
COSN31480000 1720 COSMIC
COSN31610033 1741 COSMIC
COSN31516478 1759 COSMIC
COSN30175512 1810 COSMIC
COSN19503017 1819 COSMIC
COSN20213960 1825 COSMIC
COSN31522645 1827 COSMIC
COSN31551365 1870 COSMIC
COSN27224860 1906 COSMIC
COSN31568751 1922 COSMIC
rs3025053 1043 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs748984440 1 dbSNP
rs371208770 4 dbSNP
rs1272402969 6 dbSNP
rs768366559 7 dbSNP
rs778358844 8 dbSNP
rs144772480 11 dbSNP
rs771561387 12 dbSNP
rs374253522 13 dbSNP
rs367809801 20 dbSNP
rs201575061 21 dbSNP
rs1159309955 27 dbSNP
rs769516531 28 dbSNP
rs1410335572 29 dbSNP
rs1046219704 37 dbSNP
rs1423738097 39 dbSNP
rs1459938559 39 dbSNP
rs1383348581 40 dbSNP
rs1169570968 41 dbSNP
rs775856114 42 dbSNP
rs1395831641 44 dbSNP
rs775012448 45 dbSNP
rs374044063 52 dbSNP
rs1335475234 56 dbSNP
rs917813568 62 dbSNP
rs202125661 64 dbSNP
rs774432825 65 dbSNP
rs1269130764 67 dbSNP
rs762001063 68 dbSNP
rs767672556 72 dbSNP
rs750489567 75 dbSNP
rs756142052 84 dbSNP
rs1249577551 87 dbSNP
rs1438175455 88 dbSNP
rs201001455 91 dbSNP
rs753667339 92 dbSNP
rs200439877 95 dbSNP
rs201676874 96 dbSNP
rs1418611973 99 dbSNP
rs1404175496 100 dbSNP
rs1347884113 106 dbSNP
rs372384354 108 dbSNP
rs770300127 109 dbSNP
rs775795841 110 dbSNP
rs111933757 112 dbSNP
rs1330516915 113 dbSNP
rs369043844 115 dbSNP
rs1413732811 116 dbSNP
rs1481115447 123 dbSNP
rs1293381502 126 dbSNP
rs1336225539 130 dbSNP
rs1216787567 131 dbSNP
rs774672415 132 dbSNP
rs376707517 135 dbSNP
rs1234890403 136 dbSNP
rs1205870489 140 dbSNP
rs753429817 143 dbSNP
rs931623857 146 dbSNP
rs187429037 156 dbSNP
rs891362263 166 dbSNP
rs1284892129 175 dbSNP
rs987423086 176 dbSNP
rs1222127052 182 dbSNP
rs578148161 186 dbSNP
rs112005313 187 dbSNP
rs1182403544 188 dbSNP
rs1377053612 196 dbSNP
rs1353903332 199 dbSNP
rs965161532 206 dbSNP
rs978846445 207 dbSNP
rs1406104557 209 dbSNP
rs112256643 213 dbSNP
rs936479141 214 dbSNP
rs988080022 218 dbSNP
rs1210630136 219 dbSNP
rs149179279 221 dbSNP
rs913819452 222 dbSNP
rs563703669 224 dbSNP
rs1232786789 225 dbSNP
rs1461834731 234 dbSNP
rs578064053 236 dbSNP
rs543089337 237 dbSNP
rs561490568 239 dbSNP
rs937769907 240 dbSNP
rs529074549 241 dbSNP
rs3025039 254 dbSNP
rs559522706 255 dbSNP
rs963141368 260 dbSNP
rs1382924269 263 dbSNP
rs1335433160 265 dbSNP
rs993623699 269 dbSNP
rs1026557481 276 dbSNP
rs973226910 277 dbSNP
rs1159368851 279 dbSNP
rs1400549113 282 dbSNP
rs1378787222 289 dbSNP
rs1185964647 290 dbSNP
rs778163655 307 dbSNP
rs890715188 308 dbSNP
rs533046584 313 dbSNP
rs551692177 314 dbSNP
rs1479430148 316 dbSNP
rs570044029 318 dbSNP
rs964713658 321 dbSNP
rs1215263426 323 dbSNP
rs537491073 325 dbSNP
rs1042624192 339 dbSNP
rs1033082420 343 dbSNP
rs549490546 345 dbSNP
rs902787596 349 dbSNP
rs1333377740 351 dbSNP
rs936794448 361 dbSNP
rs1363433630 372 dbSNP
rs1053987330 375 dbSNP
rs1289097615 375 dbSNP
rs895212897 375 dbSNP
rs567722917 377 dbSNP
rs1425661285 381 dbSNP
rs368441324 389 dbSNP
rs1186179862 390 dbSNP
rs1262436004 390 dbSNP
rs371875161 390 dbSNP
rs535119313 391 dbSNP
rs553262626 392 dbSNP
rs578135072 400 dbSNP
rs982021226 403 dbSNP
rs538948863 414 dbSNP
rs963275334 416 dbSNP
rs973196202 423 dbSNP
rs1028824123 430 dbSNP
rs1295623940 432 dbSNP
rs1213458290 434 dbSNP
rs1304581618 440 dbSNP
rs937671499 440 dbSNP
rs1238203994 443 dbSNP
rs1467779736 445 dbSNP
rs557256799 445 dbSNP
rs987593914 452 dbSNP
rs1191406667 462 dbSNP
rs1037894818 463 dbSNP
rs757492858 464 dbSNP
rs1169886788 467 dbSNP
rs1476863432 477 dbSNP
rs1378985785 479 dbSNP
rs1478270034 500 dbSNP
rs911648535 502 dbSNP
rs1266320765 506 dbSNP
rs1208019685 510 dbSNP
rs945680828 516 dbSNP
rs1251789402 522 dbSNP
rs1226146309 526 dbSNP
rs1315522300 528 dbSNP
rs929023157 540 dbSNP
rs1047886858 543 dbSNP
rs1299582804 568 dbSNP
rs1401171836 574 dbSNP
rs36001252 575 dbSNP
rs924176625 581 dbSNP
rs1440234937 583 dbSNP
rs1324204022 584 dbSNP
rs890601547 594 dbSNP
rs1333044240 601 dbSNP
rs1009117670 609 dbSNP
rs1437635641 611 dbSNP
rs559477981 617 dbSNP
rs1376875253 626 dbSNP
rs936930305 636 dbSNP
rs1039274565 643 dbSNP
rs560963332 644 dbSNP
rs1420652852 649 dbSNP
rs1251234417 650 dbSNP
rs1053956091 660 dbSNP
rs111590525 661 dbSNP
rs1203931487 663 dbSNP
rs1259234032 665 dbSNP
rs1000200646 684 dbSNP
rs1211266484 700 dbSNP
rs1269022481 702 dbSNP
rs185294556 703 dbSNP
rs956118182 710 dbSNP
rs1385119736 712 dbSNP
rs747321252 723 dbSNP
rs1187263279 728 dbSNP
rs771331791 729 dbSNP
rs906635173 730 dbSNP
rs1240099342 732 dbSNP
rs573628689 735 dbSNP
rs1364096972 742 dbSNP
rs530287018 745 dbSNP
rs1171357298 746 dbSNP
rs1437697716 748 dbSNP
rs1244871227 752 dbSNP
rs541137949 767 dbSNP
rs3025040 769 dbSNP
rs899086791 770 dbSNP
rs1206466612 771 dbSNP
rs1351851092 778 dbSNP
rs926554562 779 dbSNP
rs528762513 795 dbSNP
rs1238634262 803 dbSNP
rs750478984 806 dbSNP
rs959332666 808 dbSNP
rs973099534 816 dbSNP
rs920222087 826 dbSNP
rs1338721383 836 dbSNP
rs533184854 839 dbSNP
rs746442886 840 dbSNP
rs1019082216 841 dbSNP
rs912091383 842 dbSNP
rs769164425 848 dbSNP
rs1417601085 852 dbSNP
rs1039732235 853 dbSNP
rs114607160 855 dbSNP
rs563616137 859 dbSNP
rs1194914456 862 dbSNP
rs1447164963 869 dbSNP
rs1165908869 881 dbSNP
rs530836187 886 dbSNP
rs1054465756 888 dbSNP
rs891771619 889 dbSNP
rs778009175 892 dbSNP
rs1266641860 895 dbSNP
rs1228190758 896 dbSNP
rs1354375361 908 dbSNP
rs958268348 909 dbSNP
rs989696266 915 dbSNP
rs1204225098 920 dbSNP
rs190588351 921 dbSNP
rs1281668721 929 dbSNP
rs10434 930 dbSNP
rs1194111230 933 dbSNP
rs1046569871 935 dbSNP
rs1024374658 939 dbSNP
rs1474152384 947 dbSNP
rs970585789 948 dbSNP
rs1370228735 950 dbSNP
rs762477558 951 dbSNP
rs940800585 956 dbSNP
rs528542280 959 dbSNP
rs1802040 965 dbSNP
rs780389723 965 dbSNP
rs1458449719 966 dbSNP
rs542812735 967 dbSNP
rs1033895355 969 dbSNP
rs1158265666 984 dbSNP
rs959320221 985 dbSNP
rs41430645 994 dbSNP
rs1421982497 996 dbSNP
rs571724503 1010 dbSNP
rs1196527327 1011 dbSNP
rs889053103 1013 dbSNP
rs539264549 1015 dbSNP
rs1375393155 1025 dbSNP
rs950374975 1032 dbSNP
rs983187952 1033 dbSNP
rs911639125 1034 dbSNP
rs1347195644 1042 dbSNP
rs3025053 1043 dbSNP
rs1315397399 1049 dbSNP
rs1018802888 1052 dbSNP
rs1330804662 1060 dbSNP
rs1465703676 1061 dbSNP
rs1398840917 1066 dbSNP
rs1168139170 1073 dbSNP
rs1340601909 1074 dbSNP
rs1237683119 1076 dbSNP
rs182317842 1082 dbSNP
rs967528845 1082 dbSNP
rs1355323511 1083 dbSNP
rs1235155844 1085 dbSNP
rs974949193 1092 dbSNP
rs780075986 1095 dbSNP
rs536572716 1096 dbSNP
rs936286611 1099 dbSNP
rs1054700031 1101 dbSNP
rs1278142103 1107 dbSNP
rs1218494807 1110 dbSNP
rs747174244 1112 dbSNP
rs750140926 1112 dbSNP
rs891823874 1114 dbSNP
rs554910999 1117 dbSNP
rs946026389 1118 dbSNP
rs1045881192 1129 dbSNP
rs1328747281 1133 dbSNP
rs916787221 1141 dbSNP
rs552833857 1147 dbSNP
rs969693893 1152 dbSNP
rs907293552 1156 dbSNP
rs1424533026 1162 dbSNP
rs1001985161 1167 dbSNP
rs573618781 1169 dbSNP
rs1236857244 1176 dbSNP
rs1185538685 1177 dbSNP
rs767407432 1178 dbSNP
rs1378708490 1181 dbSNP
rs894943055 1191 dbSNP
rs994796268 1198 dbSNP
rs540750016 1199 dbSNP
rs1286032880 1205 dbSNP
rs1027510808 1224 dbSNP
rs950427338 1229 dbSNP
rs1305169953 1237 dbSNP
rs930617155 1239 dbSNP
rs1403528948 1242 dbSNP
rs553079671 1243 dbSNP
rs183460308 1261 dbSNP
rs188186771 1266 dbSNP
rs1301900924 1282 dbSNP
rs563477755 1282 dbSNP
rs1445303928 1284 dbSNP
rs889012828 1288 dbSNP
rs781756914 1289 dbSNP
rs1379071045 1295 dbSNP
rs1419446054 1295 dbSNP
rs1040602724 1306 dbSNP
rs540841861 1306 dbSNP
rs902983990 1306 dbSNP
rs1240373198 1315 dbSNP
rs1302201612 1316 dbSNP
rs1310273438 1317 dbSNP
rs1235131035 1319 dbSNP
rs1256590703 1322 dbSNP
rs1480233272 1325 dbSNP
rs1195320768 1326 dbSNP
rs530796133 1328 dbSNP
rs1242885426 1344 dbSNP
rs1217153992 1362 dbSNP
rs141683858 1366 dbSNP
rs1487833118 1367 dbSNP
rs566144283 1375 dbSNP
rs998690665 1377 dbSNP
rs1236385878 1384 dbSNP
rs561110106 1392 dbSNP
rs1179547642 1393 dbSNP
rs1394687532 1404 dbSNP
rs974876708 1412 dbSNP
rs1012981736 1420 dbSNP
rs1022651742 1422 dbSNP
rs1399841886 1428 dbSNP
rs922150020 1430 dbSNP
rs936146834 1431 dbSNP
rs866177519 1433 dbSNP
rs1035686035 1434 dbSNP
rs990438125 1439 dbSNP
rs41282644 1440 dbSNP
rs1378733321 1447 dbSNP
rs1424680592 1447 dbSNP
rs1461877796 1455 dbSNP
rs373941416 1458 dbSNP
rs1260712972 1495 dbSNP
rs972219770 1500 dbSNP
rs946247119 1502 dbSNP
rs920667200 1505 dbSNP
rs1049160 1506 dbSNP
rs1251883361 1511 dbSNP
rs986535970 1516 dbSNP
rs1217593105 1517 dbSNP
rs1338934938 1522 dbSNP
rs1285640131 1523 dbSNP
rs910587281 1526 dbSNP
rs907173870 1527 dbSNP
rs1390734609 1529 dbSNP
rs1292281454 1532 dbSNP
rs1463605064 1535 dbSNP
rs1401040618 1537 dbSNP
rs944711139 1544 dbSNP
rs181069410 1548 dbSNP
rs796446173 1551 dbSNP
rs895003063 1556 dbSNP
rs934450906 1557 dbSNP
rs1054316295 1563 dbSNP
rs1189338814 1568 dbSNP
rs1458715708 1570 dbSNP
rs1258090828 1590 dbSNP
rs1216761169 1592 dbSNP
rs994627281 1595 dbSNP
rs1259885197 1596 dbSNP
rs34241255 1598 dbSNP
rs370654536 1598 dbSNP
rs532477681 1598 dbSNP
rs147035281 1600 dbSNP
rs1377770130 1608 dbSNP
rs3025054 1613 dbSNP
rs549547019 1616 dbSNP
rs150363719 1618 dbSNP
rs995961655 1628 dbSNP
rs1173361780 1630 dbSNP
rs1466371933 1631 dbSNP
rs1029155433 1634 dbSNP
rs972188375 1639 dbSNP
rs1428258842 1653 dbSNP
rs1441524268 1657 dbSNP
rs553136985 1661 dbSNP
rs952122946 1669 dbSNP
rs1456063452 1670 dbSNP
rs1257856744 1676 dbSNP
rs1426397353 1679 dbSNP
rs1344793774 1681 dbSNP
rs957591908 1684 dbSNP
rs1242737371 1687 dbSNP
rs1355091784 1692 dbSNP
rs1309159530 1705 dbSNP
rs990322138 1707 dbSNP
rs1385009536 1709 dbSNP
rs1335108170 1714 dbSNP
rs1395626761 1715 dbSNP
rs913363312 1729 dbSNP
rs1163501700 1740 dbSNP
rs967640594 1744 dbSNP
rs796725834 1745 dbSNP
rs1380903852 1747 dbSNP
rs910629028 1749 dbSNP
rs1459081462 1766 dbSNP
rs944700713 1769 dbSNP
rs1187844012 1774 dbSNP
rs1293719095 1776 dbSNP
rs1253602433 1777 dbSNP
rs773067982 1786 dbSNP
rs778075982 1796 dbSNP
rs1219330561 1807 dbSNP
rs866951594 1809 dbSNP
rs937321687 1810 dbSNP
rs1280090418 1811 dbSNP
rs934586127 1812 dbSNP
rs1284907566 1818 dbSNP
rs567150308 1824 dbSNP
rs371781236 1834 dbSNP
rs931363788 1835 dbSNP
rs1401635629 1844 dbSNP
rs1048886254 1849 dbSNP
rs1320176024 1855 dbSNP
rs1360859863 1864 dbSNP
rs1297542595 1869 dbSNP
rs1417734801 1870 dbSNP
rs948564402 1871 dbSNP
rs1266240172 1888 dbSNP
rs1044129922 1894 dbSNP
rs1366408341 1894 dbSNP
rs869136464 1894 dbSNP
rs886252251 1895 dbSNP
rs1191952751 1896 dbSNP
rs1004772225 1897 dbSNP
rs1262868047 1899 dbSNP
rs1040674850 1900 dbSNP
rs1215113355 1901 dbSNP
rs901547945 1902 dbSNP
rs76989981 1905 dbSNP
rs534658089 1914 dbSNP
rs1209378776 1921 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Cos-7
Location of target site 3'UTR
Tools used in this research FindTar
Original Description (Extracted from the article) ... {This MTI is shown in Fig. 1 and Fig. 2} ...

- Ye W; Lv Q; Wong CK; Hu S; Fu C; Hua Z; Cai et al., 2008, PloS one.

Article - Ye W; Lv Q; Wong CK; Hu S; Fu C; Hua Z; Cai et al.
- PloS one, 2008
MicroRNAs (miRNAs) guide posttranscriptional repression of mRNAs. Hundreds of miRNAs have been identified but the target identification of mammalian mRNAs is still a difficult task due to a poor understanding of the interaction between miRNAs and the miRNA recognizing element (MRE). In recent research, the importance of the 5' end of the miRNA:MRE duplex has been emphasized and the effect of the tail region addressed, but the role of the central loop has largely remained unexplored. Here we examined the effect of the loop region in miRNA:MRE duplexes and found that the location of the central loop is one of the important factors affecting the efficiency of gene regulation mediated by miRNAs. It was further determined that the addition of a loop score combining both location and size as a new criterion for predicting MREs and their cognate miRNAs significantly decreased the false positive rates and increased the specificity of MRE prediction.
LinkOut: [PMID: 18320040]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 7422.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1 "HITS-CLIP data was present in GSM714643. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 7422.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions RPMI-8226 , ARH-77 , OPM-2 , U266
Location of target site 3'UTR
Tools used in this research microRNA.org , TargetRank , TargetScan
Original Description (Extracted from the article) ... Western blotting combined with the luciferase reporter assay demonstrated that VEGF-A was a direct target of miR-15a/16. ...

- Sun CY; She XM; Qin Y; Chu ZB; Chen L; Ai et al., 2013, Carcinogenesis.

Article - Sun CY; She XM; Qin Y; Chu ZB; Chen L; Ai et al.
- Carcinogenesis, 2013
Deregulated microRNAs (miRNAs) and their roles in cancer development have attracted much attention. Two miRNAs, miR-15a and miR-16, which act as putative tumor suppressor by targeting the oncogene BCL2, have been implicated in cell cycle, apoptosis and proliferation. In this study, we investigated the possible role of miR-15a/16 in the angiogenesis of multiple myeloma (MM). Using a stem-loop quantitative reverse transcription-PCR, we analyzed miR-15a/16 expressions in bone marrow samples from newly diagnosed MM patients and a panel of MM cell lines. miRNA transfection, western blotting analysis and assay of luciferase activity were used to examine whether vascular endothelial growth factor (VEGF) is the target of miR-15a/16. The functional roles of miR-15a/16 on tumorigenesis and angiogenesis were examined by in vitro angiogenesis models and in vivo tumor xenograft model. We showed that miR-15a and miR-16 were significantly underexpressed in primary MM cells as well as in MM cell lines. The aberrant expression of miR-15a/16 was detected especially in advanced stage MM. In human MM cell lines and normal plasma cells, expression of miR-15a/16 inversely correlated with the expression of VEGF-A. Western blotting combined with the luciferase reporter assay demonstrated that VEGF-A was a direct target of miR-15a/16. Ectopic overexpression of miR-15a/16 led to decreased pro-angiogenic activity of MM cells. Finally, infection of lentivirus-miR-15a or lentivirus-miR-16 resulted in significant inhibition of tumor growth and angiogenesis in nude mice. This study suggest that miR-15a/16 could play a role in the tumorigenesis of MM at least in part by modulation of angiogenesis through targeting VEGF-A.
LinkOut: [PMID: 23104180]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions PACs
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... VEGF-A and AKT3 Are Direct Targets of Both miR-15a and miR-16 ...

- Spinetti G; Fortunato O; Caporali A; et al., 2013, Circulation research.

Article - Spinetti G; Fortunato O; Caporali A; et al.
- Circulation research, 2013
RATIONALE: Circulating proangiogenic cells (PACs) support postischemic neovascularization. Cardiovascular disease and diabetes mellitus impair PAC regenerative capacities via molecular mechanisms that are not fully known. We hypothesize a role for microRNAs (miRs). Circulating miRs are currently investigated as potential diagnostic and prognostic biomarkers. OBJECTIVE: The objectives were the following: (1) to profile miR expression in PACs from critical limb ischemia (CLI) patients; (2) to demonstrate that miR-15a and miR-16 regulate PAC functions; and (3) to characterize circulating miR-15a and miR-16 and to investigate their potential biomarker value. METHODS AND RESULTS: Twenty-eight miRs potentially able to modulate angiogenesis were measured in PACs from CLI patients with and without diabetes mellitus and controls. miR-15a and miR-16 were further analyzed. CLI-PACs expressed higher level of mature miR-15a and miR-16 and of the primary transcript pri-miR-15a/16-1. miR-15a/16 overexpression impaired healthy PAC survival and migration. Conversely, miR-15a/16 inhibition improved CLI-PAC-defective migration. Vascular endothelial growth factor-A and AKT-3 were validated as direct targets of the 2 miRs, and their protein levels were reduced in miR-15a/16-overexpressing healthy PACs and in CLI-PACs. Transplantation of healthy PACs ex vivo-engineered with anti-miR-15a/16 improved postischemic blood flow recovery and muscular arteriole density in immunodeficient mice. miR-15a and miR-16 were present in human blood, including conjugated to argonaute-2 and in exosomes. Both miRs were increased in the serum of CLI patients and positively correlated with amputation after restenosis at 12 months postrevascularization of CLI type 2 diabetes mellitus patients. Serum miR-15a additionally correlated with restenosis at follow-up. CONCLUSIONS: Ex vivo miR-15a/16 inhibition enhances PAC therapeutic potential, and circulating miR-15a and miR-16 deserves further investigation as a prognostic biomarker in CLI patients undergoing revascularization.
LinkOut: [PMID: 23233752]
Experimental Support 8 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 7422.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 9 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166 , TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 10 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
Experimental Support 11 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions DU145 , HUVEC
Disease MIMAT0000068
Location of target site 3'UTR
Tools used in this research DIANA-microT , miRanda , miRBase Target Database , miRWALK , PicTar , TargetScan
Original Description (Extracted from the article) ... "The luciferase assays showed that compared with control ...

- Terzuoli E; Donnini S; Finetti F; Nesi G; et al., 2016, Oncotarget.

Article - Terzuoli E; Donnini S; Finetti F; Nesi G; et al.
- Oncotarget, 2016
Prostaglandin E-2 (PGE-2) promotes tumor angiogenesis via paracrine secretion of pro-angiogenic growth factors, such as vascular endothelial growth factor (VEGF). Since miRNAs regulate several cell processes, including angiogenesis, we sought to determine whether they would influence PGE-2-induced VEGF. We compared DU145 and PC3 prostate cancer cells bearing the mPGES-1 enzyme (mPGES-1+/+) and producing PGE-2, with those in which the enzyme was silenced or deleted (mPGES-1-/-). We demonstrated that mPGES-1/PGE-2 signaling decreased Dicer expression and miRNA biogenesis. Genome-wide sequencing of miRNAs revealed that miR-15a and miR-186, associated with expression of VEGF and hypoxia inducible factor-1alpha (HIF-1alpha), were down-regulated in mPGES-1+/+ cells. As a consequence, mPGES-1+/+ tumor cells expressed high levels of VEGF and HIF-1alpha, induced endothelial cells activation and formed highly vascularized tumors. Mir-186 mimic inhibited VEGF expression in mPGES-1+/+ tumor xenografts and reduced tumor growth. In human prostate cancer specimens, mPGES-1 was over-expressed in tumors with high Gleason score, elevated expression of VEGF and HIF-1alpha, high microvessel density and decreased expression of Dicer, miR15a and miR-186. Thus, clear evidence for regulating miRNA processing and VEGF output by intrinsic PGE-2 production provides a means to distinguish between aggressive and indolent prostate tumors and suggests a potential target for controlling tumor progression.
LinkOut: [PMID: 27322147]
Experimental Support 12 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293T
Disease osteoarthritis
Location of target site 3'UTR
Tools used in this research miRDB , TargetScan
Original Description (Extracted from the article) ... miR-15a-5p contributes to cell apoptosis and matrix degradation via inhibiting VEGFA//miR-15a-5p regulates viability and matrix degradation of OA and induced a new target for OA diagnosis and therapy ...

- Chen H; Tian Y, 2017, Bioscience trends.

Article - Chen H; Tian Y
- Bioscience trends, 2017
Previous studies demonstrated that miR-15a-5p was probably associated with human hepatocellular carcinoma, while the function of miR-15a-5p in OA (Osteoarthritis) still remains unknown. Here, we uncovered the potential role of miR-15a-5p on OA pathogenesis and confirmed its predicted target VEGFA (Vascular Endothelial Growth Factor A). Measured by RT-PCR, miR-15a-5p expression increased remarkably while VEGFA expression was significantly decreased in OA chondrocytes compared with normal conditions. According to Luciferase activity assay, miR-15a-5p directly targeted the 3'-UTR of VEGFA to inhibit its expression. Functional analysis including CCK-8 assay and flow cytometry revealed that overexpression of VEGFA or inhibition of miR-15a-5p promoted cell proliferation, suppressed cell apoptosis and reduced matrix degradation in OA chondrocytes. Moreover, rescue assays carried out with both expression of VEGFA and miR-15a-5p demonstrated that miR-15a-5p contributes to cell apoptosis and matrix degradation via inhibiting VEGFA. We further provided evidence that multiple proteins related to matrix synthesis were regulated by miR-15a-5p and VEGFA using Western blot and ELISA assays. Taken together, our findings elucidated an underlying mechanism by which miR-15a-5p regulates viability and matrix degradation of OA and indicated a new target for OA diagnosis and therapy.
LinkOut: [PMID: 27916780]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000372067.3 | 3UTR | GCCAUUUUAUUUUUCUUGCUGCUAAAUCACCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714643
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000372067.3 | 3UTR | CCAUUUUAUUUUUCUUGCUGCUAAAUCACCGAGCCCGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000372067.3 | 3UTR | CCAUUUUAUUUUUCUUGCUGCUAAAUCACCGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000372067.3 | 3UTR | UAUUUUUCUUGCUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000372067.3 | 3UTR | CCAUUUUAUUUUUCUUGCUGCUAAAUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000372067.3 | 3UTR | CCAUUUUAUUUUUCUUGCUGCUAAAUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000372067.3 | 3UTR | AUUCGCCAUUUUAUUUUUCUUGCUGCUAAAUCACCGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000372067.3 | 3UTR | CCAUUUUAUUUUUCUUGCUGCUAAAUCACCGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000372067.3 | 3UTR | CGCCAUUUUAUUUUUCUUGCUGCUAAAUCACCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000372067.3 | 3UTR | AUUCGCCAUUUUAUUUUUCUUGCUGCUAAAUCACCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000372067.3 | 3UTR | CCAUUUUAUUUUUCUUGCUGCUAAAUCACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000372067.3 | 3UTR | CCAUUUUAUUUUUCUUGCUGCUAAAUCACCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 13 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000372067.3 | 3UTR | AUUCGCCAUUUUAUUUUUCUUGCUGCUAAAUCACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 14 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000372067.3 | 3UTR | CCAUUUUAUUUUUCUUGCUGCUAAAUCACCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 15 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000372067.3 | 3UTR | CCAUUUUAUUUUUCUUGCUGCUAAAUCACCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
CLIP-seq Support 16 for dataset GSM1462573
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl BaL
Location of target site ENST00000372067.3 | 3UTR | CCAUUUUAUUUUUCUUGCUGCUAAAUCACCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
CLIP-seq Support 17 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000372067.3 | 3UTR | CCAUUUUAUUUUUCUUGCUGCUAAAUCACCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis -0.696 2.3e-4 -0.625 1.2e-3 21 Click to see details
GSE42095 Differentiated embryonic stem cells 0.471 1.2e-2 0.343 5.5e-2 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.433 1.5e-2 -0.342 4.7e-2 25 Click to see details
GSE14794 Lymphoblastoid cells 0.207 2.5e-2 0.194 3.3e-2 90 Click to see details
GSE26953 Aortic valvular endothelial cells -0.345 4.9e-2 -0.292 8.3e-2 24 Click to see details
GSE27834 Pluripotent stem cells -0.334 1.0e-1 -0.309 1.2e-1 16 Click to see details
GSE28260 Renal cortex and medulla 0.33 1.4e-1 0.231 2.2e-1 13 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.197 2.0e-1 -0.389 4.5e-2 20 Click to see details
GSE19536 Breast cancer 0.065 2.6e-1 0.008 4.7e-1 100 Click to see details
GSE19783 ER- ER- breast cancer 0.071 2.7e-1 -0.001 5.0e-1 79 Click to see details
GSE19783 ER+ ER+ breast cancer -0.146 2.7e-1 -0.194 2.1e-1 20 Click to see details
GSE17498 Multiple myeloma 0.09 2.9e-1 0.060 3.6e-1 40 Click to see details
GSE19350 CNS germ cell tumors 0.169 3.0e-1 0.112 3.6e-1 12 Click to see details
GSE21687 Ependynoma primary tumors -0.065 3.0e-1 -0.017 4.5e-1 64 Click to see details
GSE17306 Multiple myeloma 0.074 3.1e-1 0.063 3.3e-1 49 Click to see details
GSE21032 Prostate cancer 0.055 3.1e-1 0.069 2.7e-1 83 Click to see details
GSE28544 Breast cancer -0.086 3.4e-1 -0.440 1.6e-2 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.064 3.8e-1 0.030 4.4e-1 25 Click to see details
GSE32688 Pancreatic cancer 0.036 4.2e-1 -0.018 4.6e-1 32 Click to see details
GSE32688 Pancreatic cancer 0.036 4.2e-1 -0.018 4.6e-1 32 Click to see details
GSE32688 Pancreatic cancer 0.036 4.2e-1 -0.018 4.6e-1 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.468 0 0.428 0.01 32 Click to see details
BLCA 0.522 0.01 0.509 0.02 18 Click to see details
BRCA 0.183 0.05 0.143 0.1 84 Click to see details
KIRC 0.195 0.06 0.276 0.01 68 Click to see details
CHOL 0.469 0.1 0.617 0.04 9 Click to see details
HNSC 0.169 0.14 0.165 0.15 42 Click to see details
LIHC 0.147 0.16 0.116 0.21 49 Click to see details
CESC 0.88 0.16 0.500 0.33 3 Click to see details
PRAD 0.126 0.19 0.033 0.41 50 Click to see details
THCA 0.084 0.26 0.186 0.08 59 Click to see details
KIRP 0.11 0.27 0.220 0.11 32 Click to see details
UCEC 0.144 0.28 0.116 0.32 19 Click to see details
COAD 0.216 0.3 0.143 0.37 8 Click to see details
LUSC -0.078 0.32 -0.080 0.32 38 Click to see details
LUAD 0.134 0.34 0.133 0.34 12 Click to see details
PAAD 0.268 0.37 0.000 0.5 4 Click to see details
ESCA -0.089 0.4 0.173 0.31 11 Click to see details
PCPG -0.288 0.41 -0.500 0.33 3 Click to see details
KICH 0.033 0.44 0.066 0.38 25 Click to see details
KICH 0.033 0.44 0.066 0.38 25 Click to see details
KICH 0.033 0.44 0.066 0.38 25 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
694 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT736201 DRD1 dopamine receptor D1 3 0
MIRT735131 GSDMB gasdermin B 2 0
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT725130 SYNRG synergin gamma 2 2
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT717465 ADORA3 adenosine A3 receptor 2 2
MIRT716436 RAB15 RAB15, member RAS oncogene family 2 2
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 2 2
MIRT713423 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT701510 NEGR1 neuronal growth regulator 1 2 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT691713 FLOT2 flotillin 2 2 3
MIRT682518 GLP2R glucagon like peptide 2 receptor 2 2
MIRT682280 RS1 retinoschisin 1 2 2
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT659260 CUL3 cullin 3 5 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT655815 NOTCH2 notch 2 2 3
MIRT648788 KLHL40 kelch like family member 40 2 2
MIRT646599 ANKRD36 ankyrin repeat domain 36 2 2
MIRT645514 BSPRY B-box and SPRY domain containing 2 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 2 4
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT616471 ADRA2B adrenoceptor alpha 2B 2 2
MIRT614697 TRAK1 trafficking kinesin protein 1 2 2
MIRT576593 Npepps aminopeptidase puromycin sensitive 2 2
MIRT576100 Pdcd1 programmed cell death 1 2 5
MIRT575928 Dmpk dystrophia myotonica-protein kinase 2 7
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 4
MIRT574595 N4BP1 NEDD4 binding protein 1 2 3
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 2 4
MIRT574207 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT574062 PROSC pyridoxal phosphate binding protein 2 2
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 2 3
MIRT571824 PHF19 PHD finger protein 19 5 2
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT571431 RIF1 replication timing regulatory factor 1 2 2
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 2 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT570464 TLK1 tousled like kinase 1 2 3
MIRT568621 ACVR2A activin A receptor type 2A 2 2
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 2 2
MIRT568477 ARMC12 armadillo repeat containing 12 2 2
MIRT568143 CCDC88C coiled-coil domain containing 88C 2 2
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT567482 FZD9 frizzled class receptor 9 2 2
MIRT567450 GNG12 G protein subunit gamma 12 2 2
MIRT567017 KLHL15 kelch like family member 15 2 2
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT566654 NCKAP1 NCK associated protein 1 2 2
MIRT566122 RASEF RAS and EF-hand domain containing 2 2
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT564954 XKR7 XK related 7 2 2
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT564556 CCDC80 coiled-coil domain containing 80 2 2
MIRT564482 ZNF391 zinc finger protein 391 2 2
MIRT564336 CCNT1 cyclin T1 2 2
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT563507 DLGAP3 DLG associated protein 3 2 2
MIRT563090 SLC25A12 solute carrier family 25 member 12 2 3
MIRT562881 KIAA1456 KIAA1456 2 2
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT562031 LANCL1 LanC like 1 2 2
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT561404 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561153 KRT33B keratin 33B 2 2
MIRT560855 OSBPL3 oxysterol binding protein like 3 2 2
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 2 5
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559006 CA8 carbonic anhydrase 8 2 2
MIRT558664 CNKSR3 CNKSR family member 3 2 2
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558041 EXT1 exostosin glycosyltransferase 1 2 2
MIRT557484 GPR27 G protein-coupled receptor 27 2 4
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT555431 PPAP2B phospholipid phosphatase 3 2 2
MIRT555278 PRDM4 PR/SET domain 4 2 2
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555035 RAB23 RAB23, member RAS oncogene family 2 2
MIRT554965 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT554702 RNF149 ring finger protein 149 2 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT553777 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT553565 TMEM161B transmembrane protein 161B 2 2
MIRT553442 TPM3 tropomyosin 3 2 2
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT552348 ZNF704 zinc finger protein 704 2 2
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT551621 ZNF267 zinc finger protein 267 2 2
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT550827 FAM229B family with sequence similarity 229 member B 2 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT549389 AMOT angiomotin 2 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 2 3
MIRT549123 C11orf24 chromosome 11 open reading frame 24 2 4
MIRT549076 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT548946 CDK17 cyclin dependent kinase 17 2 3
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT548727 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548219 FKBP1A FK506 binding protein 1A 2 2
MIRT548018 GRB2 growth factor receptor bound protein 2 2 4
MIRT548001 HCFC2 host cell factor C2 2 4
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT547702 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547661 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 2 4
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547406 MKX mohawk homeobox 2 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 3
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547069 PNISR PNN interacting serine and arginine rich protein 2 3
MIRT546640 RTN4 reticulon 4 2 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT546611 SALL1 spalt like transcription factor 1 2 4
MIRT546118 USP48 ubiquitin specific peptidase 48 2 4
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 2
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545351 CCDC83 coiled-coil domain containing 83 2 2
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT544916 CLSPN claspin 2 2
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT543839 GSG1 germ cell associated 1 2 2
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543529 PRSS21 protease, serine 21 2 2
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT543310 ZNF585B zinc finger protein 585B 2 2
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT542837 PDCD1 programmed cell death 1 2 7
MIRT542810 PHC3 polyhomeotic homolog 3 2 3
MIRT541432 CBX4 chromobox 4 2 3
MIRT541217 HOXA10 homeobox A10 2 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT539902 RPL14 ribosomal protein L14 2 4
MIRT537815 EFNB2 ephrin B2 2 4
MIRT522778 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 5
MIRT521818 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT521207 SBNO1 strawberry notch homolog 1 2 6
MIRT521055 SLC2A3 solute carrier family 2 member 3 2 4
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT518533 FLCN folliculin 2 6
MIRT518095 TRIM35 tripartite motif containing 35 2 2
MIRT514042 ATG14 autophagy related 14 2 2
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 5
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 2 8
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 5
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 2 7
MIRT511847 GPATCH8 G-patch domain containing 8 2 5
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT509368 DMPK DM1 protein kinase 2 11
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 2 5
MIRT508041 AXIN2 axin 2 2 6
MIRT507877 CBX6 chromobox 6 2 2
MIRT507853 CCNE2 cyclin E2 2 6
MIRT507820 CDK1 cyclin dependent kinase 1 2 6
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 6
MIRT506854 KIF23 kinesin family member 23 2 7
MIRT506487 MYO5A myosin VA 2 7
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506166 PLAG1 PLAG1 zinc finger 2 9
MIRT506138 PLRG1 pleiotropic regulator 1 2 4
MIRT506112 PPIG peptidylprolyl isomerase G 2 6
MIRT505930 RCAN3 RCAN family member 3 2 4
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT505549 SNX16 sorting nexin 16 2 6
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 2 6
MIRT505398 TMEM100 transmembrane protein 100 2 2
MIRT505349 TMEM245 transmembrane protein 245 2 6
MIRT505116 YTHDC1 YTH domain containing 1 2 6
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT504540 ZNF620 zinc finger protein 620 2 6
MIRT504338 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT503140 ATG9A autophagy related 9A 2 7
MIRT502950 CDC37L1 cell division cycle 37 like 1 2 9
MIRT502922 CDCA4 cell division cycle associated 4 4 9
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502570 E2F7 E2F transcription factor 7 2 11
MIRT502496 FAM122B family with sequence similarity 122B 2 8
MIRT502151 KIF5B kinesin family member 5B 2 9
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT501089 SMAD7 SMAD family member 7 2 8
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT500936 SRPR SRP receptor alpha subunit 2 7
MIRT500860 SYPL1 synaptophysin like 1 2 8
MIRT500580 USP53 ubiquitin specific peptidase 53 2 2
MIRT500425 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500321 ZNF622 zinc finger protein 622 2 9
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT498984 ORC4 origin recognition complex subunit 4 2 8
MIRT497776 KIAA0895 KIAA0895 2 2
MIRT496019 CD180 CD180 molecule 2 2
MIRT495146 ZNRF1 zinc and ring finger 1 2 2
MIRT494354 CASKIN1 CASK interacting protein 1 2 2
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT487394 C10orf54 V-set immunoregulatory receptor 2 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT482581 ABHD2 abhydrolase domain containing 2 2 2
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482370 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT481181 AVL9 AVL9 cell migration associated 2 6
MIRT479988 CARD10 caspase recruitment domain family member 10 2 2
MIRT479457 CDK6 cyclin dependent kinase 6 2 2
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT476276 GNAL G protein subunit alpha L 2 6
MIRT476259 GNB1 G protein subunit beta 1 2 7
MIRT475843 HDGF heparin binding growth factor 2 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475539 HOXA3 homeobox A3 2 8
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT474318 LAMC1 laminin subunit gamma 1 2 2
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT472263 NFIC nuclear factor I C 2 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT471495 PDE4D phosphodiesterase 4D 2 4
MIRT471038 PISD phosphatidylserine decarboxylase 2 10
MIRT469415 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT469090 RNF168 ring finger protein 168 2 2
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT468151 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468052 SIK1 salt inducible kinase 1 2 3
MIRT467002 SSRP1 structure specific recognition protein 1 2 5
MIRT466917 STK38 serine/threonine kinase 38 2 10
MIRT466436 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466008 TMEM189 transmembrane protein 189 2 8
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT465570 TOB2 transducer of ERBB2, 2 2 2
MIRT465165 TSC22D2 TSC22 domain family member 2 2 2
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 3
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT463167 ZNF367 zinc finger protein 367 2 10
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT460438 DOCK11 dedicator of cytokinesis 11 2 2
MIRT460224 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT456867 ZNF460 zinc finger protein 460 2 10
MIRT454970 TPM2 tropomyosin 2 2 2
MIRT453754 CSNK1E casein kinase 1 epsilon 2 2
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT448440 TLL1 tolloid like 1 2 2
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 2
MIRT438610 RET ret proto-oncogene 3 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 2 2
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 2 7
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT313675 ITGA2 integrin subunit alpha 2 2 2
MIRT307141 CTDSPL CTD small phosphatase like 2 4
MIRT302825 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT300992 MTMR3 myotubularin related protein 3 2 2
MIRT300100 STRADB STE20-related kinase adaptor beta 2 2
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT295810 CHMP4B charged multivesicular body protein 4B 2 2
MIRT294283 ZFP28 ZFP28 zinc finger protein 2 2
MIRT289625 CBX2 chromobox 2 2 2
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT274741 RAB3IP RAB3A interacting protein 2 2
MIRT273665 HOXC8 homeobox C8 2 2
MIRT270552 SETD1B SET domain containing 1B 2 2
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT265076 CHEK1 checkpoint kinase 1 2 3
MIRT265056 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 3
MIRT256305 CDC42SE2 CDC42 small effector 2 2 2
MIRT255333 SRPRB SRP receptor beta subunit 2 5
MIRT251487 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT249449 ZNF691 zinc finger protein 691 2 4
MIRT248765 ATXN7L3B ataxin 7 like 3B 2 4
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT247236 ELK4 ELK4, ETS transcription factor 2 4
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 2 8
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 2 2
MIRT229343 ZNF449 zinc finger protein 449 2 2
MIRT224965 BAG4 BCL2 associated athanogene 4 2 2
MIRT223681 FZD6 frizzled class receptor 6 2 6
MIRT217743 TBPL1 TATA-box binding protein like 1 2 3
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT211199 FGF2 fibroblast growth factor 2 2 4
MIRT206020 NUP50 nucleoporin 50 2 7
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT204623 MOB4 MOB family member 4, phocein 2 8
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT196450 TAOK1 TAO kinase 1 2 2
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT191625 SLC39A9 solute carrier family 39 member 9 2 6
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT190184 GPR180 G protein-coupled receptor 180 2 6
MIRT189961 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 2 7
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT165883 CREBRF CREB3 regulatory factor 2 3
MIRT165172 GRAMD3 GRAM domain containing 2B 2 3
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT158990 EPT1 selenoprotein I 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT154043 RASSF2 Ras association domain family member 2 2 2
MIRT152922 NOL4L nucleolar protein 4 like 2 3
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 2 3
MIRT150354 IER2 immediate early response 2 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT142237 DCTN5 dynactin subunit 5 2 9
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 2 3
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT133769 SKI SKI proto-oncogene 2 3
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 3
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT117655 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT112969 LUZP1 leucine zipper protein 1 2 6
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 7
MIRT109240 ZNF275 zinc finger protein 275 2 2
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 3
MIRT106292 ZFHX4 zinc finger homeobox 4 2 6
MIRT104015 USP42 ubiquitin specific peptidase 42 2 6
MIRT103856 FOXK1 forkhead box K1 2 3
MIRT103092 MAFK MAF bZIP transcription factor K 2 5
MIRT102971 EN2 engrailed homeobox 2 2 6
MIRT102632 UBN2 ubinuclein 2 2 11
MIRT102434 CALU calumenin 2 3
MIRT100896 CD2AP CD2 associated protein 2 2
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 3 8
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT096234 CANX calnexin 2 2
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT091667 RARB retinoic acid receptor beta 2 6
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 2 3
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT088102 SEPT2 septin 2 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT087424 ZNRF3 zinc and ring finger 3 2 2
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT079655 NAPG NSF attachment protein gamma 2 12
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 2 2
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 2 7
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075249 SNTB2 syntrophin beta 2 2 4
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 5
MIRT071206 FCF1 FCF1, rRNA-processing protein 2 2
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 2 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT061244 AMOTL1 angiomotin like 1 2 12
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT057514 CEP55 centrosomal protein 55 2 8
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 11
MIRT054895 SOX5 SRY-box 5 2 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT053079 KLF4 Kruppel like factor 4 2 1
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051341 FASN fatty acid synthase 2 5
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 4 3
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT006913 IFNG interferon gamma 2 1
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006658 Ccnd1 cyclin D1 2 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 6 3
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004275 VEGFA vascular endothelial growth factor A 7 17
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT003899 APP amyloid beta precursor protein 4 3
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003334 AKT3 AKT serine/threonine kinase 3 3 6
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003330 RPS6 ribosomal protein S6 0 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 4 4
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT001228 CCNE1 cyclin E1 7 10
MIRT001227 CCND1 cyclin D1 6 8
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 4 5
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000285 CCND2 cyclin D2 4 7
MIRT000284 CDC25A cell division cycle 25A 4 4
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
Error report submission
MIRT ID*
Your e-Mail*
Memo*