miRTarBase - #MIRT003876 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NT5DC1   
Synonyms C6orf200, LP2642, NT5C2L1
Description 5'-nucleotidase domain containing 1
Transcript NM_152729   
Expression
Putative miRNA Targets on NT5DC1
3'UTR of NT5DC1
(miRNA target sites are highlighted)
>NT5DC1|NM_152729|3'UTR
   1 GTTGTCTTTACTGAAAAATGAAGTGAAGACCCATATATGCAGTTAAAAAAAAGTTAATTTTCAAAAAATACTGTAAAAGA
  81 CTTTAAGGAACAAGTTTTATTGACCAATAAGTTGATATTTGTCCATAGGTCTCCTTTCTATAAATCATCTTGATGTTTAA
 161 CAACTCTTATTATATTAAAATCTCAGTATCCTAAAACTTAGAACCTTATTGATATTTTCTATACAGTAGTTTTGTGATTA
 241 GAATTCACCTGGGGACACACACTCACACGCACAGTCACTCTTACACATATGCCTAGTCCAGTGGTTCTCAAAGTGTGATC
 321 CATAGACTAATAGCATAGCATTACCTGAGAACTTGATAATGCATATTTGCAGGCCCCACGCAAAACCTGCTGAATCAGAA
 401 GCTCTGAGAGTAAGGCCTACCAATCTGGTTTAACAAGCCCGTCAGGTGATTCTGATTTACAGTACAGTTTGAGACCCACT
 481 GGCTAGAACATATCCTCCAGAGACTTGGCTTAATTGGTCTGGGTAAATATGGCTGAGCGTTGTTATCTTTTGTTATCTTT
 561 TATATGCCCTAGGAAAGTACAACCAGAATTGAAAACCAACTGATCTATACCAGTTCTTTCAATTAATAGTCAAGAACATT
 641 GAGTCCAGTGAGATTAAGTGATTTTTGCAGGCTATGAGGTTTTATGCTATTCCTGTGTTCTCCAAAACAAGAAAATAAAA
 721 AGACATGACTTATTCTCTGTTCATACAGCAAGTATGGAAAAAAGATGATCTAGAAGTCAACTATCTCAACCTCCATTGTT
 801 ACCCACTAGGTTTTTTTCTAATAATGTTAAAGGCTATTTAATTTATTTAATCAACTTTAAGCATTACATTCTCAATTGGG
 881 GACAAAAATTGGTTCTTGGGGTGAAAAAATATTAGATATGGCTTGTGGACTTCCAATATCATCCTATCCAACAAAATCTT
 961 ATTCCTTAGTATTAATTTATCTCATTGGGAAGAAATTTGTAGTTAAAACTATTTAATGTAATTTGAATTTAATTTCTGTA
1041 ATTGGGAAGGAGGGTAATAATGAACAAAAAGTTTGAGAAAAAAATGCTTTAATGGGTTTTACAGGCATGCTACAATCCAG
1121 GACTGTGGTGTTCTATGTGCCGTGTATGGTCATATTAGTAGCTATTTGTTGCAAGATACTTGAAGCCAAATGTTTGCAGT
1201 ATAGGTTCCTGGCTACTGTTTATGCTGTGATTTCACTCTGTCTATCATGGGCAGTATTAGAAAACACACTGGTTTTCACT
1281 ATCTGGTTTACAAACACTATCATTATTTTACCTGGATTGAAGTGCAGAATTTGGCATATCGATGCATGCAATGGAAAGAA
1361 AAAAAATTTGTTAAAATTTGTAAATGTTCAGCTAAATCTCAGATATACTGTGGGATGAGTATCTCAGGGTAAGTAACAAA
1441 AAAACAAACAAAAAAAATCACTGAAATTTTTCCCTCACAGTCAGTAGCTTTGTTTGATATTTAACAATAAGTATATGGTG
1521 ATATACTTGAAATTTATGTCCAGAATGTCACTGGAATATTACAATGAGCATAAATAATCAAGCTTAGGACTAAATGAAAG
1601 ATACTATCTCATGTATGCTTTAAATAGAGAATTTATTTCTTTTAAAAATAAAGCTATTTTTCCTTAAAAAAAAAAAAAAA
1681 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGU-A---AUACACGACGau 5'
            || |::| |   ||| ||:|||  
Target 5' gtCATATTAGTAGCTATTTGTTGCaa 3'
1149 - 1174 120.00 -8.40
2
miRNA  3' guguuUGGUAAUACACGACGau 5'
               ||::|| | |||||:  
Target 5' tggctACTGTT-TATGCTGTga 3'
1210 - 1230 120.00 -6.80
3
miRNA  3' guGUUUGGUAAU-ACACGACGAu 5'
            ||| |||  | |||| ||:| 
Target 5' taCAATCCAGGACTGTGGTGTTc 3'
1111 - 1133 120.00 -13.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30114101 29 COSMIC
COSN30106049 50 COSMIC
COSN18730856 53 COSMIC
COSN30503141 57 COSMIC
COSN31542679 72 COSMIC
COSN30744111 112 COSMIC
COSN26817148 521 COSMIC
COSN16172851 741 COSMIC
COSN20103301 1013 COSMIC
COSN32064254 1019 COSMIC
COSN30170573 1278 COSMIC
COSN5618616 1364 COSMIC
COSN20103309 1458 COSMIC
COSN31485509 1469 COSMIC
COSN6722332 1508 COSMIC
COSN31523051 1513 COSMIC
COSN31527787 1535 COSMIC
COSN20488809 1862 COSMIC
COSN2135786 2437 COSMIC
COSN27341432 2471 COSMIC
COSN27462068 2471 COSMIC
COSN17894234 2500 COSMIC
COSN27751859 2814 COSMIC
COSN21531329 2875 COSMIC
COSN22547366 3068 COSMIC
COSN24829237 3205 COSMIC
COSN23140937 3367 COSMIC
COSN2135788 3575 COSMIC
COSN14846783 3587 COSMIC
COSN14786997 3729 COSMIC
COSN24941502 3823 COSMIC
COSN27955026 4183 COSMIC
COSN26717071 4231 COSMIC
COSN6722333 4347 COSMIC
COSN30397504 4849 COSMIC
COSN20388670 5153 COSMIC
COSN21184356 5181 COSMIC
COSN14753152 5411 COSMIC
COSN26152720 5450 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs41289920 2 dbSNP
rs1296245852 5 dbSNP
rs1387040361 6 dbSNP
rs1262084900 12 dbSNP
rs921712000 13 dbSNP
rs866663913 18 dbSNP
rs747480072 19 dbSNP
rs756835201 21 dbSNP
rs1473420041 22 dbSNP
rs553676300 26 dbSNP
rs1389197607 28 dbSNP
rs1231176904 31 dbSNP
rs1447271564 38 dbSNP
rs754090141 43 dbSNP
rs771415291 45 dbSNP
rs776921372 45 dbSNP
rs757261289 46 dbSNP
rs1360174631 51 dbSNP
rs1228183393 65 dbSNP
rs1473462640 70 dbSNP
rs1272055900 80 dbSNP
rs1228213286 81 dbSNP
rs1296533495 95 dbSNP
rs1397932411 114 dbSNP
rs1367135191 115 dbSNP
rs1323967072 118 dbSNP
rs1404752892 130 dbSNP
rs867787898 145 dbSNP
rs557703936 149 dbSNP
rs935281550 150 dbSNP
rs1056811736 165 dbSNP
rs1366692249 168 dbSNP
rs1422500465 170 dbSNP
rs1190979559 171 dbSNP
rs896309286 173 dbSNP
rs1270131610 183 dbSNP
rs749935496 188 dbSNP
rs1221274074 193 dbSNP
rs947917282 200 dbSNP
rs1275680110 202 dbSNP
rs1317316458 210 dbSNP
rs1276551815 218 dbSNP
rs763939936 219 dbSNP
rs1346375928 222 dbSNP
rs542029125 222 dbSNP
rs1275275588 224 dbSNP
rs1044459207 227 dbSNP
rs1348085391 238 dbSNP
rs905958304 247 dbSNP
rs1382977369 255 dbSNP
rs1465700930 261 dbSNP
rs1398834158 266 dbSNP
rs755893725 269 dbSNP
rs1324763252 270 dbSNP
rs563508796 271 dbSNP
rs1191017192 275 dbSNP
rs1477218853 279 dbSNP
rs1248208092 281 dbSNP
rs1402874394 282 dbSNP
rs1315668421 286 dbSNP
rs1358613044 287 dbSNP
rs575982682 288 dbSNP
rs1027623411 297 dbSNP
rs749154151 298 dbSNP
rs1205620997 302 dbSNP
rs375071675 302 dbSNP
rs1262268867 310 dbSNP
rs2235980 318 dbSNP
rs1218451880 321 dbSNP
rs1365151902 323 dbSNP
rs1204202670 327 dbSNP
rs1259148170 330 dbSNP
rs1447507623 350 dbSNP
rs1462292647 352 dbSNP
rs1376041399 359 dbSNP
rs1328744307 364 dbSNP
rs1470650382 368 dbSNP
rs1359409221 370 dbSNP
rs1183618809 374 dbSNP
rs1174851275 377 dbSNP
rs1386463587 380 dbSNP
rs1005116599 381 dbSNP
rs778939672 388 dbSNP
rs1236854732 397 dbSNP
rs1185532635 402 dbSNP
rs182798061 408 dbSNP
rs966228685 411 dbSNP
rs1208201290 414 dbSNP
rs558426980 419 dbSNP
rs974910610 422 dbSNP
rs1028713943 424 dbSNP
rs967804095 429 dbSNP
rs1454570573 431 dbSNP
rs1306933383 440 dbSNP
rs748011142 442 dbSNP
rs1382999046 449 dbSNP
rs1379182358 451 dbSNP
rs1454691765 457 dbSNP
rs1445437492 467 dbSNP
rs1346575094 468 dbSNP
rs1159672857 472 dbSNP
rs1337432389 473 dbSNP
rs979069373 474 dbSNP
rs573379285 477 dbSNP
rs564013734 490 dbSNP
rs770861368 495 dbSNP
rs1413246376 499 dbSNP
rs1450343890 508 dbSNP
rs772152323 515 dbSNP
rs1264128271 531 dbSNP
rs377244558 532 dbSNP
rs15679 539 dbSNP
rs1238010668 540 dbSNP
rs1322244208 540 dbSNP
rs1258607194 546 dbSNP
rs992082840 548 dbSNP
rs1325219920 562 dbSNP
rs546229838 566 dbSNP
rs529337982 570 dbSNP
rs947872625 582 dbSNP
rs1241971379 584 dbSNP
rs1358949710 587 dbSNP
rs1435082673 595 dbSNP
rs1458915794 597 dbSNP
rs1459545170 613 dbSNP
rs1162815456 623 dbSNP
rs1430337787 642 dbSNP
rs1180628496 649 dbSNP
rs1193139091 666 dbSNP
rs1044882540 672 dbSNP
rs1303540617 673 dbSNP
rs927350255 675 dbSNP
rs1420069319 686 dbSNP
rs930744669 717 dbSNP
rs1218768893 721 dbSNP
rs1319317574 725 dbSNP
rs562939998 726 dbSNP
rs201202601 730 dbSNP
rs1471077516 744 dbSNP
rs1337941776 745 dbSNP
rs568371606 747 dbSNP
rs1285637004 748 dbSNP
rs1177320119 752 dbSNP
rs1387675015 753 dbSNP
rs1390680778 756 dbSNP
rs114140740 775 dbSNP
rs1204827 776 dbSNP
rs569100511 777 dbSNP
rs1464311157 781 dbSNP
rs1040626080 789 dbSNP
rs1200774559 797 dbSNP
rs1372653103 799 dbSNP
rs902101620 806 dbSNP
rs1189332418 810 dbSNP
rs996317604 819 dbSNP
rs763111749 826 dbSNP
rs1163823336 830 dbSNP
rs1304562048 832 dbSNP
rs1315721523 838 dbSNP
rs145704354 842 dbSNP
rs1257351825 860 dbSNP
rs1234443487 862 dbSNP
rs1330822517 863 dbSNP
rs1029184947 864 dbSNP
rs1378271493 865 dbSNP
rs188225093 866 dbSNP
rs1444607773 869 dbSNP
rs1000607378 874 dbSNP
rs1173319857 876 dbSNP
rs1466365419 877 dbSNP
rs1376922700 884 dbSNP
rs1173678596 892 dbSNP
rs1223761788 904 dbSNP
rs1441519631 904 dbSNP
rs1238680379 920 dbSNP
rs1177497349 924 dbSNP
rs200386643 926 dbSNP
rs1426192902 928 dbSNP
rs1257849187 934 dbSNP
rs1031204468 936 dbSNP
rs1343840519 937 dbSNP
rs1254680107 938 dbSNP
rs956398626 940 dbSNP
rs1204828 952 dbSNP
rs1355089959 954 dbSNP
rs1309109654 962 dbSNP
rs751802551 966 dbSNP
rs1206726533 973 dbSNP
rs570855780 980 dbSNP
rs1395724064 1000 dbSNP
rs917807041 1002 dbSNP
rs1310886425 1008 dbSNP
rs1421246126 1009 dbSNP
rs140719 1010 dbSNP
rs58649705 1010 dbSNP
rs767181898 1010 dbSNP
rs375892459 1011 dbSNP
rs200489894 1013 dbSNP
rs1157912584 1014 dbSNP
rs201345590 1014 dbSNP
rs1048920 1019 dbSNP
rs1369757432 1024 dbSNP
rs553054142 1037 dbSNP
rs1200424940 1039 dbSNP
rs1253599289 1043 dbSNP
rs1428815628 1052 dbSNP
rs1219276370 1059 dbSNP
rs931175385 1070 dbSNP
rs1285937604 1072 dbSNP
rs1238697823 1078 dbSNP
rs1359061039 1079 dbSNP
rs1284903308 1085 dbSNP
rs574363432 1088 dbSNP
rs542092338 1090 dbSNP
rs1338955906 1093 dbSNP
rs1280281754 1096 dbSNP
rs190289711 1097 dbSNP
rs1049126337 1108 dbSNP
rs1355083648 1110 dbSNP
rs1398933633 1111 dbSNP
rs1254976910 1112 dbSNP
rs1392757204 1115 dbSNP
rs907990233 1118 dbSNP
rs940669013 1119 dbSNP
rs1296319650 1128 dbSNP
rs1366367057 1132 dbSNP
rs1367213917 1136 dbSNP
rs1477941831 1137 dbSNP
rs1405286439 1142 dbSNP
rs1040791732 1143 dbSNP
rs1343226006 1155 dbSNP
rs1453874165 1156 dbSNP
rs1291168450 1158 dbSNP
rs1209341449 1159 dbSNP
rs1354263004 1165 dbSNP
rs1280338296 1169 dbSNP
rs1215854914 1170 dbSNP
rs1219546178 1172 dbSNP
rs1340100217 1174 dbSNP
rs1277375720 1185 dbSNP
rs768018728 1190 dbSNP
rs996412908 1193 dbSNP
rs1308664236 1198 dbSNP
rs1404247299 1214 dbSNP
rs541396139 1220 dbSNP
rs904017274 1224 dbSNP
rs1465860049 1238 dbSNP
rs1422430601 1239 dbSNP
rs1490953153 1240 dbSNP
rs1185174735 1243 dbSNP
rs1223621721 1245 dbSNP
rs182804280 1252 dbSNP
rs1247811629 1264 dbSNP
rs1198691221 1266 dbSNP
rs1450388244 1268 dbSNP
rs549221009 1269 dbSNP
rs1199319275 1270 dbSNP
rs76809089 1281 dbSNP
rs1188428521 1282 dbSNP
rs1420330667 1283 dbSNP
rs764689590 1286 dbSNP
rs1030713114 1288 dbSNP
rs1427925317 1297 dbSNP
rs1275215007 1301 dbSNP
rs1166673484 1309 dbSNP
rs956666578 1310 dbSNP
rs1332837758 1316 dbSNP
rs540238245 1317 dbSNP
rs1425116030 1320 dbSNP
rs370464713 1326 dbSNP
rs565988807 1337 dbSNP
rs561638503 1342 dbSNP
rs1025077309 1343 dbSNP
rs530747533 1346 dbSNP
rs1240530757 1350 dbSNP
rs1179367947 1359 dbSNP
rs980642507 1359 dbSNP
rs919876794 1360 dbSNP
rs1212594301 1366 dbSNP
rs1432439484 1368 dbSNP
rs952543876 1369 dbSNP
rs983024043 1371 dbSNP
rs907924811 1379 dbSNP
rs1311304872 1380 dbSNP
rs1240257553 1381 dbSNP
rs1375423068 1392 dbSNP
rs1295939124 1395 dbSNP
rs187485875 1400 dbSNP
rs1360667829 1402 dbSNP
rs976216087 1409 dbSNP
rs1212260600 1423 dbSNP
rs1296078784 1426 dbSNP
rs550929405 1432 dbSNP
rs1159716749 1433 dbSNP
rs1439618874 1434 dbSNP
rs1405958698 1436 dbSNP
rs1183652676 1438 dbSNP
rs1483725352 1438 dbSNP
rs1362193923 1445 dbSNP
rs569164483 1446 dbSNP
rs144666526 1450 dbSNP
rs1050665552 1454 dbSNP
rs904108651 1457 dbSNP
rs936791083 1467 dbSNP
rs1242875475 1468 dbSNP
rs755181475 1476 dbSNP
rs1053045598 1478 dbSNP
rs753394812 1479 dbSNP
rs1283183955 1480 dbSNP
rs892190192 1482 dbSNP
rs1362922684 1489 dbSNP
rs1299174534 1496 dbSNP
rs1013731894 1506 dbSNP
rs1419677178 1506 dbSNP
rs1167039606 1507 dbSNP
rs1024752847 1510 dbSNP
rs1445160357 1521 dbSNP
rs1413363523 1534 dbSNP
rs1162755045 1539 dbSNP
rs904860856 1544 dbSNP
rs1411378168 1547 dbSNP
rs1001863623 1550 dbSNP
rs1402165810 1551 dbSNP
rs1478920708 1565 dbSNP
rs1159425060 1568 dbSNP
rs1026819437 1571 dbSNP
rs1217037019 1581 dbSNP
rs952644923 1584 dbSNP
rs1344192994 1589 dbSNP
rs982613308 1592 dbSNP
rs192365065 1594 dbSNP
rs551241309 1596 dbSNP
rs1271987762 1607 dbSNP
rs1231136028 1610 dbSNP
rs1341964919 1616 dbSNP
rs1453977250 1618 dbSNP
rs965270931 1630 dbSNP
rs976567073 1636 dbSNP
rs1204829 1659 dbSNP
rs147077531 1664 dbSNP
rs1458477921 1667 dbSNP
rs1349439054 1669 dbSNP
rs374643043 1670 dbSNP
rs1285277960 1688 dbSNP
rs747924864 1692 dbSNP
rs568146611 1693 dbSNP
rs1022239031 1697 dbSNP
rs903887675 1712 dbSNP
rs1427646144 1722 dbSNP
rs1206975574 1724 dbSNP
rs1245027962 1725 dbSNP
rs997053069 1734 dbSNP
rs1192921657 1737 dbSNP
rs1488759220 1744 dbSNP
rs1251890318 1748 dbSNP
rs1461778647 1775 dbSNP
rs1211245112 1778 dbSNP
rs55842313 1779 dbSNP
rs796129151 1779 dbSNP
rs199752027 1781 dbSNP
rs200696222 1782 dbSNP
rs201857846 1783 dbSNP
rs199760527 1784 dbSNP
rs955694664 1791 dbSNP
rs79375219 1792 dbSNP
rs1387914504 1793 dbSNP
rs1367484188 1795 dbSNP
rs1324012765 1796 dbSNP
rs978077892 1797 dbSNP
rs1401323233 1805 dbSNP
rs1170159704 1814 dbSNP
rs1455314337 1815 dbSNP
rs1371189945 1817 dbSNP
rs949611928 1821 dbSNP
rs557275153 1822 dbSNP
rs1406193464 1825 dbSNP
rs1191231806 1831 dbSNP
rs1458670223 1838 dbSNP
rs1468795111 1838 dbSNP
rs1194939430 1842 dbSNP
rs1479446690 1843 dbSNP
rs1046568654 1854 dbSNP
rs1015738187 1857 dbSNP
rs749762641 1859 dbSNP
rs17582201 1862 dbSNP
rs540031705 1863 dbSNP
rs1026626205 1872 dbSNP
rs973849465 1874 dbSNP
rs1328260765 1885 dbSNP
rs1389939594 1885 dbSNP
rs569707119 1897 dbSNP
rs1404580545 1922 dbSNP
rs888137191 1923 dbSNP
rs1466318869 1938 dbSNP
rs1004524088 1940 dbSNP
rs185778741 1941 dbSNP
rs572915197 1954 dbSNP
rs1441458528 1957 dbSNP
rs377002426 1966 dbSNP
rs976618418 1970 dbSNP
rs1350161632 1972 dbSNP
rs1030388448 1973 dbSNP
rs1226808464 1974 dbSNP
rs1219509736 1975 dbSNP
rs953457562 1975 dbSNP
rs986105500 1975 dbSNP
rs925253934 1976 dbSNP
rs958090722 1982 dbSNP
rs1236926491 1983 dbSNP
rs777664403 1984 dbSNP
rs980391266 1986 dbSNP
rs187443663 1988 dbSNP
rs573721456 2002 dbSNP
rs1415171643 2008 dbSNP
rs1374692328 2009 dbSNP
rs1310828640 2030 dbSNP
rs1421487975 2052 dbSNP
rs1361053014 2055 dbSNP
rs1157514167 2056 dbSNP
rs1395744368 2064 dbSNP
rs747113026 2082 dbSNP
rs1187902505 2091 dbSNP
rs1203065816 2100 dbSNP
rs1474669371 2107 dbSNP
rs1255911235 2110 dbSNP
rs1276482110 2114 dbSNP
rs1439458811 2122 dbSNP
rs1052970425 2130 dbSNP
rs913085638 2132 dbSNP
rs945444853 2139 dbSNP
rs1043830097 2142 dbSNP
rs903856395 2151 dbSNP
rs1201170103 2153 dbSNP
rs1429490050 2157 dbSNP
rs1291252738 2158 dbSNP
rs996812265 2159 dbSNP
rs888103307 2161 dbSNP
rs1050392809 2162 dbSNP
rs891398240 2168 dbSNP
rs1398879236 2171 dbSNP
rs1392332080 2172 dbSNP
rs1008784385 2173 dbSNP
rs1164982764 2175 dbSNP
rs1015752320 2180 dbSNP
rs1037319756 2197 dbSNP
rs544224531 2202 dbSNP
rs1478321925 2208 dbSNP
rs1242052972 2210 dbSNP
rs1453817497 2211 dbSNP
rs1268201033 2212 dbSNP
rs1400779086 2213 dbSNP
rs535505766 2214 dbSNP
rs1260182845 2217 dbSNP
rs1220249062 2218 dbSNP
rs562776343 2222 dbSNP
rs961563080 2232 dbSNP
rs998399872 2239 dbSNP
rs1412117955 2240 dbSNP
rs56370126 2244 dbSNP
rs953881744 2247 dbSNP
rs555083883 2248 dbSNP
rs958275695 2258 dbSNP
rs1285455381 2263 dbSNP
rs1419318990 2268 dbSNP
rs192735431 2275 dbSNP
rs1479311006 2282 dbSNP
rs1396169092 2288 dbSNP
rs1193109899 2289 dbSNP
rs979809338 2296 dbSNP
rs1467146558 2322 dbSNP
rs914104909 2327 dbSNP
rs1232677923 2330 dbSNP
rs1437440769 2335 dbSNP
rs527462389 2337 dbSNP
rs928512711 2338 dbSNP
rs148842669 2339 dbSNP
rs1347071937 2343 dbSNP
rs1282235359 2345 dbSNP
rs184525155 2354 dbSNP
rs746016521 2355 dbSNP
rs1303997111 2375 dbSNP
rs1232939134 2377 dbSNP
rs1368238584 2378 dbSNP
rs989157540 2379 dbSNP
rs1442545078 2382 dbSNP
rs913065177 2390 dbSNP
rs1341461459 2403 dbSNP
rs1327300782 2404 dbSNP
rs1196325276 2411 dbSNP
rs1376605713 2412 dbSNP
rs1173487423 2416 dbSNP
rs535457393 2417 dbSNP
rs1382301268 2427 dbSNP
rs1177822363 2429 dbSNP
rs1272125026 2438 dbSNP
rs947257356 2441 dbSNP
rs367912808 2443 dbSNP
rs1159954210 2445 dbSNP
rs1312631299 2445 dbSNP
rs1362963157 2445 dbSNP
rs1400136099 2445 dbSNP
rs140116058 2445 dbSNP
rs1433448195 2445 dbSNP
rs201432318 2445 dbSNP
rs57839520 2445 dbSNP
rs1406072423 2447 dbSNP
rs1183889978 2449 dbSNP
rs1043758875 2455 dbSNP
rs1475652475 2455 dbSNP
rs1258019647 2456 dbSNP
rs1186918223 2459 dbSNP
rs938215889 2466 dbSNP
rs925374358 2474 dbSNP
rs932621934 2475 dbSNP
rs1315741288 2479 dbSNP
rs1269199586 2485 dbSNP
rs1229731776 2491 dbSNP
rs909637762 2494 dbSNP
rs1413270650 2497 dbSNP
rs188676436 2497 dbSNP
rs9488875 2500 dbSNP
rs1008464317 2503 dbSNP
rs1037722100 2504 dbSNP
rs1368261166 2509 dbSNP
rs143511792 2512 dbSNP
rs573386571 2516 dbSNP
rs1343574151 2520 dbSNP
rs1169031964 2541 dbSNP
rs1462198570 2553 dbSNP
rs1417364151 2557 dbSNP
rs1163970534 2559 dbSNP
rs181373840 2567 dbSNP
rs1428276923 2571 dbSNP
rs1049701691 2572 dbSNP
rs1239903167 2573 dbSNP
rs1361797593 2596 dbSNP
rs889614189 2599 dbSNP
rs776068181 2611 dbSNP
rs1335101546 2614 dbSNP
rs573391981 2619 dbSNP
rs534394157 2627 dbSNP
rs1032801755 2635 dbSNP
rs1309706527 2636 dbSNP
rs905624077 2640 dbSNP
rs1001718530 2659 dbSNP
rs1035345023 2662 dbSNP
rs1295391673 2665 dbSNP
rs1441660076 2669 dbSNP
rs960013755 2673 dbSNP
rs988738132 2683 dbSNP
rs1009953236 2686 dbSNP
rs1020937108 2695 dbSNP
rs1020166921 2696 dbSNP
rs968484373 2699 dbSNP
rs978585148 2700 dbSNP
rs1417243659 2704 dbSNP
rs1468486281 2706 dbSNP
rs555548716 2710 dbSNP
rs1247978489 2724 dbSNP
rs1211506439 2730 dbSNP
rs763382845 2733 dbSNP
rs1481399953 2743 dbSNP
rs1292212141 2745 dbSNP
rs1488001609 2748 dbSNP
rs573733745 2759 dbSNP
rs959494735 2760 dbSNP
rs985974737 2766 dbSNP
rs544236476 2782 dbSNP
rs866897706 2787 dbSNP
rs746751301 2814 dbSNP
rs984263769 2815 dbSNP
rs912564117 2816 dbSNP
rs944043011 2833 dbSNP
rs909597488 2835 dbSNP
rs939806877 2837 dbSNP
rs1037244935 2840 dbSNP
rs111726320 2856 dbSNP
rs1352693629 2858 dbSNP
rs1191819971 2860 dbSNP
rs562435273 2867 dbSNP
rs1247994839 2868 dbSNP
rs369764981 2872 dbSNP
rs897428903 2888 dbSNP
rs1394007251 2907 dbSNP
rs931438034 2909 dbSNP
rs1165931849 2916 dbSNP
rs1167727015 2919 dbSNP
rs1386266815 2929 dbSNP
rs757731262 2929 dbSNP
rs922277420 2930 dbSNP
rs113393607 2933 dbSNP
rs1347761642 2935 dbSNP
rs1278334157 2953 dbSNP
rs1049669039 2957 dbSNP
rs80131465 2960 dbSNP
rs906052844 2962 dbSNP
rs184480015 2963 dbSNP
rs1035882200 2972 dbSNP
rs1389887033 2974 dbSNP
rs1348466984 2989 dbSNP
rs776627004 2994 dbSNP
rs1314466254 3000 dbSNP
rs1382885576 3014 dbSNP
rs1319964302 3017 dbSNP
rs895449141 3018 dbSNP
rs1010321215 3020 dbSNP
rs1435314126 3022 dbSNP
rs1363010594 3025 dbSNP
rs1374733420 3029 dbSNP
rs1171221100 3032 dbSNP
rs1454839030 3034 dbSNP
rs1054309075 3037 dbSNP
rs1463579096 3041 dbSNP
rs1315564254 3045 dbSNP
rs1180726883 3047 dbSNP
rs189150466 3054 dbSNP
rs893858661 3059 dbSNP
rs1189055966 3062 dbSNP
rs1020135941 3068 dbSNP
rs199882355 3071 dbSNP
rs552813105 3074 dbSNP
rs1350903998 3076 dbSNP
rs1206981602 3078 dbSNP
rs1207629353 3079 dbSNP
rs1351582418 3084 dbSNP
rs527538225 3090 dbSNP
rs765742533 3093 dbSNP
rs1260210141 3095 dbSNP
rs1009641524 3119 dbSNP
rs1337190261 3127 dbSNP
rs1294941065 3128 dbSNP
rs1021491197 3141 dbSNP
rs1462224674 3158 dbSNP
rs906541779 3161 dbSNP
rs968620907 3163 dbSNP
rs978678713 3178 dbSNP
rs753542741 3179 dbSNP
rs1385119046 3204 dbSNP
rs548718394 3205 dbSNP
rs561854598 3206 dbSNP
rs758139847 3209 dbSNP
rs1166119996 3213 dbSNP
rs1475047015 3217 dbSNP
rs1255845359 3219 dbSNP
rs1330131804 3226 dbSNP
rs912638826 3227 dbSNP
rs961871028 3237 dbSNP
rs972499021 3241 dbSNP
rs768835782 3244 dbSNP
rs1203427721 3246 dbSNP
rs1386550737 3247 dbSNP
rs972740311 3253 dbSNP
rs1233677196 3256 dbSNP
rs1333973941 3258 dbSNP
rs1282197215 3259 dbSNP
rs1229582368 3262 dbSNP
rs1326921690 3268 dbSNP
rs1317059080 3272 dbSNP
rs985132413 3278 dbSNP
rs918618296 3294 dbSNP
rs529311575 3313 dbSNP
rs931534193 3320 dbSNP
rs1048715471 3325 dbSNP
rs745333506 3326 dbSNP
rs1396712082 3336 dbSNP
rs906023002 3355 dbSNP
rs1308875427 3357 dbSNP
rs548480197 3359 dbSNP
rs937514661 3364 dbSNP
rs1412146299 3376 dbSNP
rs181920051 3377 dbSNP
rs1476047503 3383 dbSNP
rs1372962974 3386 dbSNP
rs895573996 3396 dbSNP
rs1054810848 3400 dbSNP
rs1265782435 3410 dbSNP
rs1009830029 3422 dbSNP
rs1253697725 3425 dbSNP
rs1213363766 3427 dbSNP
rs1325114524 3428 dbSNP
rs1203695179 3429 dbSNP
rs1287515370 3437 dbSNP
rs1197292594 3445 dbSNP
rs891619135 3457 dbSNP
rs1269457097 3461 dbSNP
rs1483204771 3467 dbSNP
rs1372616058 3471 dbSNP
rs1199152502 3478 dbSNP
rs1253114674 3483 dbSNP
rs1473085049 3484 dbSNP
rs1041353374 3514 dbSNP
rs945910743 3520 dbSNP
rs1410827910 3546 dbSNP
rs1042437002 3552 dbSNP
rs904222238 3553 dbSNP
rs1167330971 3571 dbSNP
rs1455953287 3574 dbSNP
rs1000069339 3575 dbSNP
rs1481488958 3582 dbSNP
rs1028902652 3585 dbSNP
rs1477180395 3585 dbSNP
rs1052443 3587 dbSNP
rs1358573360 3588 dbSNP
rs1009163592 3590 dbSNP
rs879052326 3592 dbSNP
rs1033661813 3593 dbSNP
rs533344852 3595 dbSNP
rs1280461658 3598 dbSNP
rs1299759911 3598 dbSNP
rs1396957330 3599 dbSNP
rs1005786359 3600 dbSNP
rs1408952732 3602 dbSNP
rs965830242 3604 dbSNP
rs972835283 3605 dbSNP
rs1346968257 3606 dbSNP
rs1223663446 3607 dbSNP
rs1442471294 3607 dbSNP
rs1335602408 3611 dbSNP
rs1306531697 3615 dbSNP
rs374153826 3623 dbSNP
rs961564189 3623 dbSNP
rs147976687 3641 dbSNP
rs1173115849 3648 dbSNP
rs952724099 3649 dbSNP
rs1410247834 3651 dbSNP
rs1231714882 3660 dbSNP
rs781183689 3662 dbSNP
rs1159424008 3668 dbSNP
rs567151498 3673 dbSNP
rs1469800455 3676 dbSNP
rs1029383274 3677 dbSNP
rs955120514 3693 dbSNP
rs1486625822 3704 dbSNP
rs985101449 3717 dbSNP
rs984338533 3720 dbSNP
rs1309994944 3726 dbSNP
rs9387388 3729 dbSNP
rs1224038611 3738 dbSNP
rs1349464570 3741 dbSNP
rs1286878026 3750 dbSNP
rs1416956052 3762 dbSNP
rs1356674775 3765 dbSNP
rs773466245 3789 dbSNP
rs555957318 3790 dbSNP
rs957060577 3791 dbSNP
rs990081099 3793 dbSNP
rs140720 3798 dbSNP
rs781249506 3798 dbSNP
rs1057487168 3800 dbSNP
rs1409973226 3800 dbSNP
rs1156705690 3814 dbSNP
rs1198945611 3815 dbSNP
rs917454679 3816 dbSNP
rs766858430 3823 dbSNP
rs1045989484 3824 dbSNP
rs769953127 3825 dbSNP
rs1041488881 3827 dbSNP
rs1243385100 3829 dbSNP
rs1191904488 3832 dbSNP
rs1464177930 3838 dbSNP
rs904191186 3840 dbSNP
rs1235535333 3842 dbSNP
rs1335991015 3845 dbSNP
rs1431448372 3846 dbSNP
rs1293039611 3847 dbSNP
rs1364652133 3858 dbSNP
rs999818790 3858 dbSNP
rs1289548410 3865 dbSNP
rs1430041717 3867 dbSNP
rs754335861 3873 dbSNP
rs1328259700 3890 dbSNP
rs1462147110 3891 dbSNP
rs1395004066 3892 dbSNP
rs141649709 3893 dbSNP
rs1422016172 3894 dbSNP
rs1428930131 3904 dbSNP
rs1050337141 3906 dbSNP
rs1421508830 3913 dbSNP
rs1186605913 3919 dbSNP
rs889042300 3929 dbSNP
rs754529762 3930 dbSNP
rs1008843902 3931 dbSNP
rs775836869 3932 dbSNP
rs1468619890 3933 dbSNP
rs961943351 3939 dbSNP
rs1219764443 3942 dbSNP
rs1309799616 3943 dbSNP
rs749696115 3945 dbSNP
rs1367111373 3947 dbSNP
rs1025741480 3954 dbSNP
rs1305687066 3973 dbSNP
rs1038577452 3974 dbSNP
rs1393966066 3987 dbSNP
rs1292509716 3999 dbSNP
rs1364916230 4000 dbSNP
rs537914614 4007 dbSNP
rs952652495 4008 dbSNP
rs1171135195 4027 dbSNP
rs994317892 4029 dbSNP
rs1029854133 4036 dbSNP
rs984140400 4037 dbSNP
rs955547698 4054 dbSNP
rs769105410 4057 dbSNP
rs927540704 4060 dbSNP
rs1189847870 4074 dbSNP
rs1481865139 4078 dbSNP
rs1006631936 4079 dbSNP
rs1252242694 4097 dbSNP
rs959200789 4099 dbSNP
rs73773832 4100 dbSNP
rs9488876 4115 dbSNP
rs544983352 4121 dbSNP
rs990231230 4124 dbSNP
rs1393356447 4125 dbSNP
rs1375320727 4126 dbSNP
rs545696640 4136 dbSNP
rs1246308635 4138 dbSNP
rs1487560857 4152 dbSNP
rs187419160 4157 dbSNP
rs1248637541 4164 dbSNP
rs1174991094 4165 dbSNP
rs772619013 4167 dbSNP
rs1376574326 4170 dbSNP
rs1173593999 4171 dbSNP
rs1420476424 4174 dbSNP
rs925721205 4178 dbSNP
rs928459686 4191 dbSNP
rs1482372041 4194 dbSNP
rs1260155725 4199 dbSNP
rs1211690536 4203 dbSNP
rs937207486 4205 dbSNP
rs1254317586 4206 dbSNP
rs1241497136 4212 dbSNP
rs1317702908 4214 dbSNP
rs1386862401 4217 dbSNP
rs376476257 4226 dbSNP
rs1408929423 4228 dbSNP
rs935637948 4229 dbSNP
rs1314736516 4232 dbSNP
rs916664848 4242 dbSNP
rs941335290 4245 dbSNP
rs1400924775 4247 dbSNP
rs1432332704 4249 dbSNP
rs1038789371 4255 dbSNP
rs1050499719 4273 dbSNP
rs1158912193 4281 dbSNP
rs897380418 4290 dbSNP
rs192088605 4291 dbSNP
rs1189343638 4295 dbSNP
rs1442318233 4297 dbSNP
rs1254206108 4301 dbSNP
rs1206923106 4309 dbSNP
rs944617708 4312 dbSNP
rs1486323394 4317 dbSNP
rs1267668248 4321 dbSNP
rs759063984 4324 dbSNP
rs1040324650 4325 dbSNP
rs1051374413 4332 dbSNP
rs1366636268 4339 dbSNP
rs1339767422 4341 dbSNP
rs1435030075 4345 dbSNP
rs1295961387 4360 dbSNP
rs1309987362 4361 dbSNP
rs897628092 4370 dbSNP
rs560720035 4380 dbSNP
rs1385481774 4383 dbSNP
rs1388927658 4386 dbSNP
rs531379595 4389 dbSNP
rs1229203287 4398 dbSNP
rs1289497852 4400 dbSNP
rs368748991 4419 dbSNP
rs544333773 4422 dbSNP
rs562989685 4423 dbSNP
rs533217315 4428 dbSNP
rs1195420402 4438 dbSNP
rs1186626157 4440 dbSNP
rs1261605684 4440 dbSNP
rs1429262204 4440 dbSNP
rs1207111022 4447 dbSNP
rs1469963646 4453 dbSNP
rs1005665271 4455 dbSNP
rs752304586 4456 dbSNP
rs1210166426 4466 dbSNP
rs958775721 4469 dbSNP
rs1263539024 4472 dbSNP
rs993482238 4472 dbSNP
rs879734138 4473 dbSNP
rs551706800 4479 dbSNP
rs1365369334 4490 dbSNP
rs567063096 4503 dbSNP
rs527956967 4504 dbSNP
rs967493298 4506 dbSNP
rs1181035445 4514 dbSNP
rs1411265032 4515 dbSNP
rs1402075472 4525 dbSNP
rs977570193 4526 dbSNP
rs926151065 4528 dbSNP
rs1170203787 4530 dbSNP
rs1430925255 4531 dbSNP
rs1389669419 4544 dbSNP
rs935732873 4546 dbSNP
rs1020354258 4547 dbSNP
rs1253804546 4548 dbSNP
rs758050153 4550 dbSNP
rs1199314219 4552 dbSNP
rs1287454245 4553 dbSNP
rs1450889703 4553 dbSNP
rs967102500 4556 dbSNP
rs180882861 4559 dbSNP
rs1342748827 4562 dbSNP
rs981318009 4563 dbSNP
rs1035608442 4592 dbSNP
rs528291290 4593 dbSNP
rs746846620 4594 dbSNP
rs1435289314 4599 dbSNP
rs910201002 4626 dbSNP
rs868316614 4638 dbSNP
rs371061298 4640 dbSNP
rs1411002498 4642 dbSNP
rs1449271413 4645 dbSNP
rs1283957116 4648 dbSNP
rs1166814548 4652 dbSNP
rs1436589680 4658 dbSNP
rs768550487 4659 dbSNP
rs1377353055 4672 dbSNP
rs1172274549 4681 dbSNP
rs763815944 4682 dbSNP
rs974207529 4697 dbSNP
rs751353417 4702 dbSNP
rs757205323 4703 dbSNP
rs1250896514 4705 dbSNP
rs1202929571 4706 dbSNP
rs1486398455 4707 dbSNP
rs918568832 4718 dbSNP
rs1218315978 4730 dbSNP
rs1289172727 4732 dbSNP
rs1281667899 4733 dbSNP
rs1229335743 4735 dbSNP
rs930027254 4735 dbSNP
rs17077720 4747 dbSNP
rs891392625 4768 dbSNP
rs929096277 4774 dbSNP
rs150166961 4776 dbSNP
rs887634995 4784 dbSNP
rs1442929812 4789 dbSNP
rs1006048507 4791 dbSNP
rs1034474973 4792 dbSNP
rs540395907 4797 dbSNP
rs1410366694 4803 dbSNP
rs1161108730 4805 dbSNP
rs893330688 4811 dbSNP
rs1410933897 4813 dbSNP
rs1011731370 4814 dbSNP
rs1484175289 4815 dbSNP
rs1020068743 4819 dbSNP
rs902843674 4823 dbSNP
rs1235538161 4835 dbSNP
rs556029126 4838 dbSNP
rs1285840519 4841 dbSNP
rs750520821 4842 dbSNP
rs894435483 4845 dbSNP
rs1014261503 4848 dbSNP
rs1208964061 4849 dbSNP
rs1002494960 4854 dbSNP
rs1035535427 4864 dbSNP
rs111460133 4869 dbSNP
rs571270974 4875 dbSNP
rs1380477905 4877 dbSNP
rs1283698158 4880 dbSNP
rs1410712337 4889 dbSNP
rs1445828034 4895 dbSNP
rs756173175 4898 dbSNP
rs1321535501 4907 dbSNP
rs977665210 4909 dbSNP
rs538262033 4910 dbSNP
rs559089769 4914 dbSNP
rs138729982 4918 dbSNP
rs780457083 4919 dbSNP
rs957593490 4923 dbSNP
rs986249287 4930 dbSNP
rs1414369527 4933 dbSNP
rs1180782582 4941 dbSNP
rs1471564017 4942 dbSNP
rs1249334336 4950 dbSNP
rs561713547 4965 dbSNP
rs1016491220 4968 dbSNP
rs963270688 4969 dbSNP
rs910304664 4972 dbSNP
rs1322855619 4973 dbSNP
rs185183506 4978 dbSNP
rs1227089092 4979 dbSNP
rs975787262 4985 dbSNP
rs1491388497 4986 dbSNP
rs147785414 4987 dbSNP
rs201343006 4987 dbSNP
rs1298379433 4988 dbSNP
rs1170432379 4999 dbSNP
rs749456244 5010 dbSNP
rs1363224874 5016 dbSNP
rs929191095 5021 dbSNP
rs542540726 5022 dbSNP
rs1318306726 5025 dbSNP
rs1459193393 5035 dbSNP
rs1350252709 5038 dbSNP
rs190041231 5045 dbSNP
rs1276675258 5049 dbSNP
rs1164071205 5061 dbSNP
rs1403515813 5069 dbSNP
rs769156889 5070 dbSNP
rs909039803 5076 dbSNP
rs942912938 5078 dbSNP
rs1188599410 5081 dbSNP
rs1039986705 5086 dbSNP
rs575872927 5087 dbSNP
rs1276369895 5094 dbSNP
rs1439369511 5095 dbSNP
rs937869318 5108 dbSNP
rs543600244 5116 dbSNP
rs1056245913 5120 dbSNP
rs1275465390 5121 dbSNP
rs562845082 5131 dbSNP
rs1401114967 5133 dbSNP
rs1041817749 5138 dbSNP
rs1305990550 5145 dbSNP
rs1387555605 5147 dbSNP
rs200236861 5149 dbSNP
rs140721 5150 dbSNP
rs35883814 5150 dbSNP
rs201379893 5153 dbSNP
rs533425265 5157 dbSNP
rs1372277204 5158 dbSNP
rs1477384184 5158 dbSNP
rs1428622039 5163 dbSNP
rs1172525026 5164 dbSNP
rs1014781366 5171 dbSNP
rs1177850975 5182 dbSNP
rs1433376516 5188 dbSNP
rs1424941482 5191 dbSNP
rs545089405 5192 dbSNP
rs1423655681 5202 dbSNP
rs1045688285 5209 dbSNP
rs903230302 5210 dbSNP
rs182578198 5215 dbSNP
rs1432058212 5223 dbSNP
rs1482150760 5226 dbSNP
rs1257813598 5242 dbSNP
rs187280765 5248 dbSNP
rs1311788328 5249 dbSNP
rs201238430 5252 dbSNP
rs1221400042 5265 dbSNP
rs779478894 5269 dbSNP
rs1308619504 5277 dbSNP
rs1325702074 5281 dbSNP
rs957731116 5285 dbSNP
rs1409112653 5288 dbSNP
rs1204830 5302 dbSNP
rs772503457 5303 dbSNP
rs965811626 5331 dbSNP
rs561560854 5332 dbSNP
rs531991968 5337 dbSNP
rs1228961344 5339 dbSNP
rs1273640039 5345 dbSNP
rs550306364 5346 dbSNP
rs1026121981 5347 dbSNP
rs1471880423 5348 dbSNP
rs1339722439 5358 dbSNP
rs559647727 5358 dbSNP
rs1399334237 5364 dbSNP
rs1258392123 5368 dbSNP
rs1224286145 5369 dbSNP
rs1201062415 5370 dbSNP
rs773719728 5377 dbSNP
rs758997283 5382 dbSNP
rs1450586043 5384 dbSNP
rs190518093 5390 dbSNP
rs1245546759 5405 dbSNP
rs1331007745 5410 dbSNP
rs909134226 5410 dbSNP
rs1055814 5411 dbSNP
rs867461110 5426 dbSNP
rs917763880 5427 dbSNP
rs964076752 5430 dbSNP
rs1314261879 5439 dbSNP
rs950158721 5442 dbSNP
rs775134008 5447 dbSNP
rs141864230 5450 dbSNP
rs1328264863 5451 dbSNP
rs914829887 5452 dbSNP
rs1456133616 5455 dbSNP
rs998814111 5457 dbSNP
rs1367345264 5461 dbSNP
rs1435726966 5462 dbSNP
rs183676572 5470 dbSNP
rs565370261 5471 dbSNP
rs1190793424 5472 dbSNP
rs147656275 5472 dbSNP
rs1246683939 5473 dbSNP
rs1268550261 5474 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Location of target site 3'UTR
Article - Calin GA; Cimmino A; Fabbri M; Ferracin M; et al.
- Proceedings of the National Academy of Sciences of the United States of America, 2008
MicroRNAs (miRNAs) are short noncoding RNAs regulating gene expression that play roles in human diseases, including cancer. Each miRNA is predicted to regulate hundreds of transcripts, but only few have experimental validation. In chronic lymphocytic leukemia (CLL), the most common adult human leukemia, miR-15a and miR-16-1 are lost or down-regulated in the majority of cases. After our previous work indicating a tumor suppressor function of miR-15a/16-1 by targeting the BCL2 oncogene, here, we produced a high-throughput profiling of genes modulated by miR-15a/16-1 in a leukemic cell line model (MEG-01) and in primary CLL samples. By combining experimental and bioinformatics data, we identified a miR-15a/16-1-gene signature in leukemic cells. Among the components of the miR-15a/16-1 signature, we observed a statistically significant enrichment in AU-rich elements (AREs). By examining the Gene Ontology (GO) database, a significant enrichment in cancer genes (such as MCL1, BCL2, ETS1, or JUN) that directly or indirectly affect apoptosis and cell cycle was found.
LinkOut: [PMID: 18362358]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 bindi