miRTarBase - #MIRT003875 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SKAP2   
Synonyms PRAP, RA70, SAPS, SCAP2, SKAP-HOM, SKAP55R
Description src kinase associated phosphoprotein 2
Transcript NM_003930   
Expression
Putative miRNA Targets on SKAP2
3'UTR of SKAP2
(miRNA target sites are highlighted)
>SKAP2|NM_003930|3'UTR
   1 GAGTCCTGGAAAAGGAAAATTCTTCTGCTTGTCTGCAAATGCTTTGGATTTAGAAGCGTCATGAAAGCACGAGTGACAGC
  81 TCCTAACCTCTCCTTGTTTTATTAAACATTACTTATCTTTGACTGTTATTTTATGCAGTCGCTCATTAAAATATTCCTCT
 161 GATGTGAAATTAAATGAAGGATATTAATGTAAATTAGATGCAACCAGTTAAGTTATACCTGTTGCTATTTTGCAAAGAAA
 241 TAATTATAGTTTTTATTTACCCATTTGATTTGTGTGAAGAATTCATCACTATTTTATACGTAACATATAGTCTACTATAG
 321 CATAGTATGCTACTATTGCTACTTCTGGTGTGATTTGTAATGTTTCTTAATCATTGGACATCAATTATTTTTAGAGAGTA
 401 ATGTATAATTTCATAGCATTTTAAATTTAGTGTATCATGCGAGTTTTTTTTGGTAGATGCTGAAGAATGTGGTTGCTAAA
 481 CAAAGAATGCTAAAGAATGTTCAAACTTTATAGATAACTTTATTGTTATTATTTATTTTCACACATTTAATTCCTATTAA
 561 GTACAGCCGCAAGAAAGAAAAAATGATGAAGTTGCAAATGGCAGTGTGCTGTCACCTGCAACAGAAGTGCGTACCAGAAG
 641 TATGACTCATGCAAAGCATTTTACCGTACAAATATCCTGGTGCGATGATGGGCCTGGCAACATTTTCTACTGTACTTTTG
 721 TTTAAATTTAATGAAACAAAAAATTCCTAAGAAATACCACCCTACCACTAACAAAATGGTATAAAGAATCTCCCAGCCAG
 801 GCCAACATGGTGAAACCCTGTCTCTACTAAAAATTAGCCAAGTGTGGTAATGTTCACCTGCAGTCCCAGCTACTTGGGAG
 881 GCCAAGGCACGAGAATTGCTTGAACAAGGTAGGCAGAGGTTGCAGTGAGCCAAGATCGCGCCACTGCACTCCAGCCTGGG
 961 CGACAGAGTGAGACTCCATCTCAGAAAAAAAAAAAAAAAAAAACAGAATCTCAGTGTATTCTCAAAGTAAAAAGGCATAA
1041 CCAAGCACTCTCTTATCTTGCCTTATTGCTATACTATTTACATCCCACTGCAGAACAGCAGATTTGAGGCTTTTCTATAT
1121 ACTTCTCAGAGCACTGAAAAGAAAGGAAGGGTTTGCAGAGGAGAGTGTAGAAATCCCAGTGGTAGCATGTACCAACAGGT
1201 GAGTAGAAAGGTAGTGTTAGCCTGACATTTGAGTTATACTCTGTGCTGCCTGAGCAAGATTTGTAGAATCATATAATTAC
1281 CTTTTCATGTATATTTGAAATCAGAGGTGTTTAAAATACCTATGAGATACCAATGTAGCCTTAACATATGTCAAAATGCA
1361 TTGCTGGTTAGATAATTATTTGGACTACACATAAACTCCTAATATTGAATCATTACCTATCAGGTATTATCTTTATGGAA
1441 CTTTTCAATATCTTTGCTTTATAAAGATTCTAAACATGTATCTGAGCTGGTAATATTTTAAAATCTCCATTATTTGTGTA
1521 AAACTGTTTATAAGCAGTGTTTGAGAGGGTCTGCTTTACCATTACCCCCTCAATATCATGATCATCCAATCTCAAATGTG
1601 AAAAAAAAAAAGAAATTTGATTTTAGGGATTGTGAGTAAACAAGTTTATATAGAGAGACATTGTGAAGTTAAAGTTTTCA
1681 GAAGTTACATTTGTGCAGTTCTTACCTTTTCCTCATATAGTGCCATTGAAATAGACTGAAATTATCTTGGCAAAAGTTAG
1761 ACAACCAAAGACGACTTTAGTGGACTGGTTTTCAAAACTTGAGCAGCTGAAAAGCAAAAGCCGTTGTTTCCCATGACAAT
1841 GTAGCCTTTGTGGATTTGGGTTTGTGCTTTGGGTTGAAAAGAAGTTTTTAGTCCTAGGCCAGTAGATGGCAGCAGCTTTT
1921 CATTGCAGACAAAACCTCTTGAAACCCTTCCCCCATGGCACAAACTCGCCCATGATGGAAAGCATCTAGATTTCTGCCTC
2001 CTTTTACAGTTAATCCAGGAGAGGGAGTCCTTTGCCAACTGATGACCAACAGTTCCAAGCCAGATAGTCTCGTGAACAGT
2081 GACAATACAGAAATAAGGTGTTATTTCTGTTCAGATCTCCACCGGCCTTTGTTCTTTTAAAACTTGAATATAGGTGGGAG
2161 ACATAAGAAAGGAAAGAAAAGACTTAAAACTGGAGTGACAGGACAAATAATCATTACTTTCAATTCATGACTGCTTTATA
2241 TTCATTTGATGAAATCATTTGTATACAAACCAGGGAGAGTTTTCTTTACACCCTTGACAATATATCACATACTCTTCAAG
2321 ATCATAATAATATCATTAATATAAATTTAAACAACATGGCTTGTTAGAAAATATGCTAATTGCTATGGTCTCATTATGTT
2401 TGCTTAGCTTTTATTTGTTTTTCTGTGAACAGTTAGAGAGCTAATTTTTTTCAAAGGTGATTGTAAGTCATATTTTATAT
2481 AGCATTTTGCTTGATTATTTGCTCTGTACTGAATTTGTACTCTATTGCCATTAGATCTTACAATAATGTTCCACTCTGCA
2561 AATTTTTAAGGTTCAAATAAAGTTTAATTGTTTGCAAACTGTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUA--AUACACGACGau 5'
            ::|:::||  | ||||||||  
Target 5' ttTGAGTTATACTCTGTGCTGCct 3'
1228 - 1251 142.00 -12.90
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :||:::| ||  ||:|||| 
Target 5' gtTAAGTTA-TACCTGTTGCTa 3'
207 - 227 139.00 -11.40
3
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            ||||: :  :|||||||:  
Target 5' tgCAAATGGCAGTGTGCTGTca 3'
593 - 614 128.00 -14.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN32059356 1 COSMIC
COSN28648315 53 COSMIC
COSN21619885 402 COSMIC
COSN16875453 491 COSMIC
COSN29834427 701 COSMIC
COSN7976185 1168 COSMIC
COSN9983939 1346 COSMIC
COSN9983938 1426 COSMIC
COSN22862222 1705 COSMIC
COSN2217594 1891 COSMIC
COSN20103982 2035 COSMIC
COSN9983937 2270 COSMIC
COSN2217593 2321 COSMIC
COSN9940392 2441 COSMIC
COSN9983936 2462 COSMIC
COSN31585459 2528 COSMIC
COSN31589528 2651 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1447370281 5 dbSNP
rs904660856 17 dbSNP
rs770568326 18 dbSNP
rs1421321623 20 dbSNP
rs1358339938 21 dbSNP
rs529899363 27 dbSNP
rs1405523161 42 dbSNP
rs777093193 45 dbSNP
rs3735549 53 dbSNP
rs1244593243 58 dbSNP
rs1291757438 62 dbSNP
rs774886198 63 dbSNP
rs1051849912 66 dbSNP
rs932971844 67 dbSNP
rs1220781285 68 dbSNP
rs139464146 75 dbSNP
rs1365206001 76 dbSNP
rs919192101 92 dbSNP
rs1197005517 114 dbSNP
rs527667697 129 dbSNP
rs565247317 130 dbSNP
rs1185543292 132 dbSNP
rs909038026 133 dbSNP
rs763095706 149 dbSNP
rs1476325946 151 dbSNP
rs1165864851 152 dbSNP
rs1372695638 167 dbSNP
rs1317982994 173 dbSNP
rs1460563266 186 dbSNP
rs1299955359 187 dbSNP
rs1456210838 190 dbSNP
rs1395891433 191 dbSNP
rs1359420415 206 dbSNP
rs1311477724 211 dbSNP
rs984259917 223 dbSNP
rs1018746255 232 dbSNP
rs970527302 234 dbSNP
rs1305402056 247 dbSNP
rs1435340446 254 dbSNP
rs773327377 257 dbSNP
rs993252048 270 dbSNP
rs112439134 271 dbSNP
rs1208588159 274 dbSNP
rs1259381594 286 dbSNP
rs1485903435 291 dbSNP
rs1031887638 292 dbSNP
rs1261378348 300 dbSNP
rs531814916 322 dbSNP
rs999031532 335 dbSNP
rs1250396811 355 dbSNP
rs1206942711 360 dbSNP
rs968894411 362 dbSNP
rs13247713 367 dbSNP
rs1029783686 373 dbSNP
rs1415858349 379 dbSNP
rs902733064 391 dbSNP
rs999739224 391 dbSNP
rs1021746840 396 dbSNP
rs1007334711 406 dbSNP
rs1295709520 426 dbSNP
rs1043416345 429 dbSNP
rs1231409066 435 dbSNP
rs888875112 437 dbSNP
rs1051498400 438 dbSNP
rs1010960726 441 dbSNP
rs1310591165 445 dbSNP
rs997592099 449 dbSNP
rs897458581 467 dbSNP
rs1485034705 469 dbSNP
rs141436037 480 dbSNP
rs1262672711 481 dbSNP
rs1279353515 491 dbSNP
rs1191827656 492 dbSNP
rs769833607 501 dbSNP
rs1228806434 504 dbSNP
rs1158835085 505 dbSNP
rs941923733 522 dbSNP
rs374029297 523 dbSNP
rs535171189 535 dbSNP
rs1369745208 545 dbSNP
rs947885700 550 dbSNP
rs1379249697 551 dbSNP
rs543232775 555 dbSNP
rs1464235611 556 dbSNP
rs1358157816 560 dbSNP
rs916000161 560 dbSNP
rs992887747 563 dbSNP
rs1216206456 575 dbSNP
rs148372191 575 dbSNP
rs1430761398 576 dbSNP
rs924609229 578 dbSNP
rs929212458 579 dbSNP
rs1211921171 580 dbSNP
rs144404492 592 dbSNP
rs187834240 593 dbSNP
rs779832659 598 dbSNP
rs1428060786 622 dbSNP
rs1256954804 634 dbSNP
rs551219547 646 dbSNP
rs1021824509 649 dbSNP
rs1421289795 658 dbSNP
rs758014778 661 dbSNP
rs1393349312 671 dbSNP
rs1459494036 683 dbSNP
rs1257025534 684 dbSNP
rs1205656308 689 dbSNP
rs1394516387 689 dbSNP
rs1440808063 697 dbSNP
rs1344009166 710 dbSNP
rs953531552 714 dbSNP
rs531137922 723 dbSNP
rs375485011 733 dbSNP
rs1226601705 734 dbSNP
rs997256947 742 dbSNP
rs1334443471 746 dbSNP
rs1231639843 747 dbSNP
rs1275147717 751 dbSNP
rs985989261 756 dbSNP
rs1203868462 762 dbSNP
rs1231741335 766 dbSNP
rs780091175 775 dbSNP
rs1481898684 782 dbSNP
rs955449881 786 dbSNP
rs558393743 787 dbSNP
rs1029786838 789 dbSNP
rs1014579682 794 dbSNP
rs1006170196 796 dbSNP
rs1408933597 799 dbSNP
rs1393746200 800 dbSNP
rs1326267205 806 dbSNP
rs1356224301 807 dbSNP
rs1354464393 809 dbSNP
rs1308233906 814 dbSNP
rs778453279 818 dbSNP
rs1312080401 822 dbSNP
rs1372791421 832 dbSNP
rs887708614 850 dbSNP
rs1022996480 865 dbSNP
rs1044966032 874 dbSNP
rs1270897539 875 dbSNP
rs1309787421 879 dbSNP
rs947883372 884 dbSNP
rs1011137578 886 dbSNP
rs894841660 886 dbSNP
rs1484919712 901 dbSNP
rs1190510213 902 dbSNP
rs896286316 908 dbSNP
rs756762070 915 dbSNP
rs372090166 917 dbSNP
rs1172983856 919 dbSNP
rs1410482879 919 dbSNP
rs1167042184 928 dbSNP
rs753418278 931 dbSNP
rs1003302970 938 dbSNP
rs1422100448 942 dbSNP
rs1430197226 944 dbSNP
rs1268515098 946 dbSNP
rs1364233996 951 dbSNP
rs1229193702 959 dbSNP
rs938768258 959 dbSNP
rs1183144639 962 dbSNP
rs1483953044 965 dbSNP
rs1213488530 972 dbSNP
rs1446102146 973 dbSNP
rs764800647 973 dbSNP
rs1190509094 974 dbSNP
rs1249357164 978 dbSNP
rs924640306 979 dbSNP
rs1475477157 981 dbSNP
rs569526705 995 dbSNP
rs1047615675 1002 dbSNP
rs143960607 1003 dbSNP
rs1383919308 1015 dbSNP
rs1398717448 1016 dbSNP
rs914810559 1018 dbSNP
rs1038046866 1019 dbSNP
rs943299127 1045 dbSNP
rs1302692883 1047 dbSNP
rs183543583 1047 dbSNP
rs1237097376 1049 dbSNP
rs1394637298 1051 dbSNP
rs567254887 1054 dbSNP
rs1350464105 1062 dbSNP
rs1203720718 1064 dbSNP
rs1242036670 1065 dbSNP
rs1333502271 1076 dbSNP
rs1465056419 1083 dbSNP
rs1212535613 1084 dbSNP
rs953705151 1090 dbSNP
rs985386716 1092 dbSNP
rs532946023 1097 dbSNP
rs975853226 1099 dbSNP
rs961776929 1100 dbSNP
rs868691939 1104 dbSNP
rs1348175485 1107 dbSNP
rs1325347106 1110 dbSNP
rs1327291807 1114 dbSNP
rs190629830 1118 dbSNP
rs1392130245 1121 dbSNP
rs1324823793 1122 dbSNP
rs571569859 1132 dbSNP
rs190033 1141 dbSNP
rs1335679771 1146 dbSNP
rs1005909744 1153 dbSNP
rs1281577274 1154 dbSNP
rs1329433339 1158 dbSNP
rs1232258824 1159 dbSNP
rs887412389 1180 dbSNP
rs169873 1193 dbSNP
rs959614994 1196 dbSNP
rs1023981522 1205 dbSNP
rs1459993520 1217 dbSNP
rs1417248502 1233 dbSNP
rs1012158169 1235 dbSNP
rs896351311 1237 dbSNP
rs1003188328 1242 dbSNP
rs906296322 1248 dbSNP
rs1056284216 1249 dbSNP
rs1183733441 1254 dbSNP
rs551591982 1258 dbSNP
rs1026100411 1261 dbSNP
rs993228060 1262 dbSNP
rs1164548107 1271 dbSNP
rs1415919790 1273 dbSNP
rs1269440809 1274 dbSNP
rs1207977387 1278 dbSNP
rs938799222 1280 dbSNP
rs531880147 1286 dbSNP
rs1331330504 1295 dbSNP
rs1351433776 1299 dbSNP
rs562969460 1308 dbSNP
rs543273461 1315 dbSNP
rs943289920 1316 dbSNP
rs529495567 1318 dbSNP
rs560782710 1320 dbSNP
rs1041742726 1321 dbSNP
rs751912712 1324 dbSNP
rs947397001 1325 dbSNP
rs77746300 1333 dbSNP
rs1326670645 1343 dbSNP
rs766710196 1364 dbSNP
rs932233797 1371 dbSNP
rs923462396 1372 dbSNP
rs976260852 1373 dbSNP
rs1185530640 1374 dbSNP
rs962181944 1377 dbSNP
rs907629409 1378 dbSNP
rs1188342128 1380 dbSNP
rs571952368 1382 dbSNP
rs369836169 1383 dbSNP
rs984505286 1388 dbSNP
rs1439349602 1395 dbSNP
rs1372538004 1396 dbSNP
rs1460938717 1397 dbSNP
rs1171093524 1399 dbSNP
rs1339009270 1403 dbSNP
rs558488969 1404 dbSNP
rs1371709472 1409 dbSNP
rs1394318176 1413 dbSNP
rs1434550617 1414 dbSNP
rs1321326755 1416 dbSNP
rs938025967 1418 dbSNP
rs1356977871 1419 dbSNP
rs1396207807 1419 dbSNP
rs59588152 1419 dbSNP
rs1294256272 1420 dbSNP
rs951836447 1420 dbSNP
rs1023299645 1421 dbSNP
rs1158192337 1421 dbSNP
rs1012604137 1430 dbSNP
rs1228941236 1430 dbSNP
rs1208485811 1431 dbSNP
rs960644942 1431 dbSNP
rs1034873850 1432 dbSNP
rs1261270398 1432 dbSNP
rs200768023 1433 dbSNP
rs922583966 1433 dbSNP
rs1191449639 1434 dbSNP
rs945471471 1434 dbSNP
rs915401422 1435 dbSNP
rs1248521154 1436 dbSNP
rs989626236 1436 dbSNP
rs1182274338 1438 dbSNP
rs1297624085 1438 dbSNP
rs1382325263 1438 dbSNP
rs1436723247 1438 dbSNP
rs369317261 1438 dbSNP
rs376030200 1438 dbSNP
rs542284535 1438 dbSNP
rs959910727 1439 dbSNP
rs1248678740 1442 dbSNP
rs1468443703 1449 dbSNP
rs926835715 1462 dbSNP
rs902319918 1463 dbSNP
rs1463142421 1465 dbSNP
rs146947306 1466 dbSNP
rs750654215 1473 dbSNP
rs1361722185 1476 dbSNP
rs1458430313 1482 dbSNP
rs970405688 1483 dbSNP
rs1393036763 1489 dbSNP
rs575757675 1505 dbSNP
rs1346605109 1521 dbSNP
rs893150082 1525 dbSNP
rs555821957 1526 dbSNP
rs931945817 1528 dbSNP
rs1223011415 1530 dbSNP
rs1304513851 1531 dbSNP
rs1232488341 1540 dbSNP
rs879675192 1541 dbSNP
rs923564333 1543 dbSNP
rs761833104 1547 dbSNP
rs1211890903 1550 dbSNP
rs1040610577 1551 dbSNP
rs940848463 1561 dbSNP
rs1370951737 1569 dbSNP
rs908033406 1574 dbSNP
rs1489062055 1577 dbSNP
rs984578801 1595 dbSNP
rs776726387 1597 dbSNP
rs1324750532 1598 dbSNP
rs113081607 1603 dbSNP
rs916263207 1605 dbSNP
rs888933981 1612 dbSNP
rs990515692 1613 dbSNP
rs1404553302 1617 dbSNP
rs10248592 1622 dbSNP
rs1433830569 1631 dbSNP
rs188383860 1636 dbSNP
rs1441341623 1646 dbSNP
rs1296260932 1648 dbSNP
rs1170400287 1655 dbSNP
rs1034906557 1661 dbSNP
rs1241018956 1671 dbSNP
rs997383733 1672 dbSNP
rs1187569527 1673 dbSNP
rs138557030 1674 dbSNP
rs901213632 1676 dbSNP
rs1322889859 1686 dbSNP
rs1204383374 1697 dbSNP
rs966553167 1699 dbSNP
rs1443810749 1708 dbSNP
rs1254911203 1725 dbSNP
rs1484264584 1726 dbSNP
rs1183347258 1732 dbSNP
rs1209230047 1733 dbSNP
rs1256384361 1742 dbSNP
rs1347587605 1751 dbSNP
rs1183125991 1754 dbSNP
rs1413820942 1756 dbSNP
rs1022064091 1760 dbSNP
rs1012103321 1762 dbSNP
rs893234169 1767 dbSNP
rs545443438 1768 dbSNP
rs915307565 1769 dbSNP
rs1269692514 1783 dbSNP
rs996195925 1797 dbSNP
rs150085557 1799 dbSNP
rs1286054839 1808 dbSNP
rs926762220 1816 dbSNP
rs559597098 1824 dbSNP
rs982400168 1829 dbSNP
rs1344919354 1865 dbSNP
rs1040682677 1875 dbSNP
rs1311263364 1876 dbSNP
rs970961811 1882 dbSNP
rs1280011193 1883 dbSNP
rs918935395 1887 dbSNP
rs374752394 1890 dbSNP
rs1211859568 1891 dbSNP
rs1370933455 1912 dbSNP
rs971719317 1915 dbSNP
rs1309549815 1918 dbSNP
rs1184241488 1928 dbSNP
rs756918452 1930 dbSNP
rs963470196 1933 dbSNP
rs1172817077 1934 dbSNP
rs1408154793 1935 dbSNP
rs746703526 1941 dbSNP
rs1415941558 1958 dbSNP
rs1336447250 1963 dbSNP
rs1418645429 1973 dbSNP
rs1016044011 1983 dbSNP
rs1295411023 1987 dbSNP
rs760621242 1991 dbSNP
rs866279756 1994 dbSNP
rs1303283287 2000 dbSNP
rs775345382 2001 dbSNP
rs930779366 2003 dbSNP
rs916353066 2008 dbSNP
rs990939181 2020 dbSNP
rs1206289921 2021 dbSNP
rs1473476452 2027 dbSNP
rs1415280257 2031 dbSNP
rs1186769975 2033 dbSNP
rs1485589259 2034 dbSNP
rs1252998271 2035 dbSNP
rs953252021 2041 dbSNP
rs551799011 2043 dbSNP
rs796682530 2045 dbSNP
rs1426153351 2046 dbSNP
rs1478926592 2046 dbSNP
rs560723256 2046 dbSNP
rs1400299093 2048 dbSNP
rs997395048 2050 dbSNP
rs1272878725 2060 dbSNP
rs13186 2062 dbSNP
rs978000144 2066 dbSNP
rs1329841554 2067 dbSNP
rs1042389788 2072 dbSNP
rs1009543403 2074 dbSNP
rs1436479822 2082 dbSNP
rs893788090 2084 dbSNP
rs1226141021 2085 dbSNP
rs1269608253 2087 dbSNP
rs1053898639 2096 dbSNP
rs1358545154 2107 dbSNP
rs1291737448 2113 dbSNP
rs1265253039 2115 dbSNP
rs1453198476 2119 dbSNP
rs938094031 2123 dbSNP
rs966586024 2127 dbSNP
rs1232904419 2128 dbSNP
rs183102987 2130 dbSNP
rs989345478 2132 dbSNP
rs1309647040 2139 dbSNP
rs1157266596 2140 dbSNP
rs919478798 2152 dbSNP
rs1457886752 2167 dbSNP
rs1164225332 2173 dbSNP
rs972710501 2175 dbSNP
rs1388995384 2205 dbSNP
rs191244740 2206 dbSNP
rs1335597656 2207 dbSNP
rs941727260 2213 dbSNP
rs1029087716 2218 dbSNP
rs1324103793 2221 dbSNP
rs1350719237 2256 dbSNP
rs1232166207 2257 dbSNP
rs1406661953 2262 dbSNP
rs996657525 2264 dbSNP
rs1263097078 2267 dbSNP
rs1210409947 2268 dbSNP
rs1358407513 2268 dbSNP
rs755381122 2273 dbSNP
rs1481988434 2274 dbSNP
rs908865220 2278 dbSNP
rs371976338 2279 dbSNP
rs1186966326 2285 dbSNP
rs1366746033 2296 dbSNP
rs527515488 2305 dbSNP
rs549465854 2307 dbSNP
rs10233843 2317 dbSNP
rs560692218 2319 dbSNP
rs1428286444 2324 dbSNP
rs1472723676 2344 dbSNP
rs1310179661 2361 dbSNP
rs1413658619 2363 dbSNP
rs1413734945 2365 dbSNP
rs967282048 2370 dbSNP
rs1341787495 2379 dbSNP
rs1018938940 2386 dbSNP
rs546990132 2387 dbSNP
rs35642976 2389 dbSNP
rs1179359384 2391 dbSNP
rs1339900514 2394 dbSNP
rs1005169324 2398 dbSNP
rs1275033522 2401 dbSNP
rs1483519569 2402 dbSNP
rs754218819 2405 dbSNP
rs1232865583 2406 dbSNP
rs1254306283 2407 dbSNP
rs1425707998 2417 dbSNP
rs10274472 2420 dbSNP
rs10244663 2427 dbSNP
rs1271362103 2432 dbSNP
rs1170912363 2449 dbSNP
rs930832123 2459 dbSNP
rs895295157 2462 dbSNP
rs750505437 2471 dbSNP
rs369413829 2472 dbSNP
rs1396116915 2476 dbSNP
rs185970970 2480 dbSNP
rs939083332 2481 dbSNP
rs1316930776 2483 dbSNP
rs1362980126 2487 dbSNP
rs140742047 2492 dbSNP
rs977740391 2503 dbSNP
rs945020556 2505 dbSNP
rs180750672 2506 dbSNP
rs1254546993 2507 dbSNP
rs949558357 2508 dbSNP
rs897976112 2510 dbSNP
rs1036653889 2512 dbSNP
rs118103246 2518 dbSNP
rs1275437791 2521 dbSNP
rs774487079 2528 dbSNP
rs1191095677 2531 dbSNP
rs953938239 2532 dbSNP
rs573509239 2537 dbSNP
rs757349650 2541 dbSNP
rs553973316 2548 dbSNP
rs1457279618 2554 dbSNP
rs533743198 2557 dbSNP
rs1157796777 2558 dbSNP
rs1390439239 2559 dbSNP
rs10244449 2583 dbSNP
rs189840554 2588 dbSNP
rs1321220318 2594 dbSNP
rs1281935489 2595 dbSNP
rs1019012599 2597 dbSNP
rs1192078622 2601 dbSNP
rs1384875616 2612 dbSNP
rs1455984362 2621 dbSNP
rs1314197954 2627 dbSNP
rs186213072 2635 dbSNP
rs950659123 2636 dbSNP
rs1210657345 2637 dbSNP
rs151004359 2650 dbSNP
rs549504830 2657 dbSNP
rs895338401 2669 dbSNP
rs1262776020 2675 dbSNP
rs1032348452 2685 dbSNP
rs1002183390 2689 dbSNP
rs905180696 2695 dbSNP
rs535913769 2698 dbSNP
rs1279088723 2700 dbSNP
rs1055686429 2701 dbSNP
rs1409309783 2704 dbSNP
rs1003637667 2707 dbSNP
rs530571223 2708 dbSNP
rs1458415906 2709 dbSNP
rs1159184851 2711 dbSNP
rs1025086406 2714 dbSNP
rs984895447 2725 dbSNP
rs1456294647 2731 dbSNP
rs906309006 2738 dbSNP
rs1302555962 2743 dbSNP
rs1042081770 2747 dbSNP
rs1368086863 2748 dbSNP
rs374948008 2755 dbSNP
rs1288025310 2760 dbSNP
rs1348794118 2772 dbSNP
rs1230303902 2786 dbSNP
rs1268803918 2787 dbSNP
rs1321665297 2790 dbSNP
rs1220064250 2797 dbSNP
rs1267726953 2802 dbSNP
rs1489051293 2807 dbSNP
rs945051693 2831 dbSNP
rs1435254252 2832 dbSNP
rs576826741 2833 dbSNP
rs1473330751 2837 dbSNP
rs1245070613 2854 dbSNP
rs1412384651 2862 dbSNP
rs1421521256 2864 dbSNP
rs1166908820 2871 dbSNP
rs762796825 2875 dbSNP
rs914883916 2878 dbSNP
rs1053748731 2885 dbSNP
rs898026068 2891 dbSNP
rs1428884057 2903 dbSNP
rs1305881239 2911 dbSNP
rs182025800 2914 dbSNP
rs750821744 2915 dbSNP
rs17154295 2917 dbSNP
rs1177289368 2931 dbSNP
rs976596123 2937 dbSNP
rs762031146 2946 dbSNP
rs1050107732 2947 dbSNP
rs965186358 2949 dbSNP
rs547221032 2957 dbSNP
rs983503545 2958 dbSNP
rs1483845886 2962 dbSNP
rs1205492893 2963 dbSNP
rs142714228 2977 dbSNP
rs1471556595 2979 dbSNP
rs1183040772 2980 dbSNP
rs564816201 2990 dbSNP
rs1040139331 2993 dbSNP
rs1166503584 2997 dbSNP
rs1391831339 3002 dbSNP
rs1430129753 3011 dbSNP
rs1329876142 3018 dbSNP
rs1173549062 3020 dbSNP
rs1450247016 3024 dbSNP
rs1445935471 3025 dbSNP
rs1304596822 3033 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Location of target site 3'UTR
Article - Calin GA; Cimmino A; Fabbri M; Ferracin M; et al.
- Proceedings of the National Academy of Sciences of the United States of America, 2008
MicroRNAs (miRNAs) are short noncoding RNAs regulating gene expression that play roles in human diseases, including cancer. Each miRNA is predicted to regulate hundreds of transcripts, but only few have experimental validation. In chronic lymphocytic leukemia (CLL), the most common adult human leukemia, miR-15a and miR-16-1 are lost or down-regulated in the majority of cases. After our previous work indicating a tumor suppressor function of miR-15a/16-1 by targeting the BCL2 oncogene, here, we produced a high-throughput profiling of genes modulated by miR-15a/16-1 in a leukemic cell line model (MEG-01) and in primary CLL samples. By combining experimental and bioinformatics data, we identified a miR-15a/16-1-gene signature in leukemic cells. Among the components of the miR-15a/16-1 signature, we observed a statistically significant enrichment in AU-rich elements (AREs). By examining the Gene Ontology (GO) database, a significant enrichment in cancer genes (such as MCL1, BCL2, ETS1, or JUN) that directly or indirectly affect apoptosis and cell cycle was found.
LinkOut: [PMID: 18362358]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*