miRTarBase - #MIRT003105 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLC7A1   
Synonyms ATRC1, CAT-1, ERR, HCAT1, REC1L
Description solute carrier family 7 member 1
Transcript NM_003045   
Expression
Putative miRNA Targets on SLC7A1
3'UTR of SLC7A1
(miRNA target sites are highlighted)
>SLC7A1|NM_003045|3'UTR
   1 CGCACAGCCCCGCCCCCCGGAGGTGGCAGCAGCCCCGAGGGACGCCCCCAGAGGACCGGGAGGCACCCCACCCTCCCCAC
  81 CAGTGCAACAGAAACCACCTGCGTCCACACCCTCACTGCAGCCAAAGGTGCAATTACTTGACCTGCAGCCCCAGCCCACC
 161 CTCGGCTCTGCAGCCGGTTCTCCGGGCCCTGGTCACCTCCAGACAGCTGCCTGGCCGGGGCCACTAGGCTGCGGCTGGCC
 241 ACTGTGTCTCCTCACTTCTCTGAACAAAGCAGTTCCTCCCCTACCAGCTCAGCCCCGAGCTGCCGCAGCCTCAGGCAGAA
 321 CGGAGGTCACCTTCTCTCCTTATCTTGGGAACCAGGCCTTCCTCCCGGGGACTGTTCTGGGATTGAAATTGTGCATACTC
 401 CAAACTTTCGCAGCCATCTTCCCGCTCAGCCCCAGACACCCAGCAATCAAGCCAGATGAGTACCACAAAACAGTGTGTCC
 481 CCAGCAGCTCCCCACCCCAGAGCCAAATGACAGTAGTGCACTTAAAAAGGAAAATCAGGCCTGTTGTCCTTCTCCGGTTG
 561 CATTCAGATGGGTCATTAGGGCCGGACCCTGCCTGCCCCTTGGCTTCTCAGGGCTTTGCTCTGACACCATGACAGCTGCC
 641 CGGGGCTGAGGGCAGCTGGCTCCACTCAAATGAGGAAGAAGGGATCACTCCCATTAGGGCCTGCTTTGCTTATGCATGTG
 721 TGTGCACATGCATGTAAACCAGGGACCTTCAGCTCACGGCCTCCAGGCCTGGGCCAGTTCTTGCTGCTCCTGCCGTCTCC
 801 CCCGACTGGCTGTGTCCTGAGTAACTGGAACATGAGACAGTATCTGCAGGACTGGCCCCATGGTGGCCGAGTCAGAAGTC
 881 TGTTTCCTGTGAGTCGCCACCGTTCACTCAGTCTTGCCCTCCCATGCTTTGGAGCCAGTCTGGTGGCTCCTGTAAGGTTC
 961 TCAAGGCTGGTGGCAGCTCAGTCTGGGGTCAGGACATGTCGGGGTCATGCGTTTCTGGCCCTGACATAAGCTGTCTGGCC
1041 TCTCTGTGACATGATGAAATTGAAATCAATCCACAGTCCATGAAATTGTGACACTCCACCAGATTAAGTTAGGGCATAAC
1121 ATTAACTTGGAAATGGCCATGTCATCACCCCTGCGGCTGTCCTATAGCTGAGATGCGTGGGTCGCAGGGGAGGTGATTTC
1201 TAGGCATATTGCTGTCCCTTTTGTGTATCTGTCATCCGGATGCTTCGGACCCCACGCCTCTGCAAGTGGGAGAGACCCGA
1281 GCATCCTCCCCACCCCCATAGCTCCAGTGCACGCCACCCCCGTCTTGCCTGGGTCGGGGCCTGCGGCCAGCACCATTTCA
1361 CACACACTCCTTGTAGATGGGAGCCAGAGGAAACCTGAACGTGGGTGGAGCGTTCCACTGAGTCTACTTCAGGAGACAGA
1441 AGGCCCATGCTGATGGGGGAGGAGGAGGGATGTGGGCATTTTGGACACCAGGGGAAATGGAAATGCTGCTTTCAAAACTT
1521 AGTTTCCTTTCCATTTCTTCCTAGTCTGGCCTTTGACACAAATCTGGTAGAAAGAAGCCTGATAAATTGAGGGCACTTGT
1601 ACCCTCCCTGTGCCCCCAGAAGGTTCTTGGAGAGAAGTGCAAGAATTTGTGAACACGGCGGTGGAGGGCGGGTGGATGGC
1681 CATGGGCTGAGCCTCCGTATCAGGCCTGCTCACCTTGCTGGGAGCTTTATTCTGATCTCATTTTGAATGTTCCAGAGGGA
1761 GCATCATAAGAGCCCAGAGCTCCGATTTCCAAAGAGTGATATTGACATTTATGGAGATTGGTGTTGTAACATATTTTGAT
1841 AAATACTAACTTATTTTGTTGGGGTTTTGGTTGTCTCTTGTCTTAGGACCTGGTAGTTATTTGCTTGATTTTTTTTTCCG
1921 TTATTTTCTACATAGGCAAAGAGAATTCGAGGGATAGACAGTCTCCAAGAAAAGTGAAGTGGTGGGAGAGAATTGCTTTT
2001 TTCTTTTTTTTCTTTTCTCTAGTTTTTCTTTCTGGCTGAGATTTCCGTGCAAGACAGCACCCAATAGACTATTTAGAGTT
2081 GACATTTGACATTTTAATGGGCGCCATGGCTCATTTTGTAGATTGAGAAGGTGCGTCTCCCCTGCTCCAAGTCTCATCAT
2161 GACAGCGTGCTGACAGCTGGGAGTCTGTGGCCTTCCTCACGCAGAGGCCTTAAAGCTGGACACAGAAGCACGCCTAGGCT
2241 GGGCAGGGATGGGACCCATGCCCCCTCCTTAGAGGACGGGCTTCCTGGTTAGGAAAGGACACGTGGGGGTGCCTTGCATA
2321 ATAGTTCACTGGTCACCGTGCTTTTATGAGTAGTGTTTTTGTGCACTTGCCAGGGGTTTTCTCTCTGTGTGAGAGGGGAG
2401 TGATTTAAGCAATGGTGTCTGGAGTAAGCCTTACAATTTTAATAGACTTTTTCTTATCATATCCCTCATTTCTTTCCCTG
2481 AAATAAAAATACACACAAGCAAAAAAAAAATGATAGTTTCACATCTCTTAGTTCCCTTGCCCAAACAAGAATATTCTTAG
2561 TTCCACTGGCCAGGATTTTCCTACATAGTCAGAACTTACACATTACTAGAGGCACACCCACCAAGGAGTATTGTGTCTAC
2641 TTTTATCTGTGCACCAGCCACAAATACCCACATTGGAAAGACCCATTTGTGATGGGTAAACATCCCTTCCTGTCTCCCAC
2721 AACCCCTGTGACTGCCCTGCATGTGTTCATGACCTCCGAAGGCCCAAATTCATGAAGCAGCAAACCCAGCAGATCTCCAC
2801 CCCCCTGCCTCAGGACCTCTGCTGAAGAGGGGGATGAAGTGGGTCTCCAGGGAGGCAGTGGGGGCCTTGTTGGCAGCTGG
2881 CTCGGGAGCCGGCTTACAGGAGGGCAGCTCTGCAGTTGGGAGGGGCACCGTCCGGAGGAGACCAGGCCTCTACACACCCC
2961 CCACTCTACTTATCATCCCTGCTCACACACCCTTGTCCAAGGCTTTATGCATCGGATTTATTTTTCCAAATCAAGAGGAC
3041 AGTGATAGATGCATTTTCCCCAGGCTGTCTCAGAAAGGTCGCTAAATGTATACTGTTGTCAGAATTGCTGAGATCTCCCC
3121 CCACTTTTGGTTTTTGCAGCAGTAAAAACTCTTTCCACTGTGACTTATTTTCTCTCTCAGGCAGCCAGCCACCTGGTCCC
3201 TTGTGCTGACTCTAGCACAGTGGCCAGGATCCAATACGAGTCCAGGGGTGACCGCAGGATGGTGGGGGCAGCGGGCTTCT
3281 CCACCTACCCCAGCCACCAAGGCCCTGACGCACTGCCTCCTGCACCTTCAGCACATCCCTGTGCACAGCTGGAAGGGTGC
3361 ATGGCCCGCTCACCTTTGTTCAGATGGGTGGAAACGCTGATGATACCAGCTCCTCCCTGCCGTGCCCCTGCCACGGAGCA
3441 GGCATTGTGAACTGGCTGGTGTTTGCAGTCCCACGTGGCATGGCCTCCAGCCCAACCCACAGTGGAGACTGGAGACAGGG
3521 CAATGAGTCTGGTGGGGGGCACGTGGACATGCCCCATAGGGGCCCCACCCAGACTTAACAGGCAAGGTCCTGGGCATTGC
3601 GCGACGCAGGACTCAATGCTAAAGCAAGCCTGCCTGGCTCTGTGCCAGGGCCCCTCTTCTGATTCACACATCCCATTTTT
3681 ACACAGACCCTTCCTTCTTAATAAAGGCTGACAGTTCTGTTGGCAGCCAAGAACCCACACCATGAAGACAGGGAGTGAGG
3761 GGCCTTTGTGCCCAACTCCAGCACAGCTGCGTTCTGGGGTGTGTGAGAGGCATGTTCGTGTCTGTGCGCTGGTGGTCTCG
3841 TGAGACAGTTCCGAGGACGGGGAAATTGCAGGGTGGTGGGGGCGTGAGGCTTATATGTGGAACTGATGCAGAGTTCGCCT
3921 GCAGACGGATCTGGATATACACTATGTATAATTGTTACGTGTAATTTAAAATATATCTGTTTGCCATCGTCATGAGAAGA
4001 TTATATGTAAGGCTCTGAAGGGAGAGGGAGATGTACATTCTGCCAGGCTCCTGGGGACCTTATCCGAGTCATGAAATTGA
4081 TTACTGTTGATCCAGTGGTGCAAGAAGCTACACTCCATGTGTCATCACGCTTATGACTCCTAATGTATTTTTAAGGCAAA
4161 AAATGTCAGCCGACTCCATCTTCACCCCTCGATTCCTCGAGTCCAGCCTTTCTGTGCCAGTGCTTCACTGAGCCACAACG
4241 CTCTCGCCATCGGGACCCGGCTGGGCCTGGAGTCTCGGGGCACAGTTGCCATGGAGCCCTCCTGGGTCATTCTACAAATG
4321 TGCTGAGTGCCAGCTGAAAACCCCACAGGAGATGGAGTACCTTGGCCAAGCTTAAAGAGAAGATTTTCTCAGGGTATTTA
4401 TTAGTGTGTCCAGCAGGGTCAGGAAGCAGGATGGAAAGATGCACTCAGACTGTTAATTTATTAACAAGGCAAATGATTTT
4481 GTGTTTCTTGATGACAGACTATTAAGTTTGGGACTTATTTTCCCATTTGAGAAGTTATAATATATATTTAAGATGATAAG
4561 TTTCCTGCTTAAGTTGTGCCTTTCAGCTTCAATGAGTTTAAGGAGCACTAAGGGTAATGATACCAATGAGGGTTGGTTTA
4641 TTATCAAACCTGAATAGCTGTGGTTTCTCCAGTAAATATTTTCTTCTACTGAACATGGAGCCATTATTAAGAGTTGTGTG
4721 TTTTTTATTATGTACATTTGTATATTTTTTTGCTTGTTTGATGTTCTATTTTTCTAATAGTTTTCTTTTAGTTTCTTAAA
4801 GTTGTGATACTAGATTTAGATTCTGATGCTAACTGCAAATCAGGTTGGTCTCTGCTGGGTCTCTCCTGCTTTTATTTTAC
4881 TTTAAGGACAAGTGTAGTTGTCGTCCACCACCTTTCAAAAAATGTGAAACTGCCCTGCCTCCCCTTTTTGCTGACAACAC
4961 TGTGTACATTGACCACTTCCTACCATACTTTATGTTGTAAAATCAAACTCTTTTGTGGTACATTATCTCATGCTTCTGCA
5041 AATTCGAATAAATTCTATGGCTTCCAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACA----GUGUGAGGu 5'
            |:||||||| |    |||||||| 
Target 5' ccAGCACCATT-TCACACACACTCCt 3'
1347 - 1371 169.00 -22.00
2
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |::  ||||| ||||||| 
Target 5' tccATGAAATTGTGACACTCCa 3'
1077 - 1098 163.00 -19.10
3
miRNA  3' guuuguggUAACA-GUGUGAGGu 5'
                  ||||| ||:||||| 
Target 5' ggattgaaATTGTGCATACTCCa 3'
380 - 402 146.00 -16.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30158706 2 COSMIC
COSN26995514 13 COSMIC
COSN26663970 29 COSMIC
COSN26995515 43 COSMIC
COSN8778724 68 COSMIC
COSN20077912 217 COSMIC
COSN26614564 323 COSMIC
COSN30159448 336 COSMIC
COSN8778723 350 COSMIC
COSN6225932 461 COSMIC
COSN24914023 603 COSMIC
COSN31577780 699 COSMIC
COSN31537333 758 COSMIC
COSN31585774 804 COSMIC
COSN30175378 1007 COSMIC
COSN31540110 1011 COSMIC
COSN26643761 1137 COSMIC
COSN31597083 1255 COSMIC
COSN19664072 1283 COSMIC
COSN31562647 1312 COSMIC
COSN28201224 1601 COSMIC
COSN7398041 2167 COSMIC
COSN32140891 2445 COSMIC
COSN8778722 2476 COSMIC
COSN20110516 2501 COSMIC
COSN6225931 2653 COSMIC
COSN8778721 2809 COSMIC
COSN5190242 2883 COSMIC
COSN17037435 2935 COSMIC
COSN20092756 2958 COSMIC
COSN9745049 3059 COSMIC
COSN27118708 3858 COSMIC
COSN31482697 4086 COSMIC
COSN31593197 4256 COSMIC
COSN23987486 4574 COSMIC
COSN31564889 4608 COSMIC
COSN31566408 4619 COSMIC
COSN31542519 4829 COSMIC
COSN15921911 4935 COSMIC
COSN1605587 4982 COSMIC
COSN31582699 5051 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs750844620 1 dbSNP
rs1304883376 2 dbSNP
rs768042908 4 dbSNP
rs376156230 9 dbSNP
rs41318021 10 dbSNP
rs370542726 11 dbSNP
rs752502431 12 dbSNP
rs764894723 13 dbSNP
rs1303926030 14 dbSNP
rs759409750 15 dbSNP
rs1396793440 16 dbSNP
rs561952007 18 dbSNP
rs753533336 19 dbSNP
rs766645447 19 dbSNP
rs774728799 19 dbSNP
rs1457019620 34 dbSNP
rs771009213 36 dbSNP
rs761971681 37 dbSNP
rs765557595 38 dbSNP
rs1486303025 39 dbSNP
rs1052012748 40 dbSNP
rs151304682 43 dbSNP
rs1214525707 44 dbSNP
rs749523161 45 dbSNP
rs1281588881 46 dbSNP
rs780343781 48 dbSNP
rs1290472635 53 dbSNP
rs919238452 58 dbSNP
rs1194948076 63 dbSNP
rs1244149778 64 dbSNP
rs1475964068 75 dbSNP
rs1188417939 78 dbSNP
rs972061285 79 dbSNP
rs1427175926 80 dbSNP
rs372894080 84 dbSNP
rs760184055 87 dbSNP
rs1390155348 96 dbSNP
rs942128560 98 dbSNP
rs1320554814 99 dbSNP
rs774877297 101 dbSNP
rs1377034028 102 dbSNP
rs1434098934 103 dbSNP
rs985779340 108 dbSNP
rs1246704066 111 dbSNP
rs1280288116 112 dbSNP
rs984395221 128 dbSNP
rs1198409075 131 dbSNP
rs1206487224 132 dbSNP
rs959197126 133 dbSNP
rs1447886907 138 dbSNP
rs368864281 140 dbSNP
rs553692299 149 dbSNP
rs1246650103 159 dbSNP
rs539827987 163 dbSNP
rs970591518 164 dbSNP
rs1230085793 165 dbSNP
rs529227105 167 dbSNP
rs1471866800 171 dbSNP
rs1021061009 175 dbSNP
rs142396312 176 dbSNP
rs558076372 177 dbSNP
rs1456966744 183 dbSNP
rs977237132 184 dbSNP
rs1342383802 186 dbSNP
rs1333464783 187 dbSNP
rs1338125658 190 dbSNP
rs1332410624 199 dbSNP
rs538149412 201 dbSNP
rs1389791198 209 dbSNP
rs1161829012 210 dbSNP
rs1226236513 214 dbSNP
rs1032082324 216 dbSNP
rs1007769103 217 dbSNP
rs889268551 225 dbSNP
rs1052045279 233 dbSNP
rs1164406237 234 dbSNP
rs1256070196 242 dbSNP
rs1440714143 244 dbSNP
rs1452612042 247 dbSNP
rs1472820437 251 dbSNP
rs1238747877 260 dbSNP
rs1361648370 264 dbSNP
rs75331928 264 dbSNP
rs1460604126 274 dbSNP
rs1160680097 282 dbSNP
rs1248353014 288 dbSNP
rs1431106972 292 dbSNP
rs1210348271 293 dbSNP
rs376996443 296 dbSNP
rs774338208 297 dbSNP
rs1328914284 303 dbSNP
rs898053909 304 dbSNP
rs1284835119 305 dbSNP
rs1283437029 312 dbSNP
rs1036779156 325 dbSNP
rs1255830000 326 dbSNP
rs958627411 329 dbSNP
rs867997607 337 dbSNP
rs1228868788 346 dbSNP
rs555624391 347 dbSNP
rs1482788745 352 dbSNP
rs867038013 357 dbSNP
rs1271337872 360 dbSNP
rs1282531296 361 dbSNP
rs1452106410 366 dbSNP
rs942033937 367 dbSNP
rs777427117 376 dbSNP
rs1375763664 377 dbSNP
rs1463445018 379 dbSNP
rs1168445135 385 dbSNP
rs189318665 389 dbSNP
rs1298821110 390 dbSNP
rs1002211290 391 dbSNP
rs1366215304 391 dbSNP
rs909327825 400 dbSNP
rs906568887 405 dbSNP
rs566837486 409 dbSNP
rs561542317 410 dbSNP
rs1345735171 416 dbSNP
rs1385936781 422 dbSNP
rs993623308 423 dbSNP
rs774272645 424 dbSNP
rs546917632 427 dbSNP
rs1324753042 431 dbSNP
rs926472331 437 dbSNP
rs1203095177 442 dbSNP
rs534960884 446 dbSNP
rs1160968369 456 dbSNP
rs547098902 457 dbSNP
rs913782888 459 dbSNP
rs942169581 465 dbSNP
rs988244583 467 dbSNP
rs1189055098 470 dbSNP
rs1389491616 471 dbSNP
rs533169147 482 dbSNP
rs1164929343 483 dbSNP
rs184388167 485 dbSNP
rs1457074753 496 dbSNP
rs1463359592 498 dbSNP
rs1388944256 500 dbSNP
rs1384289017 513 dbSNP
rs1007301321 514 dbSNP
rs1050603778 518 dbSNP
rs933570862 524 dbSNP
rs922962983 525 dbSNP
rs1317228038 529 dbSNP
rs769929977 552 dbSNP
rs1221053754 554 dbSNP
rs1263904392 555 dbSNP
rs953078783 556 dbSNP
rs1209104215 557 dbSNP
rs3013641 568 dbSNP
rs1185394051 573 dbSNP
rs997644881 576 dbSNP
rs1413820851 581 dbSNP
rs898105938 582 dbSNP
rs200751591 583 dbSNP
rs552436314 584 dbSNP
rs1006659284 585 dbSNP
rs1388433533 587 dbSNP
rs887773318 588 dbSNP
rs1343042863 597 dbSNP
rs1339302239 602 dbSNP
rs1379899337 618 dbSNP
rs1227818056 621 dbSNP
rs1310736516 622 dbSNP
rs1318952310 626 dbSNP
rs530499710 627 dbSNP
rs1229285115 628 dbSNP
rs1055695027 629 dbSNP
rs561915856 631 dbSNP
rs563440078 634 dbSNP
rs781134232 637 dbSNP
rs192709972 641 dbSNP
rs148809564 642 dbSNP
rs1179604995 646 dbSNP
rs1275819081 649 dbSNP
rs1046220826 650 dbSNP
rs114825198 655 dbSNP
rs971286796 671 dbSNP
rs577674590 672 dbSNP
rs867693879 678 dbSNP
rs1157996588 689 dbSNP
rs1455975892 691 dbSNP
rs913849608 696 dbSNP
rs1025006103 697 dbSNP
rs557791500 698 dbSNP
rs1375682666 700 dbSNP
rs988059318 703 dbSNP
rs993879119 712 dbSNP
rs962171331 715 dbSNP
rs1323561644 716 dbSNP
rs544491244 718 dbSNP
rs1423423643 722 dbSNP
rs1370690740 723 dbSNP
rs1252510064 729 dbSNP
rs1016724404 730 dbSNP
rs1180917446 732 dbSNP
rs1249177956 734 dbSNP
rs1481244417 742 dbSNP
rs1170043791 750 dbSNP
rs755499209 757 dbSNP
rs1414381048 758 dbSNP
rs924954563 759 dbSNP
rs1050534833 760 dbSNP
rs1191571373 764 dbSNP
rs1478918812 768 dbSNP
rs1307563072 769 dbSNP
rs1244904894 771 dbSNP
rs1438926654 772 dbSNP
rs1275201768 782 dbSNP
rs1221706719 783 dbSNP
rs144384503 794 dbSNP
rs555669102 795 dbSNP
rs1342176003 797 dbSNP
rs780366572 801 dbSNP
rs1271938081 802 dbSNP
rs543652012 803 dbSNP
rs112674555 804 dbSNP
rs1247605096 810 dbSNP
rs566704574 812 dbSNP
rs1365982850 830 dbSNP
rs758722298 837 dbSNP
rs2277452 839 dbSNP
rs1410999206 840 dbSNP
rs539931539 845 dbSNP
rs2277453 849 dbSNP
rs550579698 851 dbSNP
rs372503659 855 dbSNP
rs1299620581 856 dbSNP
rs369624670 860 dbSNP
rs111521399 866 dbSNP
rs1055722430 868 dbSNP
rs1001454544 878 dbSNP
rs907333876 896 dbSNP
rs1045792446 899 dbSNP
rs1176422609 901 dbSNP
rs949268913 902 dbSNP
rs1415925709 905 dbSNP
rs962321767 927 dbSNP
rs752250598 932 dbSNP
rs568397402 938 dbSNP
rs9579382 940 dbSNP
rs892288247 956 dbSNP
rs1188514865 961 dbSNP
rs1052670394 964 dbSNP
rs936621000 966 dbSNP
rs1473822859 975 dbSNP
rs1163996405 978 dbSNP
rs1006284406 982 dbSNP
rs1403874885 983 dbSNP
rs1322260789 990 dbSNP
rs1389164867 998 dbSNP
rs953449091 1000 dbSNP
rs925152379 1001 dbSNP
rs997616107 1006 dbSNP
rs1448139246 1008 dbSNP
rs1180092568 1010 dbSNP
rs1283163298 1011 dbSNP
rs985802332 1019 dbSNP
rs1480389421 1020 dbSNP
rs1330284938 1026 dbSNP
rs199667020 1026 dbSNP
rs1020918911 1030 dbSNP
rs539141576 1030 dbSNP
rs1444696635 1033 dbSNP
rs1212573891 1044 dbSNP
rs1188322924 1045 dbSNP
rs1010478709 1055 dbSNP
rs1471918985 1058 dbSNP
rs1161674989 1060 dbSNP
rs892831457 1060 dbSNP
rs1456512496 1067 dbSNP
rs1156786557 1069 dbSNP
rs1404262484 1074 dbSNP
rs1332907448 1075 dbSNP
rs559749560 1085 dbSNP
rs1288596724 1088 dbSNP
rs1310759142 1094 dbSNP
rs146293204 1095 dbSNP
rs923039303 1097 dbSNP
rs1228154981 1100 dbSNP
rs1259407091 1113 dbSNP
rs975842619 1116 dbSNP
rs1201577201 1118 dbSNP
rs1277939389 1120 dbSNP
rs1484748774 1121 dbSNP
rs1054106685 1123 dbSNP
rs189439077 1126 dbSNP
rs559910112 1128 dbSNP
rs905584924 1131 dbSNP
rs9579381 1136 dbSNP
rs546334138 1137 dbSNP
rs780664134 1139 dbSNP
rs1171959381 1146 dbSNP
rs1399357278 1148 dbSNP
rs533081497 1154 dbSNP
rs754625489 1155 dbSNP
rs1369559661 1164 dbSNP
rs1045612580 1165 dbSNP
rs1333212081 1176 dbSNP
rs184559759 1177 dbSNP
rs1034554521 1180 dbSNP
rs1372031290 1180 dbSNP
rs1001531585 1181 dbSNP
rs907196449 1183 dbSNP
rs142053658 1184 dbSNP
rs1275495248 1192 dbSNP
rs1482839337 1208 dbSNP
rs1449799327 1211 dbSNP
rs1433563875 1214 dbSNP
rs1024374156 1223 dbSNP
rs1198014107 1227 dbSNP
rs1375851031 1231 dbSNP
rs771019380 1237 dbSNP
rs1369449440 1238 dbSNP
rs891852640 1239 dbSNP
rs762786779 1246 dbSNP
rs936468839 1247 dbSNP
rs1294955304 1250 dbSNP
rs1393241930 1251 dbSNP
rs773154041 1255 dbSNP
rs903811202 1256 dbSNP
rs1369422296 1257 dbSNP
rs984726964 1258 dbSNP
rs865785684 1260 dbSNP
rs1050314615 1267 dbSNP
rs376765570 1268 dbSNP
rs1225435485 1270 dbSNP
rs557060204 1272 dbSNP
rs1267475977 1276 dbSNP
rs1414089408 1278 dbSNP
rs931663748 1279 dbSNP
rs1028992603 1281 dbSNP
rs976226947 1282 dbSNP
rs1189160147 1284 dbSNP
rs1183779182 1288 dbSNP
rs1426221840 1290 dbSNP
rs922944486 1291 dbSNP
rs1368670865 1295 dbSNP
rs1020448036 1296 dbSNP
rs1163017344 1297 dbSNP
rs1392767345 1299 dbSNP
rs116575503 1301 dbSNP
rs1023532013 1307 dbSNP
rs536746250 1312 dbSNP
rs1001180733 1313 dbSNP
rs907580609 1317 dbSNP
rs985007921 1320 dbSNP
rs952214066 1321 dbSNP
rs561830307 1322 dbSNP
rs763254629 1322 dbSNP
rs1315755323 1323 dbSNP
rs1247356571 1331 dbSNP
rs1484885004 1335 dbSNP
rs980310971 1336 dbSNP
rs879245382 1344 dbSNP
rs897020227 1345 dbSNP
rs1185388659 1350 dbSNP
rs1024329002 1367 dbSNP
rs1036852949 1370 dbSNP
rs138788583 1371 dbSNP
rs1345113771 1373 dbSNP
rs1452312603 1379 dbSNP
rs1304641970 1391 dbSNP
rs891887745 1394 dbSNP
rs1033504048 1395 dbSNP
rs1000729405 1400 dbSNP
rs921926320 1401 dbSNP
rs976174768 1407 dbSNP
rs1267342454 1409 dbSNP
rs903675278 1410 dbSNP
rs191955097 1412 dbSNP
rs1442916769 1419 dbSNP
rs1256032818 1423 dbSNP
rs1020902470 1425 dbSNP
rs114934365 1426 dbSNP
rs769990669 1435 dbSNP
rs1189498368 1437 dbSNP
rs1472754558 1440 dbSNP
rs1183314668 1441 dbSNP
rs1466512932 1444 dbSNP
rs1407782981 1446 dbSNP
rs1040046157 1448 dbSNP
rs1178906337 1452 dbSNP
rs1434195400 1455 dbSNP
rs957878370 1462 dbSNP
rs539516012 1463 dbSNP
rs3011624 1471 dbSNP
rs557066361 1472 dbSNP
rs907653426 1488 dbSNP
rs537024097 1494 dbSNP
rs969746034 1496 dbSNP
rs1223124799 1521 dbSNP
rs1023975661 1535 dbSNP
rs1276209242 1541 dbSNP
rs930844409 1542 dbSNP
rs1204036647 1559 dbSNP
rs927481190 1569 dbSNP
rs1479863290 1577 dbSNP
rs1193367162 1598 dbSNP
rs980217666 1599 dbSNP
rs1426465234 1606 dbSNP
rs1228716046 1608 dbSNP
rs896873233 1610 dbSNP
rs971625664 1613 dbSNP
rs1328442394 1615 dbSNP
rs1005345674 1616 dbSNP
rs1438333690 1618 dbSNP
rs1293967197 1621 dbSNP
rs1370121217 1623 dbSNP
rs1293184306 1626 dbSNP
rs768659557 1627 dbSNP
rs545261421 1641 dbSNP
rs71090263 1641 dbSNP
rs577159048 1646 dbSNP
rs1299121771 1654 dbSNP
rs917457192 1656 dbSNP
rs747123544 1657 dbSNP
rs568158878 1659 dbSNP
rs1422786948 1660 dbSNP
rs77327379 1662 dbSNP
rs1247695362 1667 dbSNP
rs1049665270 1670 dbSNP
rs548560175 1673 dbSNP
rs1192332892 1674 dbSNP
rs932566175 1678 dbSNP
rs535333121 1685 dbSNP
rs3013640 1690 dbSNP
rs552753341 1697 dbSNP
rs913295274 1697 dbSNP
rs1322467105 1699 dbSNP
rs1365210451 1705 dbSNP
rs150778492 1711 dbSNP
rs1267964639 1713 dbSNP
rs926102507 1719 dbSNP
rs1228581498 1725 dbSNP
rs1028831511 1730 dbSNP
rs1290977975 1733 dbSNP
rs1334615933 1735 dbSNP
rs755720947 1736 dbSNP
rs1270059144 1737 dbSNP
rs980390368 1739 dbSNP
rs1212300619 1754 dbSNP
rs1270559345 1756 dbSNP
rs372527870 1770 dbSNP
rs1023988905 1771 dbSNP
rs1489612245 1781 dbSNP
rs750722999 1783 dbSNP
rs961421140 1784 dbSNP
rs1416818383 1786 dbSNP
rs1161179542 1797 dbSNP
rs1459694731 1797 dbSNP
rs1205345045 1799 dbSNP
rs1040688735 1801 dbSNP
rs1004578453 1802 dbSNP
rs1315589194 1821 dbSNP
rs550741723 1824 dbSNP
rs1015309014 1825 dbSNP
rs1448249862 1826 dbSNP
rs530508711 1831 dbSNP
rs543640009 1838 dbSNP
rs1457354310 1843 dbSNP
rs1231838376 1853 dbSNP
rs1303290519 1855 dbSNP
rs1403051399 1858 dbSNP
rs888317331 1862 dbSNP
rs541711488 1863 dbSNP
rs1282189707 1864 dbSNP
rs1308715262 1867 dbSNP
rs996746841 1869 dbSNP
rs901069780 1872 dbSNP
rs1184046033 1880 dbSNP
rs1474389411 1880 dbSNP
rs930415630 1880 dbSNP
rs1040798273 1890 dbSNP
rs752293869 1896 dbSNP
rs1044551324 1900 dbSNP
rs1403647672 1901 dbSNP
rs1414529387 1911 dbSNP
rs950212933 1917 dbSNP
rs1053242646 1918 dbSNP
rs913317888 1918 dbSNP
rs1167600719 1919 dbSNP
rs936068848 1920 dbSNP
rs1379758194 1923 dbSNP
rs1238873119 1928 dbSNP
rs141258338 1938 dbSNP
rs1480399000 1945 dbSNP
rs989455232 1948 dbSNP
rs1182255605 1949 dbSNP
rs369101435 1959 dbSNP
rs1207589454 1966 dbSNP
rs566395492 1969 dbSNP
rs77301268 1974 dbSNP
rs970315742 1986 dbSNP
rs956287081 1987 dbSNP
rs1437022068 1988 dbSNP
rs1179468618 1991 dbSNP
rs917467789 1998 dbSNP
rs1172449561 2003 dbSNP
rs1478338005 2003 dbSNP
rs925964816 2003 dbSNP
rs1392746626 2004 dbSNP
rs1194921601 2012 dbSNP
rs559246310 2013 dbSNP
rs1345394580 2017 dbSNP
rs1397581674 2029 dbSNP
rs1257570278 2031 dbSNP
rs573413252 2041 dbSNP
rs992911377 2045 dbSNP
rs961103299 2046 dbSNP
rs545576271 2047 dbSNP
rs1028402960 2055 dbSNP
rs1345860816 2057 dbSNP
rs1230802478 2061 dbSNP
rs767019167 2063 dbSNP
rs1322745888 2065 dbSNP
rs983908223 2072 dbSNP
rs754494051 2073 dbSNP
rs1193825273 2074 dbSNP
rs75892428 2076 dbSNP
rs996612895 2088 dbSNP
rs1192962079 2102 dbSNP
rs1250520814 2103 dbSNP
rs1450803554 2104 dbSNP
rs1168746413 2105 dbSNP
rs1334110711 2109 dbSNP
rs901102263 2110 dbSNP
rs17602182 2120 dbSNP
rs1009889950 2126 dbSNP
rs886336155 2134 dbSNP
rs555062657 2135 dbSNP
rs994428902 2155 dbSNP
rs905656065 2158 dbSNP
rs1044122257 2159 dbSNP
rs950270203 2160 dbSNP
rs1053511634 2163 dbSNP
rs1326050460 2165 dbSNP
rs537159516 2167 dbSNP
rs1335237876 2172 dbSNP
rs895985219 2176 dbSNP
rs1413339467 2177 dbSNP
rs1212924494 2178 dbSNP
rs1271176066 2198 dbSNP
rs574698354 2200 dbSNP
rs762987051 2201 dbSNP
rs1260495353 2202 dbSNP
rs1426319851 2209 dbSNP
rs1189228850 2214 dbSNP
rs934910161 2215 dbSNP
rs1180596937 2223 dbSNP
rs926190087 2229 dbSNP
rs978790881 2231 dbSNP
rs372291319 2232 dbSNP
rs1044586671 2236 dbSNP
rs530864049 2241 dbSNP
rs1459327904 2251 dbSNP
rs554972033 2254 dbSNP
rs1460756154 2261 dbSNP
rs1380675800 2264 dbSNP
rs1315120766 2268 dbSNP
rs1356399582 2276 dbSNP
rs1232457098 2278 dbSNP
rs1268666947 2297 dbSNP
rs1225418184 2302 dbSNP
rs921371403 2303 dbSNP
rs1259590842 2305 dbSNP
rs542607701 2305 dbSNP
rs917398297 2309 dbSNP
rs1201759413 2310 dbSNP
rs15376 2315 dbSNP
rs976821841 2318 dbSNP
rs1474698820 2322 dbSNP
rs965466043 2337 dbSNP
rs773053255 2338 dbSNP
rs188342862 2340 dbSNP
rs1416169508 2348 dbSNP
rs76803270 2355 dbSNP
rs1160472152 2369 dbSNP
rs1344621552 2371 dbSNP
rs940246130 2387 dbSNP
rs983266911 2390 dbSNP
rs908229112 2391 dbSNP
rs3011623 2392 dbSNP
rs1452332037 2393 dbSNP
rs1310798454 2396 dbSNP
rs1389902028 2401 dbSNP
rs762066457 2407 dbSNP
rs1352134667 2408 dbSNP
rs1323080829 2412 dbSNP
rs539233686 2415 dbSNP
rs1027522081 2436 dbSNP
rs1306221405 2443 dbSNP
rs1315118402 2446 dbSNP
rs1027991398 2451 dbSNP
rs994502195 2452 dbSNP
rs1280481792 2456 dbSNP
rs975227250 2460 dbSNP
rs1208317739 2461 dbSNP
rs1255764339 2463 dbSNP
rs905518678 2474 dbSNP
rs965220161 2479 dbSNP
rs1157493980 2490 dbSNP
rs1472872104 2492 dbSNP
rs1386700665 2494 dbSNP
rs1181424337 2496 dbSNP
rs1443733605 2498 dbSNP
rs1248448948 2499 dbSNP
rs1217780675 2500 dbSNP
rs201434764 2501 dbSNP
rs1283547009 2507 dbSNP
rs200438199 2510 dbSNP
rs1371063850 2511 dbSNP
rs3840002 2511 dbSNP
rs397841541 2511 dbSNP
rs398077150 2511 dbSNP
rs1210506185 2514 dbSNP
rs1264175467 2514 dbSNP
rs1361736592 2515 dbSNP
rs570302106 2519 dbSNP
rs550654454 2520 dbSNP
rs1303447455 2522 dbSNP
rs776677836 2531 dbSNP
rs768945270 2534 dbSNP
rs1313160908 2536 dbSNP
rs1276316345 2539 dbSNP
rs530624590 2540 dbSNP
rs747037656 2546 dbSNP
rs1245549927 2549 dbSNP
rs1366328833 2566 dbSNP
rs1009510680 2573 dbSNP
rs934835839 2584 dbSNP
rs1232717520 2585 dbSNP
rs1479919409 2587 dbSNP
rs1196092189 2589 dbSNP
rs1272293781 2590 dbSNP
rs1453887774 2593 dbSNP
rs1171916980 2594 dbSNP
rs1429160775 2605 dbSNP
rs892365890 2607 dbSNP
rs1031686226 2610 dbSNP
rs1169420185 2615 dbSNP
rs766352524 2617 dbSNP
rs1345098297 2618 dbSNP
rs775555530 2626 dbSNP
rs1043308810 2628 dbSNP
rs1462887082 2637 dbSNP
rs904614894 2637 dbSNP
rs1035398417 2640 dbSNP
rs1370228213 2647 dbSNP
rs1438065291 2648 dbSNP
rs1271466009 2651 dbSNP
rs1002795961 2653 dbSNP
rs116401454 2672 dbSNP
rs1272695888 2672 dbSNP
rs1216037726 2675 dbSNP
rs1274342083 2684 dbSNP
rs1468478547 2685 dbSNP
rs73154427 2689 dbSNP
rs944124950 2690 dbSNP
rs896006998 2695 dbSNP
rs1186148997 2698 dbSNP
rs182823000 2699 dbSNP
rs1476055981 2701 dbSNP
rs983724466 2706 dbSNP
rs950578589 2714 dbSNP
rs1027551730 2723 dbSNP
rs559574681 2724 dbSNP
rs1345305762 2730 dbSNP
rs1429516003 2731 dbSNP
rs1188033588 2732 dbSNP
rs1357038953 2740 dbSNP
rs969923703 2741 dbSNP
rs1022588913 2742 dbSNP
rs940297607 2745 dbSNP
rs1013887247 2748 dbSNP
rs908765261 2751 dbSNP
rs983755104 2757 dbSNP
rs545737558 2758 dbSNP
rs1447668873 2763 dbSNP
rs375647160 2765 dbSNP
rs1490846503 2772 dbSNP
rs999450167 2777 dbSNP
rs1221940444 2785 dbSNP
rs77136613 2786 dbSNP
rs1043220785 2790 dbSNP
rs997122314 2791 dbSNP
rs900047839 2799 dbSNP
rs1160235081 2800 dbSNP
rs988352638 2803 dbSNP
rs1041452449 2804 dbSNP
rs774974004 2806 dbSNP
rs761639393 2807 dbSNP
rs944045723 2807 dbSNP
rs1243179551 2824 dbSNP
rs908660637 2829 dbSNP
rs1022953614 2830 dbSNP
rs1407336869 2831 dbSNP
rs1284030095 2834 dbSNP
rs115169373 2855 dbSNP
rs929170711 2856 dbSNP
rs1300766405 2858 dbSNP
rs1484577464 2863 dbSNP
rs1423516474 2864 dbSNP
rs762470369 2865 dbSNP
rs895859641 2872 dbSNP
rs920446411 2874 dbSNP
rs973171694 2876 dbSNP
rs1057317434 2877 dbSNP
rs1172638152 2881 dbSNP
rs1004750449 2883 dbSNP
rs143191669 2884 dbSNP
rs1048661580 2885 dbSNP
rs1481377820 2887 dbSNP
rs1442143221 2889 dbSNP
rs915820835 2890 dbSNP
rs1266784640 2891 dbSNP
rs1235229324 2893 dbSNP
rs1279869292 2897 dbSNP
rs372658315 2903 dbSNP
rs1197301784 2904 dbSNP
rs374245757 2908 dbSNP
rs931563276 2914 dbSNP
rs1176704855 2915 dbSNP
rs959713408 2920 dbSNP
rs1031864265 2921 dbSNP
rs1454322420 2922 dbSNP
rs998626357 2925 dbSNP
rs554800191 2929 dbSNP
rs1039334288 2933 dbSNP
rs1202752188 2937 dbSNP
rs1021807580 2941 dbSNP
rs1329928957 2946 dbSNP
rs1373909162 2952 dbSNP
rs1441732282 2956 dbSNP
rs912275941 2957 dbSNP
rs1251635647 2958 dbSNP
rs749691136 2962 dbSNP
rs956779891 2963 dbSNP
rs1322018840 2964 dbSNP
rs1283290494 2965 dbSNP
rs1403769031 2966 dbSNP
rs900121391 2969 dbSNP
rs1373939985 2973 dbSNP
rs1041298448 2984 dbSNP
rs570788033 2985 dbSNP
rs887103266 2988 dbSNP
rs1397286417 2991 dbSNP
rs979367218 2995 dbSNP
rs1325249541 3007 dbSNP
rs1047477662 3011 dbSNP
rs931399764 3013 dbSNP
rs754690522 3014 dbSNP
rs1296542890 3017 dbSNP
rs1326137537 3029 dbSNP
rs1216534876 3034 dbSNP
rs1037531065 3035 dbSNP
rs1294951478 3037 dbSNP
rs1353634332 3041 dbSNP
rs1213021522 3045 dbSNP
rs948552244 3049 dbSNP
rs1263092688 3052 dbSNP
rs1337159006 3061 dbSNP
rs1486570829 3063 dbSNP
rs1205269249 3067 dbSNP
rs1470867116 3068 dbSNP
rs1022984595 3069 dbSNP
rs1487129585 3071 dbSNP
rs1427106830 3077 dbSNP
rs751045989 3080 dbSNP
rs992743913 3081 dbSNP
rs960197598 3086 dbSNP
rs1175636289 3087 dbSNP
rs541394932 3094 dbSNP
rs758394703 3096 dbSNP
rs750369807 3099 dbSNP
rs1384498675 3104 dbSNP
rs1398403900 3107 dbSNP
rs1314441479 3112 dbSNP
rs1355856401 3113 dbSNP
rs1232546604 3118 dbSNP
rs1238327355 3120 dbSNP
rs192880323 3122 dbSNP
rs1259682048 3124 dbSNP
rs1350990829 3128 dbSNP
rs1212617888 3130 dbSNP
rs1460295001 3131 dbSNP
rs559284133 3137 dbSNP
rs1181709398 3139 dbSNP
rs1254650578 3141 dbSNP
rs1021378558 3143 dbSNP
rs975619077 3144 dbSNP
rs1421448377 3154 dbSNP
rs1263042918 3157 dbSNP
rs1379794363 3158 dbSNP
rs879866438 3162 dbSNP
rs1048528817 3177 dbSNP
rs1175770294 3181 dbSNP
rs34015769 3191 dbSNP
rs539348665 3192 dbSNP
rs1413939944 3195 dbSNP
rs995745509 3196 dbSNP
rs1039364104 3213 dbSNP
rs1305624413 3223 dbSNP
rs1020315023 3228 dbSNP
rs1008493729 3238 dbSNP
rs1235968595 3238 dbSNP
rs1346751853 3240 dbSNP
rs1316942815 3248 dbSNP
rs1254651618 3249 dbSNP
rs1178282560 3252 dbSNP
rs887317560 3253 dbSNP
rs943667559 3254 dbSNP
rs1372136070 3264 dbSNP
rs1025651734 3272 dbSNP
rs995457872 3273 dbSNP
rs1173636516 3275 dbSNP
rs1454347805 3279 dbSNP
rs1356093862 3282 dbSNP
rs1462375751 3286 dbSNP
rs1330610052 3288 dbSNP
rs935074331 3290 dbSNP
rs1442424025 3293 dbSNP
rs1303569808 3300 dbSNP
rs368543943 3309 dbSNP
rs570216958 3310 dbSNP
rs556818040 3312 dbSNP
rs948581968 3313 dbSNP
rs1156998595 3337 dbSNP
rs916461353 3346 dbSNP
rs894320699 3348 dbSNP
rs1456857932 3349 dbSNP
rs1418647544 3350 dbSNP
rs748285243 3361 dbSNP
rs1057343096 3362 dbSNP
rs938616637 3365 dbSNP
rs530137212 3367 dbSNP
rs878877056 3368 dbSNP
rs565378840 3373 dbSNP
rs1428884434 3384 dbSNP
rs1169745661 3386 dbSNP
rs1443115422 3395 dbSNP
rs977121621 3396 dbSNP
rs947034824 3397 dbSNP
rs960350621 3408 dbSNP
rs545214870 3411 dbSNP
rs1209829941 3418 dbSNP
rs374700300 3421 dbSNP
rs1259539906 3422 dbSNP
rs1213030490 3426 dbSNP
rs1219602776 3430 dbSNP
rs951456962 3432 dbSNP
rs558756935 3434 dbSNP
rs536711225 3435 dbSNP
rs975146190 3443 dbSNP
rs568129263 3445 dbSNP
rs1027125699 3452 dbSNP
rs1273818864 3458 dbSNP
rs995611401 3475 dbSNP
rs1219544427 3478 dbSNP
rs548006536 3485 dbSNP
rs1486343363 3504 dbSNP
rs528084241 3509 dbSNP
rs1018975229 3510 dbSNP
rs1165574765 3512 dbSNP
rs1314129009 3517 dbSNP
rs1403090038 3522 dbSNP
rs1008475758 3523 dbSNP
rs987339421 3531 dbSNP
rs1124594 3534 dbSNP
rs1026313609 3535 dbSNP
rs36114772 3540 dbSNP
rs995489035 3540 dbSNP
rs898486399 3542 dbSNP
rs1317697838 3543 dbSNP
rs1216163849 3549 dbSNP
rs552008600 3554 dbSNP
rs1422978179 3555 dbSNP
rs903581865 3557 dbSNP
rs1384934784 3560 dbSNP
rs532298008 3564 dbSNP
rs1236797054 3569 dbSNP
rs1043580977 3579 dbSNP
rs569609398 3590 dbSNP
rs1159747410 3591 dbSNP
rs1023562090 3597 dbSNP
rs563111649 3601 dbSNP
rs1430729367 3602 dbSNP
rs896525199 3603 dbSNP
rs1056975168 3605 dbSNP
rs376271361 3606 dbSNP
rs938508953 3607 dbSNP
rs1335329002 3609 dbSNP
rs142227164 3612 dbSNP
rs373890234 3626 dbSNP
rs529876266 3629 dbSNP
rs1446496835 3631 dbSNP
rs1281285340 3640 dbSNP
rs1041638829 3642 dbSNP
rs187685469 3647 dbSNP
rs914255343 3650 dbSNP
rs1291909017 3651 dbSNP
rs1284141103 3652 dbSNP
rs865829037 3659 dbSNP
rs1039364607 3662 dbSNP
rs1571784 3665 dbSNP
rs1277684120 3669 dbSNP
rs1440588474 3672 dbSNP
rs912291535 3674 dbSNP
rs1183910637 3681 dbSNP
rs951485756 3702 dbSNP
rs1438531369 3704 dbSNP
rs1176317710 3717 dbSNP
rs528249879 3723 dbSNP
rs1434969548 3743 dbSNP
rs987026245 3747 dbSNP
rs61948792 3753 dbSNP
rs1401947103 3763 dbSNP
rs918866146 3767 dbSNP
rs1331443019 3769 dbSNP
rs1227849273 3782 dbSNP
rs974306480 3790 dbSNP
rs74044839 3791 dbSNP
rs1446090076 3797 dbSNP
rs1293298394 3798 dbSNP
rs1234283293 3802 dbSNP
rs1381614198 3817 dbSNP
rs1346160472 3818 dbSNP
rs1342635041 3827 dbSNP
rs964217600 3827 dbSNP
rs1305044740 3829 dbSNP
rs1023593100 3831 dbSNP
rs376151632 3839 dbSNP
rs1457294830 3843 dbSNP
rs960857362 3846 dbSNP
rs1365180439 3852 dbSNP
rs545688945 3853 dbSNP
rs1035514757 3858 dbSNP
rs1002735156 3859 dbSNP
rs1477241676 3864 dbSNP
rs903002680 3869 dbSNP
rs1031102839 3871 dbSNP
rs1041543590 3871 dbSNP
rs999151845 3880 dbSNP
rs1011518896 3883 dbSNP
rs903611685 3883 dbSNP
rs1043530458 3884 dbSNP
rs1170309652 3893 dbSNP
rs576824315 3895 dbSNP
rs556928411 3896 dbSNP
rs536830881 3897 dbSNP
rs1481059058 3914 dbSNP
rs942357226 3916 dbSNP
rs912337667 3917 dbSNP
rs907763027 3926 dbSNP
rs1047510309 3927 dbSNP
rs1264788859 3930 dbSNP
rs1266207560 3934 dbSNP
rs574197637 3940 dbSNP
rs929946274 3943 dbSNP
rs1448419729 3946 dbSNP
rs751362453 3951 dbSNP
rs532648048 3954 dbSNP
rs1477743343 3959 dbSNP
rs1341166507 3968 dbSNP
rs778203813 3974 dbSNP
rs974149459 3982 dbSNP
rs964082463 3986 dbSNP
rs1162785500 3988 dbSNP
rs911391001 3989 dbSNP
rs986963006 3992 dbSNP
rs929710958 3999 dbSNP
rs1285182945 4001 dbSNP
rs182194776 4002 dbSNP
rs1295047549 4003 dbSNP
rs1322298586 4004 dbSNP
rs974170653 4005 dbSNP
rs1243402918 4006 dbSNP
rs1263192208 4009 dbSNP
rs1345019400 4010 dbSNP
rs999771668 4012 dbSNP
rs962941874 4020 dbSNP
rs1264274637 4021 dbSNP
rs1393388720 4025 dbSNP
rs754671917 4036 dbSNP
rs45489205 4050 dbSNP
rs1424952819 4051 dbSNP
rs543621968 4059 dbSNP
rs1012032824 4060 dbSNP
rs1421689586 4063 dbSNP
rs746314005 4065 dbSNP
rs1360201111 4066 dbSNP
rs1417597545 4074 dbSNP
rs2490264 4082 dbSNP
rs1376609998 4084 dbSNP
rs1182003976 4087 dbSNP
rs1395414634 4100 dbSNP
rs1439211572 4110 dbSNP
rs1309880668 4113 dbSNP
rs1337033346 4115 dbSNP
rs35196293 4117 dbSNP
rs1003340135 4120 dbSNP
rs966761651 4126 dbSNP
rs551774044 4128 dbSNP
rs1197772166 4129 dbSNP
rs191046361 4136 dbSNP
rs1258162361 4144 dbSNP
rs1047675246 4164 dbSNP
rs1020133405 4165 dbSNP
rs1011405706 4166 dbSNP
rs1254754079 4168 dbSNP
rs893096601 4170 dbSNP
rs1039623541 4172 dbSNP
rs1441614661 4177 dbSNP
rs1179381101 4178 dbSNP
rs1322860984 4183 dbSNP
rs930541914 4187 dbSNP
rs1177917036 4189 dbSNP
rs1006585899 4190 dbSNP
rs1038303281 4195 dbSNP
rs1241350676 4198 dbSNP
rs890797814 4199 dbSNP
rs77692729 4214 dbSNP
rs1306611230 4215 dbSNP
rs1453809618 4221 dbSNP
rs576821740 4230 dbSNP
rs987381045 4238 dbSNP
rs529891517 4239 dbSNP
rs1313133512 4240 dbSNP
rs1038540481 4243 dbSNP
rs9508481 4245 dbSNP
rs753575104 4246 dbSNP
rs916856331 4249 dbSNP
rs991469080 4251 dbSNP
rs939591175 4252 dbSNP
rs1158624507 4256 dbSNP
rs145501514 4258 dbSNP
rs1426214214 4259 dbSNP
rs978079963 4267 dbSNP
rs1470915294 4272 dbSNP
rs966794094 4274 dbSNP
rs1022385763 4276 dbSNP
rs527804198 4277 dbSNP
rs957179030 4292 dbSNP
rs1438056316 4297 dbSNP
rs959388631 4303 dbSNP
rs1366514124 4304 dbSNP
rs565246001 4314 dbSNP
rs1320569913 4320 dbSNP
rs545402471 4320 dbSNP
rs1219787143 4325 dbSNP
rs1257442096 4343 dbSNP
rs1316132506 4347 dbSNP
rs886295444 4348 dbSNP
rs1247477040 4353 dbSNP
rs1488308882 4355 dbSNP
rs891003925 4357 dbSNP
rs1265107142 4367 dbSNP
rs1029748764 4374 dbSNP
rs1337284740 4376 dbSNP
rs1169852320 4377 dbSNP
rs1478070874 4377 dbSNP
rs763938253 4378 dbSNP
rs1047540173 4384 dbSNP
rs1444964687 4384 dbSNP
rs994723696 4385 dbSNP
rs1433887241 4388 dbSNP
rs1301604352 4393 dbSNP
rs1342788642 4394 dbSNP
rs1401054298 4405 dbSNP
rs1278120608 4406 dbSNP
rs1338061361 4407 dbSNP
rs1244778315 4415 dbSNP
rs760866477 4418 dbSNP
rs576530660 4431 dbSNP
rs1038069422 4443 dbSNP
rs2482087 4444 dbSNP
rs1288491995 4446 dbSNP
rs1488490276 4448 dbSNP
rs1192715664 4449 dbSNP
rs1284954839 4450 dbSNP
rs1260902004 4452 dbSNP
rs1473749190 4453 dbSNP
rs374542142 4458 dbSNP
rs1038336080 4466 dbSNP
rs1412450175 4474 dbSNP
rs1403182424 4477 dbSNP
rs1206942206 4485 dbSNP
rs1360847000 4495 dbSNP
rs759776536 4504 dbSNP
rs942681408 4505 dbSNP
rs542990178 4542 dbSNP
rs1450858093 4543 dbSNP
rs1284791291 4545 dbSNP
rs1055275362 4555 dbSNP
rs939602078 4556 dbSNP
rs767755835 4559 dbSNP
rs1311694440 4560 dbSNP
rs1348693070 4560 dbSNP
rs866147183 4563 dbSNP
rs1285519596 4564 dbSNP
rs149835487 4573 dbSNP
rs1354746523 4580 dbSNP
rs759481937 4582 dbSNP
rs1443999304 4586 dbSNP
rs945339759 4592 dbSNP
rs1051228763 4604 dbSNP
rs934052493 4608 dbSNP
rs924135469 4613 dbSNP
rs554095698 4614 dbSNP
rs1380507120 4617 dbSNP
rs1313396429 4619 dbSNP
rs1438720745 4626 dbSNP
rs946972523 4627 dbSNP
rs1383269543 4640 dbSNP
rs1335438846 4645 dbSNP
rs1359131500 4653 dbSNP
rs534684050 4662 dbSNP
rs571794903 4669 dbSNP
rs1377874555 4676 dbSNP
rs1327523699 4681 dbSNP
rs964765007 4683 dbSNP
rs1346843761 4684 dbSNP
rs771275847 4685 dbSNP
rs1320896812 4691 dbSNP
rs959105541 4693 dbSNP
rs1035079092 4700 dbSNP
rs1382166250 4711 dbSNP
rs1157632981 4713 dbSNP
rs1018525324 4714 dbSNP
rs985275936 4717 dbSNP
rs1459966003 4720 dbSNP
rs1199931811 4727 dbSNP
rs1238292703 4730 dbSNP
rs558258932 4733 dbSNP
rs377285486 4736 dbSNP
rs1479189554 4740 dbSNP
rs868291343 4742 dbSNP
rs1425019444 4745 dbSNP
rs994589603 4752 dbSNP
rs141048375 4756 dbSNP
rs1333369508 4762 dbSNP
rs899094974 4764 dbSNP
rs993819109 4766 dbSNP
rs867872299 4770 dbSNP
rs1327096662 4783 dbSNP
rs1333088299 4788 dbSNP
rs1274053498 4790 dbSNP
rs148109926 4790 dbSNP
rs56111458 4790 dbSNP
rs573177147 4791 dbSNP
rs896814899 4792 dbSNP
rs1220401125 4798 dbSNP
rs1242609366 4804 dbSNP
rs1195268012 4826 dbSNP
rs1316739996 4829 dbSNP
rs889818101 4833 dbSNP
rs1016528344 4836 dbSNP
rs1268989861 4837 dbSNP
rs1451842112 4839 dbSNP
rs186074959 4845 dbSNP
rs1005276795 4850 dbSNP
rs1246492253 4862 dbSNP
rs1479708765 4865 dbSNP
rs1445317895 4870 dbSNP
rs1425055348 4872 dbSNP
rs1051523159 4880 dbSNP
rs1223433116 4882 dbSNP
rs1361849490 4889 dbSNP
rs374342669 4893 dbSNP
rs1166278447 4897 dbSNP
rs1393087798 4898 dbSNP
rs536157566 4902 dbSNP
rs567425976 4903 dbSNP
rs1343428374 4906 dbSNP
rs3184811 4907 dbSNP
rs879429743 4908 dbSNP
rs902577489 4910 dbSNP
rs1339811135 4950 dbSNP
rs1272379254 4959 dbSNP
rs1055709822 4960 dbSNP
rs1356525622 4965 dbSNP
rs773696707 4969 dbSNP
rs761758619 4973 dbSNP
rs1489960586 4974 dbSNP
rs1196347014 4980 dbSNP
rs552980310 4991 dbSNP
rs1003707806 5005 dbSNP
rs906800971 5006 dbSNP
rs554183240 5008 dbSNP
rs1458555686 5012 dbSNP
rs1162879980 5013 dbSNP
rs1297053399 5015 dbSNP
rs1328849966 5020 dbSNP
rs1421259472 5028 dbSNP
rs545439819 5032 dbSNP
rs945581439 5045 dbSNP
rs770330319 5046 dbSNP
rs760713463 5049 dbSNP
rs1314171566 5050 dbSNP
rs1340536033 5051 dbSNP
rs915263229 5053 dbSNP
rs1053745870 5057 dbSNP
rs1161336706 5061 dbSNP
rs1312421348 5064 dbSNP
rs577174923 5066 dbSNP
rs910628242 5067 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Huh7
Location of target site 3'UTR
Original Description (Extracted from the article) ... Reporter activity, normalized to activity of the coexpressed firefly luciferase (FL), was tested in transfected Huh7 and HepG2 cells (Figure 2B). In HepG2 cells,all three reporters were translated with comparable efficiency, but in Huh7 cells the activity of the reporter devoid of the miR-122 sites, RL-catC, was approximately 3-fold higher than that of reporters containing miR-122 sites. ...

- Bhattacharyya SN; Habermacher R; Martine U; et al., 2006, Cell.

Article - Bhattacharyya SN; Habermacher R; Martine U; et al.
- Cell, 2006
In metazoans, most microRNAs imperfectly base-pair with the 3' untranslated region (3'UTR) of target mRNAs and prevent protein accumulation by either repressing translation or inducing mRNA degradation. Examples of specific mRNAs undergoing microRNA-mediated repression are numerous, but whether the repression is a reversible process remains largely unknown. Here we show that cationic amino acid transporter 1 (CAT-1) mRNA and reporters bearing its 3'UTR can be relieved from the microRNA miR-122-induced inhibition in human hepatocarcinoma cells subjected to different stress conditions. The derepression of CAT-1 mRNA is accompanied by its release from cytoplasmic processing bodies and its recruitment to polysomes. The derepression requires binding of HuR, an AU-rich-element binding protein, to the 3'UTR of CAT-1 mRNA. We propose that proteins interacting with the 3'UTR will generally act as modifiers altering the potential of miRNAs to repress gene expression.
LinkOut: [PMID: 16777601]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Huh7 , HepG2 , 293T , AML-12 , WC-3
Location of target site 3'UTR
Tools used in this research miRanda
Article - Chang J; Nicolas E; Marks D; Sander C; et al.
- RNA biology, 2004
These studies show that miR-122, a 22-nucleotide microRNA, is derived from a liver-specific noncoding polyadenylated RNA transcribed from the gene hcr. The exact sequence of miR-122 as well as the adjacent secondary structure within the hcr mRNA are conserved from mammalian species back to fish. Levels of miR-122 in the mouse liver increase to half maximal values around day 17 of embryogenesis, and reach near maximal levels of 50,000 copies per average cell before birth. Lewis et al. (2003) predicted the cationic amino acid transporter (CAT-1 or SLC7A1) as a miR-122 target. CAT-1 protein and its mRNA are expressed in all mammalian tissues but with lower levels in adult liver. Furthermore, during mouse liver development CAT-1 mRNA decreases in an almost inverse correlation with miR-122. Eight potential miR-122 target sites were predicted within the human CAT-1 mRNA, with six in the 3'-untranslated region. Using a reporter construct it was found that just three of the predicted sites, linked in a 400-nucleotide sequence from human CAT-1, acted with synergy and were sufficient to strongly inhibit protein synthesis and reduce mRNA levels. In summary, these studies followed the accumulation during development of miR-122 from its mRNA precursor, hcr, through to identification of what may be a specific mRNA target, CAT-1.
LinkOut: [PMID: 17179747]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Location of target site 3'UTR
Original Description (Extracted from the article) ... Our results show that all three predicted regulated genes in humans(and pre-validated in mouse [Esau et al. 2006]), Aldolase A, CAT-1, and GYS1, are targets for miR-122 negative regulation. ...

- Fabani MM; Gait MJ, 2008, RNA (New York, N.Y.).

Article - Fabani MM; Gait MJ
- RNA (New York, N.Y.), 2008
MicroRNAs are small noncoding RNAs that regulate many cellular processes in a post-transcriptional mode. MicroRNA knockdown by antisense oligonucleotides is a useful strategy to explore microRNA functionality and as potential therapeutics. MicroRNA-122 (miR-122) is a liver-specific microRNA, the main function of which has been linked with lipid metabolism and liver homeostasis. Here, we show that lipofection of an antisense oligonucleotide based on a Locked Nucleic Acids (LNA)/2'-O-methyl mixmer or electroporation of a Peptide Nucleic Acid (PNA) oligomer is effective at blocking miR-122 activity in human and rat liver cells. These oligonucleotide analogs, evaluated for the first time in microRNA inhibition, are more effective than standard 2'-O-methyl oligonucleotides in binding and inhibiting microRNA action. We also show that microRNA inhibition can be achieved without the need for transfection or electroporation of the human or rat cell lines, by conjugation of an antisense PNA to the cell-penetrating peptide R6-Penetratin, or merely by linkage to just four Lys residues, highlighting the potential of PNA for future therapeutic applications as well as for studying microRNA function.
LinkOut: [PMID: 18073344]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... Verification of miR-122 target genes using 3'UTR reporter assay is shown in Supporting Table 4. ...

- Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al., 2009, Hepatology (Baltimore, Md.).

Article - Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al.
- Hepatology (Baltimore, Md.), 2009
UNLABELLED: MicroRNAs (miRNAs), which are inhibitors of gene expression, participate in diverse biological functions and in carcinogenesis. In this study, we show that liver-specific microRNA-122 (miR-122) is significantly down-regulated in liver cancers with intrahepatic metastasis and negatively regulates tumorigenesis. Restoration of miR-122 in metastatic Mahlavu and SK-HEP-1 cells significantly reduced in vitro migration, invasion, and anchorage-independent growth as well as in vivo tumorigenesis, angiogenesis, and intrahepatic metastasis in an orthotopic liver cancer model. Because an inverse expression pattern is often present between an miRNA and its target genes, we used a computational approach and identified multiple miR-122 candidate target genes from two independent expression microarray datasets. Thirty-two target genes were empirically verified, and this group of genes was enriched with genes regulating cell movement, cell morphology, cell-cell signaling, and transcription. We further showed that one of the miR-122 targets, ADAM17 (a disintegrin and metalloprotease 17) is involved in metastasis. Silencing of ADAM17 resulted in a dramatic reduction of in vitro migration, invasion, in vivo tumorigenesis, angiogenesis, and local invasion in the livers of nude mice, which is similar to that which occurs with the restoration of miR-122. CONCLUSION: Our study suggests that miR-122, a tumor suppressor microRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, exerts some of its action via regulation of ADAM17. Restoration of miR-122 has a far-reaching effect on the cell. Using the concomitant down-regulation of its targets, including ADAM17, a rational therapeutic strategy based on miR-122 may prove to be beneficial for patients with hepatocellular carcinoma.
LinkOut: [PMID: 19296470]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1