miRTarBase - #MIRT003102 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GALNT10   
Synonyms GALNACT10, PPGALNACT10, PPGANTASE10
Description polypeptide N-acetylgalactosaminyltransferase 10
Transcript NM_198321   
Expression
Putative miRNA Targets on GALNT10
3'UTR of GALNT10
(miRNA target sites are highlighted)
>GALNT10|NM_198321|3'UTR
   1 GCCCTCATGTCCCCTTGGCAGGCCCCCCAGGGTCTGGCACTCACTGCAGACTTCCTCTTTCAAGGGAGGCAGGGCCCCTG
  81 TGGGCACTAGGTGTAAAAGGTGCTGGCCAAATGGTTCAGGGTGAAGAGGGCTCTTGATTCAGGGGCTGGGGTCTGCCTGG
 161 TCCTTGAGCCCCTGAGTTGTGGGGGTAGGGTGAAGAGCATATCCCACAAGAGGCCCCACAGGGAGCAGAGACTGCTTTAA
 241 TCCCTGCTGACATCACGGAAAAGCAACAGAGCCTTTTCAACTTTGTCACTATGTCCCCTTGAACATTATGTGGGAGAACA
 321 CCAAGGTAGCCTAGGCCACCCAAAAGTGAGTCCTGCGAGGTTGCCCAGCCCTCAGATGGCTCTCCTACATGATGGTGCTT
 401 TAGAAACAAAGGTAAAATTTGCCTGTTTGGGGCAGCTTTTAGTATCGATGCCACTCATCTGCAGCAGAAGAGAAAGAAGT
 481 CCTCTTGGGGCTTTTTAGTTTCTGCCGTCCTGGGGGGAACATTGCAGTTACTGCACAGCTTCTGTTCTCTGTCACAACCC
 561 CAGGTGATTTGGTCCGGTCAAAGGCCATACTTGGGGCCCTAAGAGTGTTCAGTATTGAATGCTGATCAGCTGCCAGGTGA
 641 GGAGTCAGAAGAGGGAGCCCCCCTAGACATTTCTTTGCAGCTATGGACATGCGGGATATCTCCCCCTGCTCTCTGGGTAT
 721 TTGAAATGTCAATTTTAGCACTCTCCAGGCACAAGGACAGCCCAGCACCAGCTTTACAGGGCAGTGTTTCAGATGGCCCT
 801 GAGCCCACGGAAAAGGCCAGGTAGACCTCCAAACTAGAAATGCTGGCTGATTTGCCCTGATCCATGCTTCCATTTCCCTG
 881 TCTCTCTTCCCCAGGCAATTACTGGCCTCAAAAGAGGAACAGAGGTGCTGCGAGGTGCTCACCTCACAGAGTCTGGAGGC
 961 CTCCAGGATCAACTGTGGGCAAAGTGCCTGCCTCTGACCTCATCATGGTTCTAGTTCTCATACAGAACTCCAGAATTTTT
1041 AAAGAACTCTATAATTGGATTGCAAACTAGGATGCTACATAGGATTCTGGTATTCCACATCCAATATGGATTTCTAGAAT
1121 GCTGTGATTAAAGGAGCCAGCCAGGTGTAATACAGTCAAGGCAGCCCCCAGCCTAGAGACAATCTGTGAAATCCAAAGTT
1201 GGTGGTGTTGGGAAAGCAGGGGGACATGTGTCCCTCAGCTCAGCAGAGGCTGTGGTACAACATGGTCCTTGGTGAAGACC
1281 TGCACCCCTGGAACCTCCCACCATCATCACAACTGTAGTCTCATTTGCAGTGGAGAAAAGAACCCGACGTCCCACAGCCA
1361 GATATACACCCAGCTCCATGCCAGCCCTTCATGTTTACCTTTTGCTTTGTTAATTACATGTCAGACTCCTAGAGGGCCTC
1441 CAGACTAATAGGAAGCATTTCTGTAACCAACCTGCCACCCACTGATTCAGAAATGGAAATCACATTCCACAATCTATGGC
1521 TTCCACCAGCTAGCCCAGGAAATACTTGAAATCAGCATTCCAATTAGTGTTGAGTCTCTTGATTGTGTCATTTACCAATT
1601 AAATAACTGAGACCTAAGTCTGGGAACAGAGCCACGAATCTGCCTTTGAGATGCTGGCAGATCTCAAGGCCATCAATTAT
1681 TGGGGGAGGGAGGGACAAACACTCCCAATCATCCACCAGTCAGACTGAATGTGTAGCTGGCGAGGAATTACTTCCACTTC
1761 TGGCCCAGCACAAGCCCTGCTTTGGCCACCTGTCTGCAAGAGAGGCGGCCCCTGTGCTTGCAACGCTTACGTGTTGATCC
1841 CAGTGTCCTTTTCCAAATGAGTGCTGTAGCTTTAGAAGTGGCCCTCTATAGAAAGAAGTCAAAAGATGAGGCCCCTTCTA
1921 GAATCTAGGATAACAAGAGTGTTGACAGTTTGAGGAGTCGAATTGAGATTCATCATCAAAGAGCAATGCAGCGTCGTTAA
2001 AATAAAAACTGTGCCTTTTAAAAAGAAAAATGCAAATATAGAGCAAATCCCTAAACTTGAACCATTTCCTAGTGCCTTGC
2081 TAGACAAACATAAAGGGGCAGGGTTGTGGGGAGGGGAACGTTTTTGGTGGTGTGTGCAGTTCCTACTGGATGAGTGTGTG
2161 TTTCTTAATGTCTCATTTCAAGCAGGAGATGTTGGGTCTGGAGCAAGATCTGAGACTGAGATGTCCCCCAAGGGTGACAG
2241 GTCAGATTTATTTCAGTCAGTGCAAGTCACACTCCAAACTAAAGGCTGGGCAGTGCGTTTAGTCTGTGGCCTAGAAGACC
2321 TCATCAGCCCCCGAGAGGAGGCCTTGCATTACCTCACTGGGACCTGTTTGGGGGCCATCCCTGCGGTCCACCCTCTGAAC
2401 CCCCAGCATGTTTGTCCTGTTTCTCACCATTGGGTTAAGGGGTGCCGAGCACTAGCTAGACTTCCACATAGTCCCACCCC
2481 AAGTGGGCGGCAGTGTTCCTGGCATGACCAGGATTCCTGTGAAAGCAGGAGCAGCAGCAAGCCGTCCCGGGCCTGCCTTT
2561 CCCATCCTTTGGTTCTCCTTTCCAGTCTGGGTTCACACCCTGAAAAGGGATGGGTGTGTCCTCTGAGCACTCTGGCATTT
2641 GTCATTGCTGAGCCCATATCAGTAGGTCCTGGGACTTGACAAAGTATGTGGGAGGGGAAGGAAGGACAGAACTTGACTGG
2721 CTCCATTTCATGGACCAACTGATCAATTGCCAGTACTAAGCCACTCATTGTTATGGCTTCCTTTTTGAAAACCACCTGTC
2801 TCAAGGATTCAGGTTTCTGCTCACATCCCCAGCTGATGCTCAATAAAACTCAGCCAGGAGCATATGGAGATGCTGACAGC
2881 CAGGTAATGGGTGAGACTGTGGGGTCCCTTTTCCTCTAAAGCCTTTACTCTGAGGATAAGGTCACAAAGTAGGGTGTGAC
2961 TTGAAAGTATCGTGACCATGTGGCCCACCAGCAGCCTTTCCAAAGGGGAACTCCAGAGACATTTCATAATGCAAACAGCA
3041 CTGTTGCTTTAAGAACAAGGCCTTTGGAGGTGGCTAAACTTGCACGCACGTGTGTGAAAAGCCATCCCATCTTCTGCCTC
3121 CAGTTGGAGCTTTCAGCTGTTAAAACAGTCAGAAACTATTGATTCTTCCCTTTAGGAAAAAATGCTCAGGCAGAACGGGG
3201 TACATCCACAGGAGGAATCGGACGAGAGGATGTGACATTCGGTCCAGGAGAGAAAGAGCAGTTTCTGTTAAAGATGTAAC
3281 AAATGGATTTCCAAAGTCTACATGACATTCACTTTTCAAACTTCCCACCAGTTGAATTTCTTTTTTTCCTTAAGAAACAG
3361 GTGATGTCTTGGAAAACAGCTCCTTATGTCTCTCTGTGCATCTCCATTTTCCTAGTCTCTGGAGTCTCAAAAAGAGTGGC
3441 AAAGCACTTTACAGTAGTAACTGAGGAATCAGAGTCTCTGCTTCAGCGATATCTAGTTTGTACAGTTGGGTGATCTTTTG
3521 TAATTCCTAGGAGGTAATGCATTTTTAATGTTTTCTGAAGCTTTGTAAGTGTGAGAGAGGGACAAGAAGTGCAGTTCTGT
3601 TCTGGAATTCCTTATTGCTTTCAACGGACACTCTTTGTGAAAAATCCAAGTAATATTTTAGTTCAAACTTGATCTTGAGC
3681 CAAGGCCCACTGCCACCTCTGGGATGGGAGTCGGACCTACATACCAAGTGACAAGTTCACCTTAACATCTGCTTCCAGAA
3761 TGGCTTTGATTCAGCCGTGCCAGGCAACAGAACAGGGTCAGACTCCTGCTCTGTTATTGGCTTGAAGACTAGGATCCCAA
3841 AGGGGTTGGAGGCAGGGAATATTTGAAAATTCAGACTGGAATTCCAGGCCAAAAGCTCAAGACCACCAGCCTCTCCTCCT
3921 GCCTGGAAAAATAAGCCTTTGTGAAAGACTGATTTACCATGTACAATTGTGATTGTGAACGTTGTTGAGTAAACCTCCAG
4001 ACTTTCTCTAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |:::| |  |||||||||| 
Target 5' tcAGTGCAA--GTCACACTCCa 3'
2257 - 2276 160.00 -19.80
2
miRNA  3' guuugugguaacagUGUGAGGu 5'
                        ||||||| 
Target 5' ggagggagggacaaACACTCCc 3'
1685 - 1706 140.00 -10.20
3
miRNA  3' guuuGUGGUAAC----AGUGUGAGGu 5'
              ||  | ||    |||||:||| 
Target 5' gattCAGAAATGGAAATCACATTCCa 3'
1484 - 1509 136.00 -15.29
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30183388 7 COSMIC
COSN508377 33 COSMIC
COSN31482101 58 COSMIC
COSN30149924 90 COSMIC
COSN28092575 115 COSMIC
COSN9412928 124 COSMIC
COSN14790975 518 COSMIC
COSN8623652 901 COSMIC
COSN2078352 951 COSMIC
COSN5070999 1143 COSMIC
COSN8382059 1213 COSMIC
COSN14793528 1349 COSMIC
COSN9412929 1742 COSMIC
COSN14736429 1837 COSMIC
COSN31571146 2085 COSMIC
COSN8205809 2326 COSMIC
COSN32064123 2339 COSMIC
COSN20091290 2566 COSMIC
COSN14787980 2634 COSMIC
COSN21640590 2652 COSMIC
COSN21640591 2657 COSMIC
COSN19244623 2712 COSMIC
COSN4844624 2919 COSMIC
COSN21573750 2973 COSMIC
COSN16636716 3057 COSMIC
COSN15660605 3135 COSMIC
COSN6868804 3496 COSMIC
COSN197516 3636 COSMIC
COSN14748641 3982 COSMIC
rs7244 3982 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs373825540 5 dbSNP
rs1450165338 7 dbSNP
rs755987653 11 dbSNP
rs778377924 12 dbSNP
rs749805249 13 dbSNP
rs779313180 18 dbSNP
rs543441325 19 dbSNP
rs753573173 23 dbSNP
rs779831681 23 dbSNP
rs746161155 24 dbSNP
rs775525831 25 dbSNP
rs572695147 28 dbSNP
rs34754330 30 dbSNP
rs768657337 31 dbSNP
rs1403380737 32 dbSNP
rs776752047 34 dbSNP
rs763044116 37 dbSNP
rs544806581 38 dbSNP
rs375900060 46 dbSNP
rs774293410 48 dbSNP
rs182092077 51 dbSNP
rs544566295 58 dbSNP
rs1255901426 59 dbSNP
rs1210581944 62 dbSNP
rs925679091 73 dbSNP
rs1464125092 76 dbSNP
rs900733562 85 dbSNP
rs996361583 92 dbSNP
rs1049196464 106 dbSNP
rs561112016 121 dbSNP
rs1353772836 129 dbSNP
rs1312450378 130 dbSNP
rs115418821 140 dbSNP
rs1005005498 144 dbSNP
rs1287064254 147 dbSNP
rs1452954000 150 dbSNP
rs1015412587 155 dbSNP
rs971399931 161 dbSNP
rs1474046868 164 dbSNP
rs1416740364 170 dbSNP
rs1181222006 174 dbSNP
rs1429484129 181 dbSNP
rs1002811004 182 dbSNP
rs1406090062 185 dbSNP
rs1203952162 187 dbSNP
rs34338065 188 dbSNP
rs1034918001 189 dbSNP
rs185759146 196 dbSNP
rs916931823 209 dbSNP
rs915119433 210 dbSNP
rs560571655 212 dbSNP
rs532714917 220 dbSNP
rs1228357762 224 dbSNP
rs919072460 228 dbSNP
rs1328043467 229 dbSNP
rs1293175649 231 dbSNP
rs930489143 235 dbSNP
rs1048938629 237 dbSNP
rs1395104429 242 dbSNP
rs889180474 252 dbSNP
rs1419349715 254 dbSNP
rs552821970 257 dbSNP
rs747294097 258 dbSNP
rs1463185829 270 dbSNP
rs1040742242 292 dbSNP
rs1375208718 292 dbSNP
rs944374292 303 dbSNP
rs1362846794 314 dbSNP
rs1446265753 317 dbSNP
rs1284198314 321 dbSNP
rs1195977870 335 dbSNP
rs901883473 336 dbSNP
rs1040035869 342 dbSNP
rs888979 344 dbSNP
rs1021191250 350 dbSNP
rs1196673837 353 dbSNP
rs6895758 356 dbSNP
rs1000967440 357 dbSNP
rs755405245 358 dbSNP
rs1371405189 365 dbSNP
rs1305537014 369 dbSNP
rs1049772736 376 dbSNP
rs1369680881 385 dbSNP
rs746369133 389 dbSNP
rs887983681 390 dbSNP
rs940839498 398 dbSNP
rs1036472192 413 dbSNP
rs907273204 422 dbSNP
rs1176141459 425 dbSNP
rs1453109956 431 dbSNP
rs1002842113 435 dbSNP
rs1182587210 437 dbSNP
rs1034278369 440 dbSNP
rs1195380271 443 dbSNP
rs190960147 448 dbSNP
rs1282184263 450 dbSNP
rs958668884 463 dbSNP
rs1347021106 473 dbSNP
rs567140385 483 dbSNP
rs1279680179 491 dbSNP
rs991286805 492 dbSNP
rs916896849 499 dbSNP
rs971107753 506 dbSNP
rs972376001 507 dbSNP
rs769357496 508 dbSNP
rs754560352 509 dbSNP
rs763021374 513 dbSNP
rs967931311 514 dbSNP
rs978308104 517 dbSNP
rs3776996 518 dbSNP
rs965754106 521 dbSNP
rs975750239 522 dbSNP
rs1473722330 523 dbSNP
rs1176646654 539 dbSNP
rs1378574920 540 dbSNP
rs1208436337 546 dbSNP
rs1048886898 550 dbSNP
rs1284875848 552 dbSNP
rs1225335809 555 dbSNP
rs910393729 558 dbSNP
rs1278439823 567 dbSNP
rs985087575 569 dbSNP
rs943446884 570 dbSNP
rs183099425 573 dbSNP
rs3776997 576 dbSNP
rs768251241 577 dbSNP
rs1382973636 582 dbSNP
rs538410606 589 dbSNP
rs1360062860 593 dbSNP
rs1009541887 595 dbSNP
rs1420322065 603 dbSNP
rs774235712 608 dbSNP
rs1472351080 613 dbSNP
rs558350876 616 dbSNP
rs1329826278 621 dbSNP
rs371957386 628 dbSNP
rs1217945613 633 dbSNP
rs186660562 638 dbSNP
rs879156669 639 dbSNP
rs1213790067 654 dbSNP
rs1336238815 655 dbSNP
rs1291067027 656 dbSNP
rs3836868 658 dbSNP
rs397814355 658 dbSNP
rs894505625 658 dbSNP
rs544171412 659 dbSNP
rs1011973758 663 dbSNP
rs761556307 669 dbSNP
rs1462060542 679 dbSNP
rs1396712754 690 dbSNP
rs903743112 691 dbSNP
rs191203253 693 dbSNP
rs1279090905 697 dbSNP
rs1030802436 702 dbSNP
rs1188021230 709 dbSNP
rs1474274542 711 dbSNP
rs1443887345 717 dbSNP
rs1194106524 726 dbSNP
rs1013061860 728 dbSNP
rs1196675165 732 dbSNP
rs1469433758 734 dbSNP
rs1024085167 738 dbSNP
rs138757159 740 dbSNP
rs1028731820 742 dbSNP
rs7710430 746 dbSNP
rs560539069 747 dbSNP
rs1340431983 749 dbSNP
rs984839099 749 dbSNP
rs1477176235 752 dbSNP
rs1172173558 761 dbSNP
rs3822711 764 dbSNP
rs1323935505 773 dbSNP
rs940904774 780 dbSNP
rs1355357406 786 dbSNP
rs1172747317 796 dbSNP
rs1471127925 809 dbSNP
rs1169235962 810 dbSNP
rs376580130 816 dbSNP
rs984738729 820 dbSNP
rs1250644334 831 dbSNP
rs910359641 834 dbSNP
rs760687201 835 dbSNP
rs976334173 849 dbSNP
rs1201922439 857 dbSNP
rs563055483 861 dbSNP
rs915957753 865 dbSNP
rs1235718933 866 dbSNP
rs531972169 869 dbSNP
rs1299752842 874 dbSNP
rs947425582 878 dbSNP
rs1374059784 883 dbSNP
rs1043418822 894 dbSNP
rs1275005677 932 dbSNP
rs923358039 933 dbSNP
rs182527619 936 dbSNP
rs568736890 943 dbSNP
rs1436560708 949 dbSNP
rs868377024 962 dbSNP
rs1042337021 967 dbSNP
rs1052341942 976 dbSNP
rs114758227 978 dbSNP
rs936921103 982 dbSNP
rs997330069 985 dbSNP
rs1200407540 992 dbSNP
rs1055325714 996 dbSNP
rs1252793444 1006 dbSNP
rs1482506045 1007 dbSNP
rs1251608433 1008 dbSNP
rs1163718200 1009 dbSNP
rs1486834167 1010 dbSNP
rs1449870919 1024 dbSNP
rs1209955664 1026 dbSNP
rs765414443 1045 dbSNP
rs895288803 1055 dbSNP
rs78352901 1061 dbSNP
rs1025581884 1067 dbSNP
rs142764832 1069 dbSNP
rs530892645 1077 dbSNP
rs747095254 1080 dbSNP
rs1399712801 1083 dbSNP
rs1191914573 1085 dbSNP
rs961730360 1094 dbSNP
rs972319349 1096 dbSNP
rs1156283722 1105 dbSNP
rs866398593 1107 dbSNP
rs928872710 1109 dbSNP
rs1466621079 1139 dbSNP
rs1418157575 1158 dbSNP
rs1170103850 1164 dbSNP
rs558272953 1182 dbSNP
rs1476396347 1188 dbSNP
rs769663844 1191 dbSNP
rs960216047 1203 dbSNP
rs1025977019 1208 dbSNP
rs1323867920 1208 dbSNP
rs951717090 1211 dbSNP
rs1397967769 1218 dbSNP
rs1328527372 1219 dbSNP
rs116156592 1228 dbSNP
rs1340855606 1236 dbSNP
rs1338544126 1238 dbSNP
rs1043145313 1242 dbSNP
rs924638387 1248 dbSNP
rs934635231 1249 dbSNP
rs1318413235 1251 dbSNP
rs567473784 1251 dbSNP
rs1456250950 1261 dbSNP
rs1263547141 1264 dbSNP
rs1017491948 1268 dbSNP
rs1456063252 1269 dbSNP
rs1187257082 1280 dbSNP
rs1429436496 1282 dbSNP
rs901735728 1284 dbSNP
rs1187154328 1286 dbSNP
rs997363308 1288 dbSNP
rs1050650590 1304 dbSNP
rs965005391 1306 dbSNP
rs3776998 1307 dbSNP
rs1490895610 1315 dbSNP
rs1016003170 1318 dbSNP
rs1265032226 1321 dbSNP
rs1227923761 1324 dbSNP
rs1308965645 1328 dbSNP
rs923107788 1332 dbSNP
rs1063283 1334 dbSNP
rs1262955394 1346 dbSNP
rs764261508 1347 dbSNP
rs3172941 1349 dbSNP
rs116652903 1352 dbSNP
rs960249661 1353 dbSNP
rs1168098448 1354 dbSNP
rs1367220913 1355 dbSNP
rs540606830 1363 dbSNP
rs1055546636 1365 dbSNP
rs895374436 1366 dbSNP
rs991623268 1370 dbSNP
rs916105034 1373 dbSNP
rs1472203149 1374 dbSNP
rs968908336 1375 dbSNP
rs1449390964 1383 dbSNP
rs1163312921 1385 dbSNP
rs1395821007 1420 dbSNP
rs1366846607 1421 dbSNP
rs1417520417 1424 dbSNP
rs1297126897 1428 dbSNP
rs144203787 1457 dbSNP
rs1383694344 1464 dbSNP
rs115064374 1471 dbSNP
rs148747376 1472 dbSNP
rs897348386 1477 dbSNP
rs1339771349 1480 dbSNP
rs1227630029 1502 dbSNP
rs546308852 1504 dbSNP
rs1348483386 1511 dbSNP
rs141452682 1515 dbSNP
rs1315847500 1517 dbSNP
rs1361629018 1521 dbSNP
rs60732724 1525 dbSNP
rs1372866772 1538 dbSNP
rs1306535484 1540 dbSNP
rs1429457261 1544 dbSNP
rs976718654 1562 dbSNP
rs114544470 1564 dbSNP
rs887540361 1567 dbSNP
rs781612245 1578 dbSNP
rs1005867255 1580 dbSNP
rs1050361889 1586 dbSNP
rs1249414945 1589 dbSNP
rs542418638 1596 dbSNP
rs1485855804 1608 dbSNP
rs1282394040 1609 dbSNP
rs1254751138 1616 dbSNP
rs1198604430 1628 dbSNP
rs750931175 1636 dbSNP
rs756552346 1637 dbSNP
rs1017691715 1640 dbSNP
rs373778569 1644 dbSNP
rs1386567210 1645 dbSNP
rs1287275810 1663 dbSNP
rs768461537 1675 dbSNP
rs1409604747 1677 dbSNP
rs941857026 1682 dbSNP
rs1336779090 1689 dbSNP
rs997877945 1691 dbSNP
rs1157738674 1700 dbSNP
rs1413258360 1708 dbSNP
rs1030163568 1709 dbSNP
rs1159200029 1711 dbSNP
rs1458845156 1717 dbSNP
rs779559990 1723 dbSNP
rs1181650087 1726 dbSNP
rs188388607 1727 dbSNP
rs1238974808 1732 dbSNP
rs1185419139 1739 dbSNP
rs547711564 1742 dbSNP
rs192637093 1743 dbSNP
rs1401173685 1758 dbSNP
rs1210086048 1759 dbSNP
rs1326372722 1763 dbSNP
rs74736763 1769 dbSNP
rs1233505666 1783 dbSNP
rs1035282453 1788 dbSNP
rs1286287814 1790 dbSNP
rs895484798 1791 dbSNP
rs748759125 1807 dbSNP
rs1319514726 1808 dbSNP
rs990796048 1811 dbSNP
rs969313751 1812 dbSNP
rs1317724940 1824 dbSNP
rs1462159112 1826 dbSNP
rs115709796 1831 dbSNP
rs184615778 1832 dbSNP
rs949652376 1835 dbSNP
rs10796 1837 dbSNP
rs1204880173 1844 dbSNP
rs1190369134 1849 dbSNP
rs1463205759 1857 dbSNP
rs918745939 1864 dbSNP
rs1245496605 1866 dbSNP
rs1213970058 1867 dbSNP
rs930101238 1868 dbSNP
rs1048613381 1871 dbSNP
rs1287239828 1883 dbSNP
rs887486439 1884 dbSNP
rs150847499 1890 dbSNP
rs922635468 1891 dbSNP
rs1356013545 1896 dbSNP
rs1177436346 1905 dbSNP
rs767144964 1906 dbSNP
rs1038690841 1912 dbSNP
rs1319938900 1912 dbSNP
rs1351867110 1912 dbSNP
rs1420523287 1918 dbSNP
rs749951267 1922 dbSNP
rs1404565428 1923 dbSNP
rs1419947615 1924 dbSNP
rs1170479528 1925 dbSNP
rs1447544033 1930 dbSNP
rs1389064659 1932 dbSNP
rs986477155 1932 dbSNP
rs1489154285 1935 dbSNP
rs900207358 1940 dbSNP
rs568191777 1952 dbSNP
rs534067325 1959 dbSNP
rs1275793603 1961 dbSNP
rs775167703 1964 dbSNP
rs1340633946 1976 dbSNP
rs1297454028 1977 dbSNP
rs762849431 1993 dbSNP
rs865917507 1994 dbSNP
rs1330796289 1996 dbSNP
rs140128775 1997 dbSNP
rs1032137139 2004 dbSNP
rs1299397853 2005 dbSNP
rs145554789 2005 dbSNP
rs897583818 2009 dbSNP
rs755716635 2010 dbSNP
rs187398816 2011 dbSNP
rs539842298 2034 dbSNP
rs916583236 2035 dbSNP
rs1265585886 2040 dbSNP
rs1056802459 2042 dbSNP
rs1198515469 2049 dbSNP
rs1251414510 2050 dbSNP
rs1470291125 2057 dbSNP
rs895517232 2060 dbSNP
rs1265634237 2072 dbSNP
rs1189108907 2073 dbSNP
rs1266209625 2077 dbSNP
rs1482238770 2081 dbSNP
rs1480677413 2083 dbSNP
rs1274568862 2091 dbSNP
rs1201274082 2096 dbSNP
rs1012564254 2098 dbSNP
rs1299238756 2103 dbSNP
rs971159115 2105 dbSNP
rs1421148765 2109 dbSNP
rs1351359487 2110 dbSNP
rs982148781 2118 dbSNP
rs73804459 2120 dbSNP
rs930215639 2121 dbSNP
rs1463578502 2126 dbSNP
rs771829708 2128 dbSNP
rs1292072939 2130 dbSNP
rs1356971840 2133 dbSNP
rs1048560390 2146 dbSNP
rs1405989229 2149 dbSNP
rs1285605889 2153 dbSNP
rs576495571 2155 dbSNP
rs1218567584 2158 dbSNP
rs956188598 2165 dbSNP
rs1251538553 2166 dbSNP
rs1296849942 2169 dbSNP
rs1182992452 2170 dbSNP
rs976868237 2171 dbSNP
rs1029734813 2173 dbSNP
rs542030260 2175 dbSNP
rs1264530766 2176 dbSNP
rs1270268711 2187 dbSNP
rs1226785193 2195 dbSNP
rs1039220448 2204 dbSNP
rs772993883 2210 dbSNP
rs1490404472 2233 dbSNP
rs1313122580 2234 dbSNP
rs1224204973 2255 dbSNP
rs1376916245 2260 dbSNP
rs1302155489 2285 dbSNP
rs192544475 2290 dbSNP
rs1260775260 2297 dbSNP
rs1390185260 2297 dbSNP
rs985451091 2298 dbSNP
rs1456350981 2305 dbSNP
rs1411746483 2308 dbSNP
rs572339180 2309 dbSNP
rs1425880150 2310 dbSNP
rs910468873 2311 dbSNP
rs1181732796 2327 dbSNP
rs541323372 2331 dbSNP
rs932950177 2333 dbSNP
rs1051394869 2334 dbSNP
rs902396950 2337 dbSNP
rs1328726783 2339 dbSNP
rs1266212291 2346 dbSNP
rs1449631464 2347 dbSNP
rs999405580 2356 dbSNP
rs185106056 2358 dbSNP
rs531940874 2359 dbSNP
rs929131334 2367 dbSNP
rs1366788854 2369 dbSNP
rs1317931389 2370 dbSNP
rs760704086 2385 dbSNP
rs868831709 2386 dbSNP
rs1024111885 2388 dbSNP
rs551772057 2390 dbSNP
rs948402613 2394 dbSNP
rs1044031748 2398 dbSNP
rs1450608113 2402 dbSNP
rs1392157063 2403 dbSNP
rs562418271 2405 dbSNP
rs368679697 2411 dbSNP
rs770945607 2411 dbSNP
rs1305115766 2412 dbSNP
rs1211844256 2415 dbSNP
rs1252490532 2418 dbSNP
rs891997171 2419 dbSNP
rs1264604828 2426 dbSNP
rs776676330 2431 dbSNP
rs982483127 2433 dbSNP
rs1295255177 2441 dbSNP
rs1227031093 2444 dbSNP
rs1025659522 2447 dbSNP
rs1007305785 2448 dbSNP
rs1384714443 2449 dbSNP
rs1389079547 2450 dbSNP
rs951603530 2468 dbSNP
rs963026715 2471 dbSNP
rs749858294 2487 dbSNP
rs1167189505 2489 dbSNP
rs984413769 2490 dbSNP
rs910035029 2495 dbSNP
rs190351258 2497 dbSNP
rs950569333 2502 dbSNP
rs548016655 2504 dbSNP
rs181031197 2510 dbSNP
rs921650728 2513 dbSNP
rs1272405311 2514 dbSNP
rs1204330382 2515 dbSNP
rs1271349732 2517 dbSNP
rs1257215934 2521 dbSNP
rs933086325 2527 dbSNP
rs1364657043 2530 dbSNP
rs1051336132 2544 dbSNP
rs147326733 2545 dbSNP
rs1352657798 2549 dbSNP
rs1403059002 2550 dbSNP
rs763172995 2550 dbSNP
rs1053653294 2551 dbSNP
rs1044534591 2564 dbSNP
rs1311431134 2568 dbSNP
rs925673983 2588 dbSNP
rs1428865082 2593 dbSNP
rs893626756 2594 dbSNP
rs1359455698 2597 dbSNP
rs1473482797 2598 dbSNP
rs750883563 2599 dbSNP
rs1053384764 2605 dbSNP
rs1023471266 2607 dbSNP
rs1487878422 2611 dbSNP
rs1216203233 2619 dbSNP
rs1243826802 2620 dbSNP
rs906578227 2624 dbSNP
rs764220020 2632 dbSNP
rs796581488 2633 dbSNP
rs2277937 2634 dbSNP
rs140982756 2635 dbSNP
rs1331703299 2654 dbSNP
rs1384689984 2657 dbSNP
rs1051225937 2663 dbSNP
rs762025530 2664 dbSNP
rs889950602 2677 dbSNP
rs1394377165 2681 dbSNP
rs1405421765 2691 dbSNP
rs1160265419 2698 dbSNP
rs984361576 2700 dbSNP
rs1458991125 2707 dbSNP
rs184228584 2713 dbSNP
rs1007010843 2715 dbSNP
rs1472980974 2732 dbSNP
rs556541864 2736 dbSNP
rs149670918 2742 dbSNP
rs868102838 2748 dbSNP
rs535927662 2750 dbSNP
rs1210259813 2751 dbSNP
rs1409761506 2763 dbSNP
rs987220043 2768 dbSNP
rs1347265883 2775 dbSNP
rs994103548 2781 dbSNP
rs73804460 2788 dbSNP
rs923589635 2794 dbSNP
rs1357425155 2805 dbSNP
rs1286523769 2808 dbSNP
rs1243246489 2821 dbSNP
rs1382180657 2822 dbSNP
rs1302722319 2827 dbSNP
rs1382963787 2828 dbSNP
rs935026741 2829 dbSNP
rs779970930 2830 dbSNP
rs1453397756 2833 dbSNP
rs1386768614 2836 dbSNP
rs1053403784 2837 dbSNP
rs555627804 2840 dbSNP
rs915103685 2844 dbSNP
rs948006339 2848 dbSNP
rs1415684439 2852 dbSNP
rs992621986 2861 dbSNP
rs1045294324 2863 dbSNP
rs1189971819 2866 dbSNP
rs906407802 2868 dbSNP
rs1286121121 2870 dbSNP
rs1393385892 2872 dbSNP
rs1241171233 2881 dbSNP
rs1221829031 2884 dbSNP
rs1452614590 2889 dbSNP
rs1292430306 2890 dbSNP
rs7721429 2891 dbSNP
rs1359383473 2895 dbSNP
rs541237646 2898 dbSNP
rs1363055652 2899 dbSNP
rs1047209118 2901 dbSNP
rs1437453821 2901 dbSNP
rs557996999 2907 dbSNP
rs1351451763 2914 dbSNP
rs1321364578 2923 dbSNP
rs1423714640 2927 dbSNP
rs1302878769 2942 dbSNP
rs935666574 2946 dbSNP
rs1243662999 2948 dbSNP
rs1447195792 2965 dbSNP
rs988441526 2968 dbSNP
rs778175010 2972 dbSNP
rs1461879585 2973 dbSNP
rs887205756 2981 dbSNP
rs1244573917 2986 dbSNP
rs577941037 2995 dbSNP
rs189943561 2997 dbSNP
rs181083404 3017 dbSNP
rs964609652 3021 dbSNP
rs1469834906 3031 dbSNP
rs1159300444 3045 dbSNP
rs1219834325 3062 dbSNP
rs1370037890 3067 dbSNP
rs997140668 3083 dbSNP
rs1404120144 3084 dbSNP
rs1350871631 3086 dbSNP
rs1030240112 3087 dbSNP
rs955589381 3090 dbSNP
rs987167958 3091 dbSNP
rs1415646794 3102 dbSNP
rs145446540 3108 dbSNP
rs1175194986 3123 dbSNP
rs1480349221 3124 dbSNP
rs1176426740 3129 dbSNP
rs994134588 3136 dbSNP
rs1479955247 3143 dbSNP
rs1232766900 3146 dbSNP
rs1454164126 3155 dbSNP
rs1210911416 3157 dbSNP
rs374278144 3161 dbSNP
rs1328716518 3162 dbSNP
rs1285989067 3176 dbSNP
rs1313961992 3188 dbSNP
rs1261564294 3197 dbSNP
rs956458847 3198 dbSNP
rs989072155 3220 dbSNP
rs541902844 3224 dbSNP
rs914948074 3225 dbSNP
rs1365299052 3226 dbSNP
rs1403255014 3228 dbSNP
rs879134004 3232 dbSNP
rs1025559374 3235 dbSNP
rs947963584 3241 dbSNP
rs1413227277 3242 dbSNP
rs1045015066 3246 dbSNP
rs1407904365 3252 dbSNP
rs1182932283 3255 dbSNP
rs1484315515 3259 dbSNP
rs1263718081 3263 dbSNP
rs1203327197 3264 dbSNP
rs1325560083 3287 dbSNP
rs1465531091 3290 dbSNP
rs1270206389 3298 dbSNP
rs561766431 3302 dbSNP
rs747521820 3303 dbSNP
rs1196622416 3307 dbSNP
rs1014159517 3314 dbSNP
rs527440447 3321 dbSNP
rs1335470231 3325 dbSNP
rs1435134571 3330 dbSNP
rs1390387884 3333 dbSNP
rs1286694245 3337 dbSNP
rs547626415 3356 dbSNP
rs1452151722 3362 dbSNP
rs1437259886 3367 dbSNP
rs750735143 3368 dbSNP
rs1182877875 3397 dbSNP
rs1166159987 3406 dbSNP
rs927775711 3407 dbSNP
rs1426048676 3437 dbSNP
rs939141650 3441 dbSNP
rs1450094898 3456 dbSNP
rs1046951808 3460 dbSNP
rs1477270373 3463 dbSNP
rs1485462015 3464 dbSNP
rs148817691 3471 dbSNP
rs756648239 3475 dbSNP
rs1005646591 3479 dbSNP
rs533241182 3482 dbSNP
rs115595825 3488 dbSNP
rs1223743763 3492 dbSNP
rs1032771060 3493 dbSNP
rs957071389 3494 dbSNP
rs988557646 3496 dbSNP
rs1366721440 3505 dbSNP
rs1293076833 3506 dbSNP
rs1381274889 3507 dbSNP
rs912937882 3512 dbSNP
rs899868873 3514 dbSNP
rs563661425 3515 dbSNP
rs997487297 3521 dbSNP
rs1364258644 3525 dbSNP
rs6867638 3536 dbSNP
rs1163443007 3547 dbSNP
rs6886795 3551 dbSNP
rs1374861959 3561 dbSNP
rs1169085305 3566 dbSNP
rs955634216 3566 dbSNP
rs754324903 3568 dbSNP
rs1395157767 3584 dbSNP
rs1031809121 3590 dbSNP
rs1038908160 3601 dbSNP
rs1291015710 3605 dbSNP
rs754508090 3611 dbSNP
rs1343728457 3615 dbSNP
rs956449440 3616 dbSNP
rs930098549 3626 dbSNP
rs142581287 3627 dbSNP
rs1283710294 3629 dbSNP
rs1344011150 3632 dbSNP
rs867063693 3633 dbSNP
rs1216738644 3634 dbSNP
rs1398795324 3652 dbSNP
rs1166255090 3653 dbSNP
rs867410161 3658 dbSNP
rs1245127525 3660 dbSNP
rs1461513060 3669 dbSNP
rs7243 3670 dbSNP
rs56966075 3675 dbSNP
rs1178832162 3678 dbSNP
rs1338899859 3692 dbSNP
rs1267876491 3697 dbSNP
rs1024243998 3704 dbSNP
rs905742649 3711 dbSNP
rs1450111885 3713 dbSNP
rs747761522 3714 dbSNP
rs1257453145 3715 dbSNP
rs1270058739 3719 dbSNP
rs939249912 3721 dbSNP
rs1229344545 3723 dbSNP
rs982576644 3742 dbSNP
rs908407614 3746 dbSNP
rs941421275 3768 dbSNP
rs1001378525 3777 dbSNP
rs17116139 3778 dbSNP
rs1338986835 3779 dbSNP
rs777735242 3781 dbSNP
rs1468410578 3782 dbSNP
rs899817936 3785 dbSNP
rs15197 3789 dbSNP
rs932639502 3791 dbSNP
rs1387888833 3803 dbSNP
rs1362007779 3805 dbSNP
rs1051551515 3806 dbSNP
rs1180985318 3812 dbSNP
rs1442562706 3814 dbSNP
rs747098061 3821 dbSNP
rs1004931027 3825 dbSNP
rs1010020539 3839 dbSNP
rs1221495952 3841 dbSNP
rs1229404391 3844 dbSNP
rs891344058 3846 dbSNP
rs1018860904 3847 dbSNP
rs999097242 3850 dbSNP
rs1423639037 3851 dbSNP
rs1031799332 3863 dbSNP
rs1238919363 3867 dbSNP
rs1341192967 3873 dbSNP
rs893329829 3880 dbSNP
rs376919764 3887 dbSNP
rs1450486152 3896 dbSNP
rs1405628887 3899 dbSNP
rs966035101 3906 dbSNP
rs1321398018 3907 dbSNP
rs1402290098 3913 dbSNP
rs577852622 3914 dbSNP
rs770825317 3926 dbSNP
rs955045407 3938 dbSNP
rs1367281929 3939 dbSNP
rs1157969031 3941 dbSNP
rs15198 3951 dbSNP
rs1397908494 3953 dbSNP
rs1022018597 3957 dbSNP
rs969564100 3958 dbSNP
rs1326930090 3961 dbSNP
rs1229462034 3962 dbSNP
rs1248277353 3968 dbSNP
rs1217487387 3970 dbSNP
rs980426999 3979 dbSNP
rs1034689580 3981 dbSNP
rs879286145 3981 dbSNP
rs7244 3982 dbSNP
rs1360828441 3988 dbSNP
rs920125829 4003 dbSNP
rs982735005 4004 dbSNP
rs1298698113 4007 dbSNP
rs185911088 4011 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... Verification of miR-122 target genes using 3'UTR reporter assay is shown in Supporting Table 4. ...

- Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al., 2009, Hepatology (Baltimore, Md.).

Article - Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al.
- Hepatology (Baltimore, Md.), 2009
UNLABELLED: MicroRNAs (miRNAs), which are inhibitors of gene expression, participate in diverse biological functions and in carcinogenesis. In this study, we show that liver-specific microRNA-122 (miR-122) is significantly down-regulated in liver cancers with intrahepatic metastasis and negatively regulates tumorigenesis. Restoration of miR-122 in metastatic Mahlavu and SK-HEP-1 cells significantly reduced in vitro migration, invasion, and anchorage-independent growth as well as in vivo tumorigenesis, angiogenesis, and intrahepatic metastasis in an orthotopic liver cancer model. Because an inverse expression pattern is often present between an miRNA and its target genes, we used a computational approach and identified multiple miR-122 candidate target genes from two independent expression microarray datasets. Thirty-two target genes were empirically verified, and this group of genes was enriched with genes regulating cell movement, cell morphology, cell-cell signaling, and transcription. We further showed that one of the miR-122 targets, ADAM17 (a disintegrin and metalloprotease 17) is involved in metastasis. Silencing of ADAM17 resulted in a dramatic reduction of in vitro migration, invasion, in vivo tumorigenesis, angiogenesis, and local invasion in the livers of nude mice, which is similar to that which occurs with the restoration of miR-122. CONCLUSION: Our study suggests that miR-122, a tumor suppressor microRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, exerts some of its action via regulation of ADAM17. Restoration of miR-122 has a far-reaching effect on the cell. Using the concomitant down-regulation of its targets, including ADAM17, a rational therapeutic strategy based on miR-122 may prove to be beneficial for patients with hepatocellular carcinoma.
LinkOut: [PMID: 19296470]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hep3B , PLC/PRF/5 , HepG2 , Huh7 , SK-Hep1 , BEL-7402 , BEL-7404
Disease Hepatitis B Virus-associated Hepatocellular Carcinoma
Location of target site 3'UTR
Tools used in this research TargetScan , DIANA , miRanda
Original Description (Extracted from the article) ... Analysis of the 3-UTR of galnt10 revealed one highly conserved miR-122-binding site (Fig. 2B). Treatment with the miR-122 mimic significantly reduced the activity of firefly luciferase with the wild type but not the miR-122-binding site mutant 3-UTR of galnt10, although the anti-miR-122 increased the luciferase activity but not mutant 3-UTR (Fig. 2C). Both gain-of-function and lossof- function analyses verified a suppressive effect of miR-122 on the expression of endogenous GALNT10. HepG2 and SK-Hep1 cells were chosen for enforcing the expression of miR-122, because the cell lines exhibit lower levels of miR-122. Conversely, miR-122 silencing was performed in Huh7 and BEL- 7404 cells because the cell lines exhibit miR-122 constitutive expression. miR-122 mimic-transfected HepG2 and SK-Hep1 cells decreased the mRNA and protein levels of GALNT10, whereas the depletion of endogenous miR-122 in Huh7 and BEL-7404 cells by its inhibitor led to an increase of GALNT10 level (Fig. 2, D and E). ...

- Wu Q; Liu HO; Liu YD; Liu WS; Pan D; Zhang et al., 2015, The Journal of biological chemistry.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugugguaacaGUGUGAGGu 5'
                       |||||||| 
Target 5' -------------CACACUCC- 3'
1 - 8
Article - Wu Q; Liu HO; Liu YD; Liu WS; Pan D; Zhang et al.
- The Journal of biological chemistry, 2015
MicroRNA-122 (miR-122), a mammalian liver-specific miRNA, has been reported to play crucial roles in the control of diverse aspects of hepatic function and dysfunction, including viral infection and hepatocarcinogenesis. In this study, we explored the clinical significance, transcriptional regulation, and direct target of miR-122 in hepatitis B virus (HBV)-associated hepatocellular carcinoma. Reduced expression of miR-122 in patients with HBV-associated hepatocellular carcinoma was correlated with venous invasion and poor prognosis. Furthermore, UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-10 (GALNT10) was identified as a bona fide target of miR-122 in hepatoma cells. Ectopic expression and knockdown studies showed that GALNT10 indeed promotes proliferation and apoptosis resistance of hepatoma cells in a glycosyltransferase-dependent manner. Critically, adverse correlation between miR-122 and GALNT10, a poor prognosticator of clinical outcome, was demonstrated in hepatoma patients. Hepatocyte nuclear factor 4alpha (Hnf4alpha), a liver-enriched transcription factor that activates miR-122 gene transcription, was suppressed in HBV-infected hepatoma cells. Chromatin immunoprecipitation assay showed significantly reduced association of Hnf4alpha with the miR-122 promoter in HBV-infected hepatoma cells. Moreover, GALNT10 was found to intensify O-glycosylation following signal activation of the epidermal growth factor receptor. In addition, in a therapeutic perspective, we proved that GALNT10 silencing increases sensitivity to sorafenib and doxorubicin challenge. In summary, our results reveal a novel Hnf4alpha/miR-122/GALNT10 regulatory pathway that facilitates EGF miR-122 activation and hepatoma growth in HBV-associated hepatocarcinogenesis.
LinkOut: [PMID: 25422324]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*