miRTarBase - #MIRT003090 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NCAM1   
Synonyms CD56, MSK39, NCAM
Description neural cell adhesion molecule 1
Transcript NM_000615   
Other Transcripts NM_001076682 , NM_181351   
Expression
Putative miRNA Targets on NCAM1
3'UTR of NCAM1
(miRNA target sites are highlighted)
>NCAM1|NM_000615|3'UTR
   1 TGGGTGAAGAGAACCGAGCAAAGATCAAAATAAAAAGTGACACAGCAGCTTCACCAGAGCATTTCCAACACCACAGACAC
  81 ACACACGCACGCACACACACAAACACACATGCACACACACACATCTCATTTCTCTAGTGTCTTTTGCCTTTAAAAAAAAC
 161 TAAACAGATAAAACATGGGAATCTCCTTTTTGTAGGTTTATAGAAAGGGTCCCTTTGTTGCACACTCACTTGTAAGAAAA
 241 TGAGACAAAAAGGTTAAACCCACAGCCAAACTAGGACACTCCGTTCCCTGAAACCGTTAAAAAATCAAACAAAAGGACCC
 321 CAAATTAAGAATCTAGGAAGCTCAGAAACGAAATCTAGGTTCAGGAAGACCACACTTGGTGTTACCCGATTGGCACAGAC
 401 CAGTTTCAGAGAAATACTTTCAGGCACTAAGACTAATCGAATGAACAAAGTCCACAGTTTATTTTTATACTTTCAGTCAA
 481 GTTTGAACTCTGTAAAACCTCATAAATAAGTTATAATTTCTGTTCACTTTGTATTTGTTCAGTATGCAAAGTGTGTCACC
 561 CTTTCTAGCTGAATTCAATTCCCACGTAGACTCTTATTTTATAGGACGAATGCCAAATTGCAGCTTCTGGGGGTAGATCT
 641 CAATTTGCAGTATTCAGACTTCTTTTTCTTTCTTTTACATTCTTTTTTCTTTCTTTCTTTCTGCCAACTTTGTTTTCCAG
 721 TGTTTACAAGGTGACAAATGTTTGACTTTGGTTGTGTTTAAATGTCCGTGTAAAATAGCTGCCTTTTATTTTTTAAGGTA
 801 ACAAATACCACCTAGAGGTAGGTAGGATCATCCCACGCTTGCTTTAGCACAGGACAACTTTACAAAACATGATTGTTTAC
 881 AGCTGCTCTTCCCCTCTTTTCTGATCTGCAGTTTTTGCCTGGGTCCCACTCAGGTGAAAATCCATCTCATTCTGGAATGG
 961 TTTTGCTTTTGAATTTTTGGTTATTTTTGTGTTTCTTTGGGGGTTAGACCACTTTCTGATTAGCCGCCACCTGCCTGCAT
1041 CTGTGAAAAGGGATCTGCTCCCAGGCGTTCTCACCCTTCTTTTGAAGGACTCCTTAGGCTTTGTTGAATGAAGCAGAGAA
1121 GATTGTATAGTTGGGGCTGGTCTTGGTGAACACACATTATTACCCCACACATCCCCTTTGTGTAGAAAGCCAAATAAAAT
1201 CTATACATACCATTTCCTTTTGAGCCCAGAATCTAGATTTGAGCGGAAGAGCATGTGTGCTTCAGGGAATTAGTGTCTTT
1281 TTTTGGAAATCTGTTGAAGTAAAGTAACATCGGCCTTCTGTTCACTTAGGCAGCATTTATAGAAACAAAAGAAGAAAGAA
1361 ACAACCTACTGTCTGGAGTCATAACACAACTTTCCTGGATTGGAAACCAAGTGGGGGAAAAAATACAGAAACTTTAAGGG
1441 GGATGGGAGGGGGGGGAGAAGGGAAAAGCCAGCCCTTTGTATAGAAATTTTGCTTTTTTTTCCCTCATTCTACTTTAGAA
1521 CTGCAAGCTTGTGCACTGTGGATGCGTGAATATTTTAGTGTGAAACGTGTTTTTGTCATAGTATTGAAATAAAACTTCAA
1601 CATAGTTTGGTTGTGGAAGGTATAGCAGATAGTTCAGAAAAAATATTCAGGAAACAAAAATCACTCAAACGGAATCGAAG
1681 CCTTTTAACAAAGAAAATGAAATACAGATGATGATGATGATGATGAAGATGATGCTAAGTAAACAGAAATCAGTACTCCG
1761 CATGCGCTCCTCTCCTAAGGTACAAAGCAGCAAGAGGTTAGGGTGGCAAGGCTGCCTCTGGGTCCATTCTGTGGGCCACT
1841 CTCCCCAACGTTCTGACACTTCTGCAGTCTGATCAGTGGCGATGCTAGATTATAATTTCAAACTGTGAAGAATAATGGTC
1921 TTGTCATTTGCTCAATGTGGGGTTATGTTGCATTTTCTCAGCTCCTGGGGATGGAAATGGAGGATCCCAGAACACACAGC
2001 CCTGGCCCCTTTGATTCTAGGGCCTGCACAGATCTCTGGTTCAAATGCACAGGCCCTCAGAATAGAGGAACATGAAGAGA
2081 GATCTTAGAGCACACAGTAGAATGTGAGAGCCTGGGTGTCTGAGACCGGGAGGGCCCAGCAGTGAGGGGCAGGCTCTTCT
2161 GGTCACCAGGCTGTTCAGTGGACTCAGTTCTTCATCTTGTAATGTCGATGGCTTTGCCACACCAGGCCAAGCCCATGCCA
2241 TACCTTGTCAAGACTGTCAAAGTGGTTGTGGTTAGGTCAAACTGGTTTTGGTTCTGATGGTTAGGAAGAAACAGGTCAGC
2321 CCTCAGATCACCTGGCCCGGGACAGCTGACCCCCTAGAACCCTGGCTCTGCCATTAGCTAGGACCTAAGACTCTGCCCAC
2401 ATTTTGGTCTGTTCTCTCCCATTACACATAGGTTTGTCTCAGCATGCAAGAGTTTTTCCTTTAAAAAAAAAAAAAAAAAA
2481 AAAAAAAAAGCAATGCTTTCTCTAAAATCAAAGAGGGAGTCATTTTATTCCAAGATGTTTTATCTTTTATGTTAAGAGAT
2561 CAAAGCTTATAATTTTCTTTTTTAATTTTTGAAGGAGGGATCAACTCCAGTTTCCAATGTCTATGTGTCTATGTGTGTAT
2641 GTGCCATACATATGTATTCACATGAAGACCGGCATGGCCAAGTTCTGCTGGAGGAGCACTCAAGTGTGACGAGCAGGGCC
2721 ACTGGACCCTGCAGGGCTGTGGTGTATATAGTGCAGCTTTGGAGGTGGAACTCTATTTTCACACTTTTCTATGGAGCCTT
2801 CCGAGTCCCAGGTTTTCACTTGAGGCTGTCTGTCTGGATGGCGGTTTTCAGACCTCCATTAACATCCCTACCCAGCATTC
2881 TGTACTTCGGGGGCCTTCTCTCTTGTTATAAAACTTTTTACCAAGTGAAACATCGATACCACCTTTGTTTCCATTCTCAC
2961 TGGTGTAAATACTGAGTACTAACTGAGAATTTTGACTTTGCATTCTGTCGGAATACTTGTGTTCAATAAAAATTGAAAGA
3041 AAAAAGCTAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||| |:||| |||||||:: 
Target 5' ggAACTCTATTTTCACACTTTt 3'
2767 - 2788 148.00 -16.70
2
miRNA  3' guuUGU-GGU---AACAGUGUGAGGu 5'
             ||| |||   | |  ||||||| 
Target 5' cccACAGCCAAACTAG-GACACTCCg 3'
259 - 283 146.00 -14.30
3
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              || |:|| | |||||:| 
Target 5' tcccCAACGTTCTGACACTTCt 3'
1842 - 1863 146.00 -11.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN4696373 2 COSMIC
COSN15625422 4 COSMIC
COSN30470660 5 COSMIC
COSN30111953 24 COSMIC
COSN30593259 86 COSMIC
COSN30561967 91 COSMIC
COSN31526671 92 COSMIC
COSN31587160 125 COSMIC
COSN31525096 129 COSMIC
COSN31573713 133 COSMIC
COSN30163672 135 COSMIC
COSN30720322 159 COSMIC
COSN25026698 265 COSMIC
COSN28194389 283 COSMIC
COSN31565909 391 COSMIC
COSN31516032 412 COSMIC
COSN22625291 422 COSMIC
COSN5823436 458 COSMIC
COSN27704867 666 COSMIC
COSN28650429 677 COSMIC
COSN31584503 698 COSMIC
COSN16130346 721 COSMIC
COSN1126714 846 COSMIC
COSN26538013 883 COSMIC
COSN25870241 917 COSMIC
COSN24303751 1075 COSMIC
COSN31550047 1097 COSMIC
COSN14853183 1246 COSMIC
COSN31515537 1282 COSMIC
COSN21209827 1312 COSMIC
COSN31518140 1332 COSMIC
COSN31573037 1388 COSMIC
COSN18826927 1418 COSMIC
COSN20108775 1449 COSMIC
COSN24363308 1449 COSMIC
COSN30172275 1485 COSMIC
COSN16130515 1489 COSMIC
COSN24304108 1503 COSMIC
COSN26066880 1511 COSMIC
COSN31516312 1578 COSMIC
COSN31579830 1672 COSMIC
COSN26838946 1684 COSMIC
COSN31518555 1727 COSMIC
COSN31566808 1747 COSMIC
COSN30166686 1763 COSMIC
COSN30539978 1812 COSMIC
COSN31595864 1881 COSMIC
COSN31557533 2007 COSMIC
COSN31608739 2014 COSMIC
COSN5256863 2025 COSMIC
COSN26635584 2053 COSMIC
COSN16129090 2075 COSMIC
COSN30544588 2098 COSMIC
COSN31585746 2186 COSMIC
COSN23269077 2217 COSMIC
COSN4718845 2743 COSMIC
COSN6985953 3006 COSMIC
COSN31960692 3012 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs782017375 1 dbSNP
rs984112551 3 dbSNP
rs909888346 15 dbSNP
rs373641108 16 dbSNP
rs537873703 17 dbSNP
rs1218339727 25 dbSNP
rs782065926 32 dbSNP
rs1345544346 41 dbSNP
rs1302431941 44 dbSNP
rs1233650057 45 dbSNP
rs917183301 55 dbSNP
rs949899147 57 dbSNP
rs60495668 62 dbSNP
rs1293319221 69 dbSNP
rs1041983479 72 dbSNP
rs902926466 74 dbSNP
rs1299093530 77 dbSNP
rs1380641484 77 dbSNP
rs375385430 77 dbSNP
rs568719919 77 dbSNP
rs1421765427 80 dbSNP
rs1373789018 83 dbSNP
rs1172393089 84 dbSNP
rs782553769 84 dbSNP
rs1379932394 85 dbSNP
rs192793968 87 dbSNP
rs1054009066 88 dbSNP
rs1263261808 90 dbSNP
rs782058567 91 dbSNP
rs1279101909 92 dbSNP
rs1484502037 92 dbSNP
rs1057924 93 dbSNP
rs1346818609 96 dbSNP
rs1249611838 99 dbSNP
rs1226588054 109 dbSNP
rs1340986485 112 dbSNP
rs565929969 112 dbSNP
rs781873996 112 dbSNP
rs782706523 112 dbSNP
rs782742932 116 dbSNP
rs1039917652 123 dbSNP
rs1397017762 125 dbSNP
rs142009888 128 dbSNP
rs1166724117 130 dbSNP
rs540477361 137 dbSNP
rs1424887056 139 dbSNP
rs1473925463 142 dbSNP
rs782476131 142 dbSNP
rs1026266131 146 dbSNP
rs1187806289 152 dbSNP
rs1443983828 152 dbSNP
rs951462297 154 dbSNP
rs1248165369 156 dbSNP
rs1197704071 157 dbSNP
rs1005659807 168 dbSNP
rs1318554149 182 dbSNP
rs1016917561 192 dbSNP
rs1220599275 194 dbSNP
rs1332726228 198 dbSNP
rs1283895641 201 dbSNP
rs1245784035 204 dbSNP
rs1342431476 210 dbSNP
rs1327278408 222 dbSNP
rs1446439047 226 dbSNP
rs1401721205 228 dbSNP
rs112708952 248 dbSNP
rs573821220 261 dbSNP
rs991511063 264 dbSNP
rs1412427173 274 dbSNP
rs1163274055 276 dbSNP
rs1473576642 282 dbSNP
rs140960623 283 dbSNP
rs1177798481 284 dbSNP
rs35983476 286 dbSNP
rs971757309 293 dbSNP
rs781834776 296 dbSNP
rs562672251 297 dbSNP
rs1289264744 299 dbSNP
rs556252881 311 dbSNP
rs1358782440 324 dbSNP
rs1307317745 327 dbSNP
rs531678435 350 dbSNP
rs1312167935 356 dbSNP
rs1439358279 359 dbSNP
rs935727696 368 dbSNP
rs1323678888 369 dbSNP
rs1406551230 386 dbSNP
rs1382390944 388 dbSNP
rs371091897 389 dbSNP
rs1381926088 395 dbSNP
rs1191457441 397 dbSNP
rs781937133 402 dbSNP
rs910329022 407 dbSNP
rs782544643 423 dbSNP
rs1222462306 428 dbSNP
rs1453366787 429 dbSNP
rs373331866 431 dbSNP
rs1040056581 434 dbSNP
rs1354609972 439 dbSNP
rs901415748 440 dbSNP
rs1217791713 448 dbSNP
rs1275940465 451 dbSNP
rs1438040678 458 dbSNP
rs564888292 470 dbSNP
rs1297262579 473 dbSNP
rs1419948465 476 dbSNP
rs144703582 482 dbSNP
rs1171562743 483 dbSNP
rs1047205366 491 dbSNP
rs1413653199 491 dbSNP
rs1425832362 494 dbSNP
rs868910747 495 dbSNP
rs1479079620 504 dbSNP
rs1261139166 508 dbSNP
rs887288021 511 dbSNP
rs371243900 514 dbSNP
rs782118756 515 dbSNP
rs1488756562 523 dbSNP
rs1288367732 532 dbSNP
rs1208524291 538 dbSNP
rs1311944317 545 dbSNP
rs1005753018 546 dbSNP
rs1221424954 547 dbSNP
rs1316533836 552 dbSNP
rs1277028288 556 dbSNP
rs548109150 558 dbSNP
rs1342019578 572 dbSNP
rs1300677180 577 dbSNP
rs868920924 584 dbSNP
rs1017013545 586 dbSNP
rs958818887 587 dbSNP
rs1359510379 591 dbSNP
rs1177892612 594 dbSNP
rs1408144573 594 dbSNP
rs1422781263 605 dbSNP
rs1012917135 608 dbSNP
rs1024736209 609 dbSNP
rs971302120 613 dbSNP
rs17174410 621 dbSNP
rs1265668764 626 dbSNP
rs1180333331 628 dbSNP
rs1483162753 632 dbSNP
rs1238426999 633 dbSNP
rs1212607948 635 dbSNP
rs1456851216 642 dbSNP
rs185536769 646 dbSNP
rs1218767380 649 dbSNP
rs1319377326 652 dbSNP
rs1310206357 657 dbSNP
rs1227395870 661 dbSNP
rs1379356355 663 dbSNP
rs635903 677 dbSNP
rs1331915918 680 dbSNP
rs1162701141 686 dbSNP
rs1466270616 686 dbSNP
rs782192206 686 dbSNP
rs1423467136 688 dbSNP
rs989963603 694 dbSNP
rs1414755386 698 dbSNP
rs910299497 700 dbSNP
rs1183988804 704 dbSNP
rs1438202593 705 dbSNP
rs1238168725 719 dbSNP
rs1199800519 723 dbSNP
rs1459435050 725 dbSNP
rs782173680 728 dbSNP
rs782554671 730 dbSNP
rs1040004752 734 dbSNP
rs922931215 739 dbSNP
rs934231780 745 dbSNP
rs1321970803 751 dbSNP
rs542969347 768 dbSNP
rs12275130 769 dbSNP
rs1375872715 772 dbSNP
rs1309960819 776 dbSNP
rs190740642 796 dbSNP
rs1448923785 801 dbSNP
rs140002200 805 dbSNP
rs1291894975 810 dbSNP
rs941507519 816 dbSNP
rs1457431519 832 dbSNP
rs1350740115 837 dbSNP
rs1165677513 850 dbSNP
rs1038584771 852 dbSNP
rs782667024 854 dbSNP
rs1438286976 858 dbSNP
rs1380087248 860 dbSNP
rs894532411 867 dbSNP
rs1442117469 869 dbSNP
rs1265823551 872 dbSNP
rs557791815 876 dbSNP
rs577674683 879 dbSNP
rs1024288040 887 dbSNP
rs181669390 906 dbSNP
rs149972999 908 dbSNP
rs75175317 910 dbSNP
rs1286478832 911 dbSNP
rs1242001643 923 dbSNP
rs189146374 926 dbSNP
rs782565759 945 dbSNP
rs1329298567 949 dbSNP
rs1300480692 956 dbSNP
rs1386328007 991 dbSNP
rs957323342 1004 dbSNP
rs1368374555 1015 dbSNP
rs75854397 1017 dbSNP
rs1418100780 1022 dbSNP
rs181105924 1026 dbSNP
rs1159649162 1027 dbSNP
rs1455649746 1042 dbSNP
rs1376474549 1046 dbSNP
rs1175971756 1051 dbSNP
rs1433326402 1053 dbSNP
rs1270428962 1066 dbSNP
rs145196484 1067 dbSNP
rs576130962 1068 dbSNP
rs1263397634 1075 dbSNP
rs976250741 1077 dbSNP
rs545058914 1081 dbSNP
rs1255414548 1082 dbSNP
rs1233891946 1096 dbSNP
rs1313812654 1098 dbSNP
rs185747842 1102 dbSNP
rs782471034 1103 dbSNP
rs923074663 1107 dbSNP
rs1285305428 1109 dbSNP
rs1398171773 1115 dbSNP
rs374126848 1126 dbSNP
rs1298995049 1136 dbSNP
rs983178605 1149 dbSNP
rs1384342160 1150 dbSNP
rs1400499462 1157 dbSNP
rs1172300859 1172 dbSNP
rs1467009764 1173 dbSNP
rs782631487 1180 dbSNP
rs908789030 1185 dbSNP
rs1167946346 1187 dbSNP
rs941603935 1192 dbSNP
rs1477198283 1195 dbSNP
rs1423949391 1204 dbSNP
rs1038510607 1219 dbSNP
rs769486776 1229 dbSNP
rs1194878531 1245 dbSNP
rs1440548252 1246 dbSNP
rs1255218788 1253 dbSNP
rs371874259 1255 dbSNP
rs1484206340 1265 dbSNP
rs1256052519 1274 dbSNP
rs1216918285 1278 dbSNP
rs1317370722 1283 dbSNP
rs200617376 1284 dbSNP
rs1046216820 1293 dbSNP
rs907306738 1312 dbSNP
rs782257757 1313 dbSNP
rs1409008661 1318 dbSNP
rs541042259 1319 dbSNP
rs1329873296 1321 dbSNP
rs1464713574 1322 dbSNP
rs561657451 1341 dbSNP
rs1169070485 1343 dbSNP
rs1367477639 1347 dbSNP
rs1471622086 1347 dbSNP
rs1188052597 1348 dbSNP
rs1011449376 1350 dbSNP
rs1236351757 1352 dbSNP
rs530293405 1356 dbSNP
rs1197919440 1365 dbSNP
rs1017366809 1367 dbSNP
rs1458112944 1371 dbSNP
rs1273811126 1375 dbSNP
rs1197590971 1378 dbSNP
rs550421830 1394 dbSNP
rs1283798812 1408 dbSNP
rs1246040691 1413 dbSNP
rs1307794477 1418 dbSNP
rs1385433715 1418 dbSNP
rs1446720612 1425 dbSNP
rs1401606370 1433 dbSNP
rs1330330812 1437 dbSNP
rs1403071516 1438 dbSNP
rs1389614155 1442 dbSNP
rs188258623 1443 dbSNP
rs1378265389 1445 dbSNP
rs1426378712 1445 dbSNP
rs531445793 1446 dbSNP
rs1440273979 1447 dbSNP
rs374394200 1448 dbSNP
rs797033338 1448 dbSNP
rs1223488695 1449 dbSNP
rs201011708 1449 dbSNP
rs7927511 1449 dbSNP
rs1361790832 1450 dbSNP
rs7927811 1451 dbSNP
rs1433758513 1452 dbSNP
rs1406397920 1453 dbSNP
rs1358191066 1454 dbSNP
rs1157851847 1456 dbSNP
rs1420061673 1458 dbSNP
rs964502887 1474 dbSNP
rs1410126160 1480 dbSNP
rs1170739632 1494 dbSNP
rs1477116742 1494 dbSNP
rs1246218159 1498 dbSNP
rs1490907258 1502 dbSNP
rs564534747 1502 dbSNP
rs1030492035 1507 dbSNP
rs1261273123 1510 dbSNP
rs113237045 1515 dbSNP
rs1317890930 1535 dbSNP
rs1287023585 1543 dbSNP
rs1217990574 1546 dbSNP
rs1283403817 1551 dbSNP
rs1406194738 1553 dbSNP
rs1338032828 1558 dbSNP
rs782678293 1563 dbSNP
rs1297170262 1567 dbSNP
rs1400457353 1568 dbSNP
rs782178889 1578 dbSNP
rs983491155 1580 dbSNP
rs1331874659 1587 dbSNP
rs553473973 1590 dbSNP
rs567567354 1604 dbSNP
rs1413848185 1606 dbSNP
rs908883747 1610 dbSNP
rs941571311 1614 dbSNP
rs974336402 1621 dbSNP
rs1193215058 1627 dbSNP
rs1486279262 1627 dbSNP
rs1244210421 1644 dbSNP
rs1208398647 1647 dbSNP
rs916193443 1665 dbSNP
rs536093756 1671 dbSNP
rs148902519 1672 dbSNP
rs564715010 1677 dbSNP
rs928702880 1678 dbSNP
rs1214798508 1690 dbSNP
rs1363557303 1691 dbSNP
rs781948501 1694 dbSNP
rs565617219 1704 dbSNP
rs1471036419 1707 dbSNP
rs527451873 1707 dbSNP
rs781907824 1707 dbSNP
rs782239509 1707 dbSNP
rs934770252 1713 dbSNP
rs1053008640 1714 dbSNP
rs1398208686 1719 dbSNP
rs1169988813 1722 dbSNP
rs893156258 1725 dbSNP
rs1421866063 1729 dbSNP
rs1429362243 1729 dbSNP
rs544800521 1734 dbSNP
rs1472660948 1740 dbSNP
rs1244355214 1752 dbSNP
rs1011562249 1757 dbSNP
rs1038910429 1760 dbSNP
rs900455769 1761 dbSNP
rs997751790 1766 dbSNP
rs1030174866 1767 dbSNP
rs115020540 1770 dbSNP
rs1227593729 1778 dbSNP
rs1383255902 1781 dbSNP
rs1316810309 1782 dbSNP
rs1444493378 1799 dbSNP
rs572430712 1803 dbSNP
rs1297713185 1812 dbSNP
rs1462533911 1812 dbSNP
rs541429398 1823 dbSNP
rs1162929415 1849 dbSNP
rs547286734 1850 dbSNP
rs1015910291 1851 dbSNP
rs963024120 1863 dbSNP
rs187112956 1868 dbSNP
rs916160823 1881 dbSNP
rs970367776 1882 dbSNP
rs981983964 1884 dbSNP
rs143624850 1887 dbSNP
rs1220385461 1904 dbSNP
rs1359638510 1913 dbSNP
rs1293700865 1915 dbSNP
rs934717039 1933 dbSNP
rs1237641638 1934 dbSNP
rs1352946726 1934 dbSNP
rs1307588986 1936 dbSNP
rs367903607 1937 dbSNP
rs1375613320 1941 dbSNP
rs914683823 1943 dbSNP
rs1291788411 1948 dbSNP
rs1404579556 1949 dbSNP
rs544090764 1960 dbSNP
rs1165893042 1966 dbSNP
rs1418232992 1974 dbSNP
rs1363787268 1983 dbSNP
rs1160468061 1985 dbSNP
rs146482354 1988 dbSNP
rs1264672142 1991 dbSNP
rs1039045529 1993 dbSNP
rs900384357 1995 dbSNP
rs532804686 1996 dbSNP
rs552782858 2003 dbSNP
rs11547504 2006 dbSNP
rs1214241509 2011 dbSNP
rs1487831714 2028 dbSNP
rs117166580 2047 dbSNP
rs781932590 2051 dbSNP
rs1299306738 2057 dbSNP
rs1222936142 2058 dbSNP
rs1004749230 2062 dbSNP
rs1346427397 2066 dbSNP
rs111287313 2068 dbSNP
rs963160994 2070 dbSNP
rs547393633 2072 dbSNP
rs1023307714 2075 dbSNP
rs1289760625 2081 dbSNP
rs1455828416 2082 dbSNP
rs144802378 2085 dbSNP
rs970674492 2094 dbSNP
rs1175137847 2107 dbSNP
rs782814447 2114 dbSNP
rs1431047846 2117 dbSNP
rs111990038 2119 dbSNP
rs1445993051 2124 dbSNP
rs956215107 2125 dbSNP
rs138566380 2128 dbSNP
rs1482251305 2137 dbSNP
rs1255305483 2142 dbSNP
rs1324372260 2146 dbSNP
rs781945336 2146 dbSNP
rs1285201278 2155 dbSNP
rs1217051395 2159 dbSNP
rs1326026898 2169 dbSNP
rs1296783820 2174 dbSNP
rs1384244083 2183 dbSNP
rs549746508 2208 dbSNP
rs1336634422 2244 dbSNP
rs1469928381 2256 dbSNP
rs74800806 2257 dbSNP
rs1167843488 2258 dbSNP
rs782226499 2259 dbSNP
rs1373245904 2267 dbSNP
rs1195105013 2283 dbSNP
rs1421806342 2289 dbSNP
rs1242534976 2296 dbSNP
rs1184143236 2300 dbSNP
rs782073515 2316 dbSNP
rs1265106349 2323 dbSNP
rs1196783499 2328 dbSNP
rs1252089395 2331 dbSNP
rs1230152731 2333 dbSNP
rs569706929 2336 dbSNP
rs974677505 2339 dbSNP
rs549710346 2340 dbSNP
rs933207201 2344 dbSNP
rs1328721239 2350 dbSNP
rs1385548093 2350 dbSNP
rs1051676758 2351 dbSNP
rs1408826201 2352 dbSNP
rs538524945 2354 dbSNP
rs940500827 2361 dbSNP
rs1384396932 2366 dbSNP
rs12278611 2367 dbSNP
rs12278614 2369 dbSNP
rs1446406311 2373 dbSNP
rs1236256772 2383 dbSNP
rs12291713 2384 dbSNP
rs1437301271 2387 dbSNP
rs1251596390 2391 dbSNP
rs1197780863 2394 dbSNP
rs898880421 2398 dbSNP
rs868951254 2408 dbSNP
rs1012005085 2409 dbSNP
rs1291529504 2412 dbSNP
rs781842856 2415 dbSNP
rs1362268567 2416 dbSNP
rs1307673939 2420 dbSNP
rs1440907837 2421 dbSNP
rs906211285 2423 dbSNP
rs1335840809 2425 dbSNP
rs192443926 2428 dbSNP
rs1035944588 2429 dbSNP
rs956324229 2430 dbSNP
rs988907094 2433 dbSNP
rs1021751627 2438 dbSNP
rs12278666 2439 dbSNP
rs1426294396 2441 dbSNP
rs1378467483 2442 dbSNP
rs1157924285 2448 dbSNP
rs1470433148 2449 dbSNP
rs1364470997 2450 dbSNP
rs1184018602 2451 dbSNP
rs1268408072 2453 dbSNP
rs1223747835 2454 dbSNP
rs1490938194 2458 dbSNP
rs1223732995 2460 dbSNP
rs151080039 2460 dbSNP
rs968752100 2461 dbSNP
rs1280817968 2462 dbSNP
rs1186352505 2463 dbSNP
rs1201295704 2463 dbSNP
rs1224979875 2463 dbSNP
rs1230397562 2463 dbSNP
rs1244400128 2463 dbSNP
rs1269408869 2463 dbSNP
rs1283296419 2463 dbSNP
rs1322213818 2463 dbSNP
rs1332096800 2463 dbSNP
rs1346940016 2463 dbSNP
rs1359366955 2463 dbSNP
rs1405461384 2463 dbSNP
rs1417602516 2463 dbSNP
rs1431152034 2463 dbSNP
rs1468357267 2463 dbSNP
rs1471098811 2463 dbSNP
rs1475938691 2463 dbSNP
rs386374947 2463 dbSNP
rs544958986 2463 dbSNP
rs56324717 2463 dbSNP
rs782799759 2463 dbSNP
rs12793334 2464 dbSNP
rs1461212658 2467 dbSNP
rs1263241903 2468 dbSNP
rs1204973350 2469 dbSNP
rs1271821237 2472 dbSNP
rs1305446988 2472 dbSNP
rs1214999075 2473 dbSNP
rs1363808416 2474 dbSNP
rs1312556891 2475 dbSNP
rs1451857419 2476 dbSNP
rs1383389275 2485 dbSNP
rs1337521047 2489 dbSNP
rs1170003140 2490 dbSNP
rs1353035399 2490 dbSNP
rs1467631300 2490 dbSNP
rs201678929 2491 dbSNP
rs1422113075 2492 dbSNP
rs759841287 2502 dbSNP
rs765440959 2504 dbSNP
rs1491220735 2510 dbSNP
rs1491106275 2511 dbSNP
rs1479362377 2513 dbSNP
rs1232017758 2515 dbSNP
rs1204780071 2517 dbSNP
rs1289365789 2518 dbSNP
rs922041596 2518 dbSNP
rs1360139333 2520 dbSNP
rs1317061912 2521 dbSNP
rs114476800 2524 dbSNP
rs1371284856 2529 dbSNP
rs558517700 2536 dbSNP
rs907774765 2537 dbSNP
rs940594317 2539 dbSNP
rs1372598237 2541 dbSNP
rs1301726132 2542 dbSNP
rs1386467674 2543 dbSNP
rs1424398812 2543 dbSNP
rs1166009829 2545 dbSNP
rs1417780124 2547 dbSNP
rs1406623286 2548 dbSNP
rs1177238297 2550 dbSNP
rs1481435464 2554 dbSNP
rs1266305477 2556 dbSNP
rs1221548605 2558 dbSNP
rs1293588751 2559 dbSNP
rs141207290 2561 dbSNP
rs1316220501 2562 dbSNP
rs899015886 2565 dbSNP
rs1306425623 2567 dbSNP
rs1224376850 2569 dbSNP
rs1352612899 2573 dbSNP
rs1281594666 2575 dbSNP
rs202178980 2575 dbSNP
rs1295592313 2576 dbSNP
rs947757175 2576 dbSNP
rs1044806233 2580 dbSNP
rs1345086992 2584 dbSNP
rs1159264478 2585 dbSNP
rs1426850295 2585 dbSNP
rs1198244320 2594 dbSNP
rs1480528111 2597 dbSNP
rs1270809681 2599 dbSNP
rs868933458 2600 dbSNP
rs1485524931 2601 dbSNP
rs1216661342 2602 dbSNP
rs1331314079 2608 dbSNP
rs1281379952 2609 dbSNP
rs1223146232 2611 dbSNP
rs1346332922 2617 dbSNP
rs1303919764 2618 dbSNP
rs906314964 2618 dbSNP
rs539282932 2620 dbSNP
rs782650056 2624 dbSNP
rs1003202687 2627 dbSNP
rs758170324 2628 dbSNP
rs374930116 2629 dbSNP
rs1403283040 2630 dbSNP
rs1459224354 2630 dbSNP
rs892008997 2632 dbSNP
rs1010464818 2636 dbSNP
rs1378970433 2636 dbSNP
rs1190819173 2640 dbSNP
rs1427687898 2644 dbSNP
rs1262419949 2646 dbSNP
rs1021720676 2649 dbSNP
rs183948283 2652 dbSNP
rs975342022 2657 dbSNP
rs1203082958 2658 dbSNP
rs1324603428 2671 dbSNP
rs1257975109 2672 dbSNP
rs534371900 2674 dbSNP
rs751544935 2677 dbSNP
rs142769829 2680 dbSNP
rs367903305 2680 dbSNP
rs1296668745 2681 dbSNP
rs1437933827 2696 dbSNP
rs1381177887 2698 dbSNP
rs954990191 2700 dbSNP
rs1452699467 2702 dbSNP
rs987454764 2707 dbSNP
rs1165787597 2712 dbSNP
rs1461108775 2729 dbSNP
rs574930445 2739 dbSNP
rs961931741 2740 dbSNP
rs973328474 2762 dbSNP
rs782220878 2774 dbSNP
rs117323688 2776 dbSNP
rs1242431607 2776 dbSNP
rs947850630 2783 dbSNP
rs1045337014 2792 dbSNP
rs185681645 2795 dbSNP
rs1443074232 2799 dbSNP
rs1258276080 2803 dbSNP
rs369683258 2804 dbSNP
rs927702688 2809 dbSNP
rs1338928711 2811 dbSNP
rs939101755 2812 dbSNP
rs1231034356 2816 dbSNP
rs1357986841 2819 dbSNP
rs577597127 2821 dbSNP
rs1246158793 2823 dbSNP
rs1341747371 2826 dbSNP
rs1326210735 2828 dbSNP
rs1390481858 2830 dbSNP
rs1396717476 2831 dbSNP
rs1309677384 2834 dbSNP
rs565782418 2843 dbSNP
rs782583121 2844 dbSNP
rs1010558185 2869 dbSNP
rs1473704284 2885 dbSNP
rs559664058 2889 dbSNP
rs1179704243 2890 dbSNP
rs1437506793 2893 dbSNP
rs1252782274 2894 dbSNP
rs1043273216 2896 dbSNP
rs1207808814 2903 dbSNP
rs1291410838 2906 dbSNP
rs1489960334 2906 dbSNP
rs904825119 2909 dbSNP
rs1210968028 2910 dbSNP
rs1359016185 2912 dbSNP
rs527389540 2912 dbSNP
rs1029581681 2914 dbSNP
rs1237663035 2916 dbSNP
rs1336045678 2923 dbSNP
rs1289834764 2929 dbSNP
rs1402645109 2931 dbSNP
rs554083500 2932 dbSNP
rs574033931 2935 dbSNP
rs1407045755 2936 dbSNP
rs1014904008 2937 dbSNP
rs1156952889 2940 dbSNP
rs1469678229 2943 dbSNP
rs547215604 2948 dbSNP
rs962025679 2952 dbSNP
rs1413060556 2955 dbSNP
rs1184618358 2957 dbSNP
rs1479546163 2958 dbSNP
rs1268648789 2970 dbSNP
rs1222718216 2977 dbSNP
rs1282756400 2978 dbSNP
rs782151359 2978 dbSNP
rs1204111154 2983 dbSNP
rs561035019 2985 dbSNP
rs1329244527 2986 dbSNP
rs1269420826 2990 dbSNP
rs529669334 2992 dbSNP
rs9289 2993 dbSNP
rs1221327944 2996 dbSNP
rs1344432945 3000 dbSNP
rs780744512 3010 dbSNP
rs1438322536 3011 dbSNP
rs527853313 3016 dbSNP
rs1317552067 3017 dbSNP
rs1401149007 3021 dbSNP
rs1389485355 3023 dbSNP
rs1161396004 3040 dbSNP
rs1468458865 3042 dbSNP
rs1428817396 3047 dbSNP
rs1192184127 3048 dbSNP
rs1479208263 3050 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Chang J; Nicolas E; Marks D; Sander C; et al.
- RNA biology, 2004
These studies show that miR-122, a 22-nucleotide microRNA, is derived from a liver-specific noncoding polyadenylated RNA transcribed from the gene hcr. The exact sequence of miR-122 as well as the adjacent secondary structure within the hcr mRNA are conserved from mammalian species back to fish. Levels of miR-122 in the mouse liver increase to half maximal values around day 17 of embryogenesis, and reach near maximal levels of 50,000 copies per average cell before birth. Lewis et al. (2003) predicted the cationic amino acid transporter (CAT-1 or SLC7A1) as a miR-122 target. CAT-1 protein and its mRNA are expressed in all mammalian tissues but with lower levels in adult liver. Furthermore, during mouse liver development CAT-1 mRNA decreases in an almost inverse correlation with miR-122. Eight potential miR-122 target sites were predicted within the human CAT-1 mRNA, with six in the 3'-untranslated region. Using a reporter construct it was found that just three of the predicted sites, linked in a 400-nucleotide sequence from human CAT-1, acted with synergy and were sufficient to strongly inhibit protein synthesis and reduce mRNA levels. In summary, these studies followed the accumulation during development of miR-122 from its mRNA precursor, hcr, through to identification of what may be a specific mRNA target, CAT-1.
LinkOut: [PMID: 17179747]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... Verification of miR-122 target genes using 3'UTR reporter assay is shown in Supporting Table 4. ...

- Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al., 2009, Hepatology (Baltimore, Md.).

Article - Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al.
- Hepatology (Baltimore, Md.), 2009
UNLABELLED: MicroRNAs (miRNAs), which are inhibitors of gene expression, participate in diverse biological functions and in carcinogenesis. In this study, we show that liver-specific microRNA-122 (miR-122) is significantly down-regulated in liver cancers with intrahepatic metastasis and negatively regulates tumorigenesis. Restoration of miR-122 in metastatic Mahlavu and SK-HEP-1 cells significantly reduced in vitro migration, invasion, and anchorage-independent growth as well as in vivo tumorigenesis, angiogenesis, and intrahepatic metastasis in an orthotopic liver cancer model. Because an inverse expression pattern is often present between an miRNA and its target genes, we used a computational approach and identified multiple miR-122 candidate target genes from two independent expression microarray datasets. Thirty-two target genes were empirically verified, and this group of genes was enriched with genes regulating cell movement, cell morphology, cell-cell signaling, and transcription. We further showed that one of the miR-122 targets, ADAM17 (a disintegrin and metalloprotease 17) is involved in metastasis. Silencing of ADAM17 resulted in a dramatic reduction of in vitro migration, invasion, in vivo tumorigenesis, angiogenesis, and local invasion in the livers of nude mice, which is similar to that which occurs with the restoration of miR-122. CONCLUSION: Our study suggests that miR-122, a tumor suppressor microRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, exerts some of its action via regulation of ADAM17. Restoration of miR-122 has a far-reaching effect on the cell. Using the concomitant down-regulation of its targets, including ADAM17, a rational therapeutic strategy based on miR-122 may prove to be beneficial for patients with hepatocellular carcinoma.
LinkOut: [PMID: 19296470]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*