miRTarBase - #MIRT003084 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ANXA11   
Synonyms ANX11, CAP-50, CAP50
Description annexin A11
Transcript NM_001157   
Other Transcripts NM_145868 , NM_145869   
Expression
Putative miRNA Targets on ANXA11
3'UTR of ANXA11
(miRNA target sites are highlighted)
>ANXA11|NM_001157|3'UTR
   1 ACAGTGACTGGTGGCTCACTTCTGCCCACCTGCCGGCAACACCAGTGCCAGGAAAAGGCCAAAAGAATGTCTGTTTCTAA
  81 CAAATCCACAAATAGCCCCGAGATTCACCGTCCTAGAGCTTAGGCCTGTCTTCCACCCCTCCTGACCCGTATAGTGTGCC
 161 ACAGGACCTGGGTCGGTCTAGAACTCTCTCAGGATGCCTTTTCTACCCCATCCCTCACAGCCTCTTGCTGCTAAAATAGA
 241 TGTTTCATTTTTCTGACTCATGCAATCATTCCCCTTTGCCTGTGGCTAAGACTTGGCTTCATTTCGTCATGTAATTGTAT
 321 ATTTTTATTTGGAGGCATATTTTCTTTTCTTACAGTCATTGCCAGACAGAGGCATACAAGTCTGTTTGCTGCATACACAT
 401 TTCTGGTGAGGGCGACTGGGTGGGTGAAGCACCGTGTCCTCGCTGAGGAGAGAAAGGGAGGCGTGCCTGAGAAGGTAGCC
 481 TGTGCATCTGGTGAGTGTGTCACGAGCTTTGTTACTGCCAAACTCACTCCTTTTTAGAAAAAACAAAAAAAAAGGGCCAG
 561 AAAGTCATTCCTTCCATCTTCCTTGCAGAAACCACGAGAACAAAGCCAGTTCCCTGTCAGTGACAGGGCTTCTTGTAATT
 641 TGTGGTATGTGCCTTAAACCTGAATGTCTGTAGCCAAAACTTGTTTCCACATTAAGAGTCAGCCAGCTCTGGAATGGTCT
 721 GGAAATGTCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuugugguaacaguGUGAGGu 5'
                         |||||| 
Target 5' tgttactgccaaactCACTCCt 3'
510 - 531 120.00 -11.80
2
miRNA  3' guuugugGUAACAGUGUGAGGu 5'
                 |||   ||||:|:| 
Target 5' tttgctgCAT--ACACATTTCt 3'
385 - 404 115.00 -8.50
3
miRNA  3' guuugUGGUAACAGUGUGAGGu 5'
               ||:: || | ||||:| 
Target 5' cagtgACTGGTGGCTCACTTCt 3'
2 - 23 113.00 -10.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26966242 4 COSMIC
COSN31526051 52 COSMIC
COSN31613599 58 COSMIC
COSN30111501 60 COSMIC
COSN23013280 73 COSMIC
COSN30158617 83 COSMIC
COSN18713671 99 COSMIC
COSN31527653 110 COSMIC
COSN28884276 119 COSMIC
COSN31597357 146 COSMIC
COSN31560923 158 COSMIC
COSN31551903 170 COSMIC
COSN20860177 220 COSMIC
COSN30118993 220 COSMIC
COSN31536343 256 COSMIC
COSN20077134 274 COSMIC
COSN31488470 305 COSMIC
COSN22864285 340 COSMIC
COSN31529332 344 COSMIC
COSN31524126 382 COSMIC
COSN7070182 420 COSMIC
COSN31537902 433 COSMIC
COSN24699751 455 COSMIC
COSN1501846 480 COSMIC
COSN30171055 504 COSMIC
COSN31564610 537 COSMIC
COSN8722106 544 COSMIC
COSN31577548 605 COSMIC
COSN28693605 822 COSMIC
COSN15361865 843 COSMIC
COSN29978824 893 COSMIC
COSN25413147 979 COSMIC
COSN21186723 987 COSMIC
COSN27615184 1064 COSMIC
COSN31778835 1106 COSMIC
COSN4896150 1473 COSMIC
COSN23394761 1619 COSMIC
COSN32062036 1734 COSMIC
COSN28724746 2048 COSMIC
COSN5884931 2175 COSMIC
COSN26458285 2182 COSMIC
COSN26310527 2433 COSMIC
COSN18723666 2518 COSMIC
COSN31778825 3076 COSMIC
COSN5291257 3196 COSMIC
COSN32062713 3801 COSMIC
COSN14487166 3940 COSMIC
COSN8722105 3958 COSMIC
COSN8722104 4126 COSMIC
rs1953600 3884 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs200104175 4 dbSNP
rs1445184630 7 dbSNP
rs776283120 10 dbSNP
rs781057466 13 dbSNP
rs369415003 19 dbSNP
rs779661783 24 dbSNP
rs757971318 26 dbSNP
rs201989810 28 dbSNP
rs762214872 30 dbSNP
rs1389366094 31 dbSNP
rs540903210 34 dbSNP
rs143332492 35 dbSNP
rs376530605 39 dbSNP
rs1322416919 44 dbSNP
rs375921939 48 dbSNP
rs1406487672 51 dbSNP
rs1398717703 55 dbSNP
rs1160402206 57 dbSNP
rs1349383822 67 dbSNP
rs962558601 68 dbSNP
rs1018518861 72 dbSNP
rs1802934 81 dbSNP
rs1470594015 89 dbSNP
rs866169122 97 dbSNP
rs1007654038 99 dbSNP
rs561680336 100 dbSNP
rs142987783 109 dbSNP
rs879067096 110 dbSNP
rs1348230203 119 dbSNP
rs2229555 125 dbSNP
rs1284800280 126 dbSNP
rs1030353058 129 dbSNP
rs575643892 136 dbSNP
rs1333531712 137 dbSNP
rs1254559300 138 dbSNP
rs1468626137 138 dbSNP
rs1048352092 147 dbSNP
rs373081857 148 dbSNP
rs116355115 149 dbSNP
rs903164255 151 dbSNP
rs1042028572 153 dbSNP
rs1424081196 153 dbSNP
rs1178285041 154 dbSNP
rs1177269770 159 dbSNP
rs760519782 163 dbSNP
rs1459992084 173 dbSNP
rs187914824 174 dbSNP
rs138435504 175 dbSNP
rs1056970286 184 dbSNP
rs145867259 186 dbSNP
rs937064546 188 dbSNP
rs1197890351 193 dbSNP
rs1354729113 210 dbSNP
rs1230979465 212 dbSNP
rs937123806 213 dbSNP
rs1274474289 218 dbSNP
rs1334866905 227 dbSNP
rs927044042 237 dbSNP
rs370063631 240 dbSNP
rs1270366072 241 dbSNP
rs978411620 254 dbSNP
rs554323812 263 dbSNP
rs913483933 274 dbSNP
rs534165636 288 dbSNP
rs981144487 301 dbSNP
rs574870879 305 dbSNP
rs1207801070 306 dbSNP
rs918250407 309 dbSNP
rs1398903389 335 dbSNP
rs973995896 343 dbSNP
rs756817785 349 dbSNP
rs1308044837 352 dbSNP
rs965659000 376 dbSNP
rs376468814 384 dbSNP
rs1374816675 398 dbSNP
rs182960307 413 dbSNP
rs867030273 414 dbSNP
rs1308667599 422 dbSNP
rs3190233 424 dbSNP
rs770485358 433 dbSNP
rs569288681 434 dbSNP
rs140723641 436 dbSNP
rs967403663 441 dbSNP
rs191624986 442 dbSNP
rs1213663147 453 dbSNP
rs1011838238 454 dbSNP
rs570800391 458 dbSNP
rs1037045059 461 dbSNP
rs1191099728 462 dbSNP
rs893354555 462 dbSNP
rs1055980627 463 dbSNP
rs544858165 465 dbSNP
rs76487007 465 dbSNP
rs527498246 467 dbSNP
rs1045496446 472 dbSNP
rs2789686 473 dbSNP
rs1042868180 475 dbSNP
rs1315569542 480 dbSNP
rs1258254885 483 dbSNP
rs1227739287 486 dbSNP
rs780454218 490 dbSNP
rs1346179597 494 dbSNP
rs1037964632 501 dbSNP
rs547998377 503 dbSNP
rs1261102248 515 dbSNP
rs1219027067 535 dbSNP
rs1351817128 537 dbSNP
rs1285375362 538 dbSNP
rs911102106 543 dbSNP
rs1193245270 544 dbSNP
rs1246856132 544 dbSNP
rs531182110 549 dbSNP
rs965984803 551 dbSNP
rs1452406970 554 dbSNP
rs55965241 554 dbSNP
rs912841630 554 dbSNP
rs986012411 556 dbSNP
rs1386514151 557 dbSNP
rs1395973505 571 dbSNP
rs954249309 572 dbSNP
rs1027017682 580 dbSNP
rs1363043790 588 dbSNP
rs758825748 595 dbSNP
rs750956259 596 dbSNP
rs1316659218 597 dbSNP
rs778810680 602 dbSNP
rs1262943432 608 dbSNP
rs1351579151 612 dbSNP
rs1013603402 613 dbSNP
rs757390793 620 dbSNP
rs1468820208 624 dbSNP
rs1421116726 642 dbSNP
rs754011767 644 dbSNP
rs1267813684 645 dbSNP
rs1418232849 652 dbSNP
rs1179584335 668 dbSNP
rs1365463543 675 dbSNP
rs1457369438 686 dbSNP
rs141534806 687 dbSNP
rs976170942 699 dbSNP
rs1391888851 701 dbSNP
rs1462721313 707 dbSNP
rs562125137 717 dbSNP
rs905728888 718 dbSNP
rs1020314904 721 dbSNP
rs567815074 731 dbSNP
rs773144563 734 dbSNP
rs957380507 736 dbSNP
rs947095343 742 dbSNP
rs1035038500 751 dbSNP
rs1291545504 751 dbSNP
rs554732918 754 dbSNP
rs907398633 760 dbSNP
rs1053184743 766 dbSNP
rs1480227422 767 dbSNP
rs1193846500 771 dbSNP
rs1195644524 777 dbSNP
rs943740780 799 dbSNP
rs780234484 803 dbSNP
rs748316112 804 dbSNP
rs868123737 811 dbSNP
rs551206079 814 dbSNP
rs932910596 816 dbSNP
rs1353544674 817 dbSNP
rs3748242 822 dbSNP
rs1038015414 827 dbSNP
rs776922643 833 dbSNP
rs1244635344 836 dbSNP
rs575689952 843 dbSNP
rs910885128 844 dbSNP
rs574943183 855 dbSNP
rs1233977595 857 dbSNP
rs1050140362 861 dbSNP
rs960779562 863 dbSNP
rs1036008635 873 dbSNP
rs35176036 874 dbSNP
rs1297133541 884 dbSNP
rs1483233028 887 dbSNP
rs1210095547 889 dbSNP
rs1405179707 895 dbSNP
rs1486399200 898 dbSNP
rs905796076 899 dbSNP
rs538363147 900 dbSNP
rs1426396340 907 dbSNP
rs1172018453 916 dbSNP
rs922431634 928 dbSNP
rs1392212432 935 dbSNP
rs767352299 937 dbSNP
rs538929447 945 dbSNP
rs1311666958 948 dbSNP
rs891519906 955 dbSNP
rs1448915280 969 dbSNP
rs967467453 971 dbSNP
rs575836226 973 dbSNP
rs943692489 988 dbSNP
rs890761447 996 dbSNP
rs558982535 1000 dbSNP
rs990233168 1005 dbSNP
rs539083018 1006 dbSNP
rs1422674653 1008 dbSNP
rs1278165668 1022 dbSNP
rs1200325345 1025 dbSNP
rs570714224 1028 dbSNP
rs35914986 1031 dbSNP
rs397847129 1031 dbSNP
rs1265329324 1032 dbSNP
rs1484572705 1037 dbSNP
rs1187905794 1049 dbSNP
rs1454155928 1054 dbSNP
rs759330934 1055 dbSNP
rs974200048 1058 dbSNP
rs940218496 1059 dbSNP
rs908618288 1060 dbSNP
rs1343523631 1061 dbSNP
rs1432899765 1061 dbSNP
rs1260606671 1063 dbSNP
rs992291583 1064 dbSNP
rs961083704 1069 dbSNP
rs547386631 1071 dbSNP
rs1317602834 1074 dbSNP
rs772414467 1075 dbSNP
rs1283386268 1078 dbSNP
rs1314684075 1081 dbSNP
rs1217296602 1096 dbSNP
rs533954820 1104 dbSNP
rs568185646 1119 dbSNP
rs969949219 1125 dbSNP
rs1255316555 1131 dbSNP
rs1478530053 1141 dbSNP
rs1177142818 1145 dbSNP
rs373220195 1147 dbSNP
rs1021575316 1149 dbSNP
rs1233462945 1151 dbSNP
rs1332515406 1159 dbSNP
rs1011410509 1163 dbSNP
rs955931306 1174 dbSNP
rs1328104170 1175 dbSNP
rs796844254 1175 dbSNP
rs971584757 1176 dbSNP
rs780657556 1180 dbSNP
rs1278944267 1183 dbSNP
rs1024447799 1199 dbSNP
rs1371067107 1200 dbSNP
rs1385800639 1201 dbSNP
rs994270030 1203 dbSNP
rs890890921 1204 dbSNP
rs897319281 1205 dbSNP
rs1452618141 1220 dbSNP
rs1400926097 1227 dbSNP
rs1016677343 1231 dbSNP
rs1471457757 1233 dbSNP
rs996498800 1236 dbSNP
rs1183467493 1238 dbSNP
rs1005291743 1263 dbSNP
rs1417266582 1268 dbSNP
rs1474228364 1275 dbSNP
rs1167456741 1279 dbSNP
rs145436814 1290 dbSNP
rs79622405 1298 dbSNP
rs1399212113 1299 dbSNP
rs1411610484 1304 dbSNP
rs1308503235 1311 dbSNP
rs940177662 1313 dbSNP
rs186017089 1315 dbSNP
rs1479111376 1321 dbSNP
rs1057038341 1323 dbSNP
rs1213582580 1327 dbSNP
rs939422555 1335 dbSNP
rs553251546 1341 dbSNP
rs150100424 1342 dbSNP
rs113424869 1343 dbSNP
rs968078902 1344 dbSNP
rs1190126150 1349 dbSNP
rs1042315293 1365 dbSNP
rs945215127 1375 dbSNP
rs1475227466 1388 dbSNP
rs74420990 1420 dbSNP
rs1166321248 1422 dbSNP
rs1197256881 1423 dbSNP
rs527713677 1424 dbSNP
rs1431336726 1425 dbSNP
rs1169220617 1430 dbSNP
rs956151491 1433 dbSNP
rs1264121610 1434 dbSNP
rs990674093 1439 dbSNP
rs1340492241 1441 dbSNP
rs936067579 1443 dbSNP
rs1429602299 1447 dbSNP
rs1344838928 1448 dbSNP
rs1008493161 1459 dbSNP
rs748331195 1460 dbSNP
rs1256979698 1463 dbSNP
rs980105383 1465 dbSNP
rs1191315195 1466 dbSNP
rs1232093562 1471 dbSNP
rs531981698 1472 dbSNP
rs1024544132 1503 dbSNP
rs1475985504 1504 dbSNP
rs972943182 1508 dbSNP
rs1394205737 1520 dbSNP
rs1028054899 1522 dbSNP
rs1376912226 1524 dbSNP
rs961555901 1531 dbSNP
rs996467633 1536 dbSNP
rs1315855840 1540 dbSNP
rs1366886884 1542 dbSNP
rs1436327082 1546 dbSNP
rs1017065452 1550 dbSNP
rs1369175334 1552 dbSNP
rs762414252 1560 dbSNP
rs1444448560 1562 dbSNP
rs1376118397 1563 dbSNP
rs1005714700 1568 dbSNP
rs202210886 1572 dbSNP
rs1350135549 1573 dbSNP
rs1334561449 1577 dbSNP
rs1416017283 1585 dbSNP
rs1270308638 1593 dbSNP
rs181713589 1595 dbSNP
rs370318491 1605 dbSNP
rs771491968 1605 dbSNP
rs769422820 1608 dbSNP
rs1252158425 1609 dbSNP
rs1431163594 1611 dbSNP
rs1200995356 1618 dbSNP
rs887375850 1619 dbSNP
rs7069100 1625 dbSNP
rs1390152596 1633 dbSNP
rs939536635 1637 dbSNP
rs926690318 1638 dbSNP
rs1176907597 1639 dbSNP
rs1392745822 1640 dbSNP
rs112194594 1643 dbSNP
rs1388887725 1643 dbSNP
rs772510408 1645 dbSNP
rs1237029947 1675 dbSNP
rs915204155 1676 dbSNP
rs1329867802 1695 dbSNP
rs561301744 1700 dbSNP
rs945267817 1705 dbSNP
rs1271500186 1710 dbSNP
rs893653167 1712 dbSNP
rs544854524 1724 dbSNP
rs924554701 1729 dbSNP
rs1354031101 1730 dbSNP
rs1287499388 1732 dbSNP
rs1161850219 1734 dbSNP
rs1376043684 1746 dbSNP
rs1413551354 1748 dbSNP
rs11392466 1750 dbSNP
rs1163845545 1750 dbSNP
rs1472595139 1750 dbSNP
rs879189833 1750 dbSNP
rs936104434 1750 dbSNP
rs575805537 1758 dbSNP
rs927373954 1762 dbSNP
rs980583013 1766 dbSNP
rs1351252333 1767 dbSNP
rs986634664 1770 dbSNP
rs955248927 1775 dbSNP
rs559097422 1777 dbSNP
rs917237549 1782 dbSNP
rs1338439454 1783 dbSNP
rs1202942766 1787 dbSNP
rs7078465 1790 dbSNP
rs961566874 1791 dbSNP
rs1483132880 1802 dbSNP
rs1400815561 1805 dbSNP
rs910058100 1806 dbSNP
rs753376565 1815 dbSNP
rs779444684 1820 dbSNP
rs1362738844 1829 dbSNP
rs573174114 1836 dbSNP
rs757757069 1837 dbSNP
rs112780182 1841 dbSNP
rs1016531610 1847 dbSNP
rs1371687097 1852 dbSNP
rs1414287703 1853 dbSNP
rs997932218 1855 dbSNP
rs1381364703 1857 dbSNP
rs1414644920 1858 dbSNP
rs965076373 1863 dbSNP
rs1165438926 1865 dbSNP
rs1294498486 1873 dbSNP
rs533826262 1884 dbSNP
rs1276753375 1889 dbSNP
rs1009491351 1890 dbSNP
rs1210026045 1899 dbSNP
rs893701737 1900 dbSNP
rs1194392031 1901 dbSNP
rs1488409909 1904 dbSNP
rs1253750610 1906 dbSNP
rs1035718573 1912 dbSNP
rs1214020092 1918 dbSNP
rs1448097156 1921 dbSNP
rs1190873232 1923 dbSNP
rs1003706142 1924 dbSNP
rs1352247341 1934 dbSNP
rs905324986 1936 dbSNP
rs1360974055 1937 dbSNP
rs1054043571 1938 dbSNP
rs946757614 1940 dbSNP
rs1290003190 1950 dbSNP
rs568380330 1954 dbSNP
rs1363265509 1956 dbSNP
rs1432690223 1958 dbSNP
rs893906315 1963 dbSNP
rs1052435646 1968 dbSNP
rs778069381 1969 dbSNP
rs1233475919 1976 dbSNP
rs1276409761 1978 dbSNP
rs1313495777 1979 dbSNP
rs1210176880 1997 dbSNP
rs1002074164 1998 dbSNP
rs756340434 2003 dbSNP
rs1044500727 2013 dbSNP
rs554331151 2019 dbSNP
rs1283353380 2021 dbSNP
rs1249049369 2028 dbSNP
rs1454058280 2031 dbSNP
rs950102412 2033 dbSNP
rs924551038 2037 dbSNP
rs1433895671 2041 dbSNP
rs917248729 2042 dbSNP
rs933918740 2047 dbSNP
rs7091565 2048 dbSNP
rs1321386250 2051 dbSNP
rs940288345 2061 dbSNP
rs962408540 2062 dbSNP
rs1273052856 2067 dbSNP
rs910164054 2081 dbSNP
rs1219694705 2085 dbSNP
rs984760491 2091 dbSNP
rs550920805 2092 dbSNP
rs145154086 2098 dbSNP
rs375001577 2112 dbSNP
rs1326386561 2117 dbSNP
rs1325637422 2121 dbSNP
rs528092538 2132 dbSNP
rs921424793 2133 dbSNP
rs1413786918 2137 dbSNP
rs976506038 2143 dbSNP
rs1171815199 2145 dbSNP
rs1489112800 2146 dbSNP
rs965086403 2149 dbSNP
rs1177091322 2150 dbSNP
rs1409871130 2171 dbSNP
rs1473609177 2197 dbSNP
rs1160250849 2201 dbSNP
rs1020651697 2205 dbSNP
rs531946633 2208 dbSNP
rs1321375856 2210 dbSNP
rs112401350 2223 dbSNP
rs1437124020 2233 dbSNP
rs905459140 2244 dbSNP
rs1348159542 2250 dbSNP
rs1229683459 2254 dbSNP
rs1191003222 2258 dbSNP
rs369377875 2261 dbSNP
rs78588336 2265 dbSNP
rs1246757727 2267 dbSNP
rs1002531239 2269 dbSNP
rs17100316 2272 dbSNP
rs893879156 2273 dbSNP
rs1250228503 2276 dbSNP
rs1046173100 2286 dbSNP
rs935340589 2288 dbSNP
rs1014308788 2292 dbSNP
rs561673030 2297 dbSNP
rs1471945099 2312 dbSNP
rs544770426 2315 dbSNP
rs751347659 2320 dbSNP
rs890418190 2321 dbSNP
rs531138528 2326 dbSNP
rs1037064030 2331 dbSNP
rs1405736252 2338 dbSNP
rs940059775 2347 dbSNP
rs565345037 2349 dbSNP
rs1368637696 2350 dbSNP
rs575421992 2351 dbSNP
rs1276682508 2354 dbSNP
rs1434472866 2358 dbSNP
rs1285525928 2361 dbSNP
rs1349383804 2363 dbSNP
rs921194696 2366 dbSNP
rs1228092643 2371 dbSNP
rs1467669442 2373 dbSNP
rs1344972392 2377 dbSNP
rs1206435314 2389 dbSNP
rs909871028 2394 dbSNP
rs941235841 2400 dbSNP
rs766318043 2402 dbSNP
rs1398490919 2403 dbSNP
rs909624682 2409 dbSNP
rs540937586 2418 dbSNP
rs1170471393 2424 dbSNP
rs1048673966 2426 dbSNP
rs1427521315 2431 dbSNP
rs1169081345 2432 dbSNP
rs932863451 2440 dbSNP
rs1425516955 2447 dbSNP
rs530217570 2451 dbSNP
rs1476724722 2461 dbSNP
rs1251844990 2463 dbSNP
rs976896133 2481 dbSNP
rs777489555 2492 dbSNP
rs927594036 2494 dbSNP
rs573317822 2507 dbSNP
rs981785255 2509 dbSNP
rs969613839 2524 dbSNP
rs553078906 2525 dbSNP
rs561559768 2526 dbSNP
rs987872160 2531 dbSNP
rs1464640731 2536 dbSNP
rs1207007614 2541 dbSNP
rs958484513 2542 dbSNP
rs1031179310 2557 dbSNP
rs957769345 2564 dbSNP
rs543051125 2565 dbSNP
rs980714821 2578 dbSNP
rs969685017 2579 dbSNP
rs7087364 2587 dbSNP
rs1013399506 2604 dbSNP
rs554443759 2611 dbSNP
rs897644218 2616 dbSNP
rs1015670125 2625 dbSNP
rs1318042280 2632 dbSNP
rs1310104528 2633 dbSNP
rs1039629088 2636 dbSNP
rs1004697750 2639 dbSNP
rs374432958 2640 dbSNP
rs1329824966 2653 dbSNP
rs756792529 2665 dbSNP
rs1312804751 2667 dbSNP
rs1328506010 2669 dbSNP
rs1226803365 2678 dbSNP
rs1270252314 2694 dbSNP
rs1048836256 2701 dbSNP
rs568725112 2708 dbSNP
rs751094102 2710 dbSNP
rs558201415 2726 dbSNP
rs900057778 2738 dbSNP
rs1041307411 2745 dbSNP
rs1200838339 2747 dbSNP
rs944212870 2758 dbSNP
rs1471975803 2761 dbSNP
rs1156578323 2763 dbSNP
rs2095571 2763 dbSNP
rs969083807 2765 dbSNP
rs1163075338 2766 dbSNP
rs1388966585 2768 dbSNP
rs566594914 2771 dbSNP
rs1177708499 2791 dbSNP
rs546268840 2794 dbSNP
rs1350027187 2800 dbSNP
rs989699483 2801 dbSNP
rs1290483114 2811 dbSNP
rs1330114607 2812 dbSNP
rs1244269778 2816 dbSNP
rs1393906003 2817 dbSNP
rs575852290 2818 dbSNP
rs1441435793 2825 dbSNP
rs987945199 2828 dbSNP
rs1236343714 2830 dbSNP
rs936375885 2844 dbSNP
rs1176562525 2847 dbSNP
rs1483416085 2848 dbSNP
rs958317795 2854 dbSNP
rs529696417 2868 dbSNP
rs768234316 2875 dbSNP
rs567918662 2878 dbSNP
rs1419327793 2883 dbSNP
rs1163563774 2887 dbSNP
rs1367093581 2897 dbSNP
rs1459767992 2899 dbSNP
rs924988064 2901 dbSNP
rs1239020059 2905 dbSNP
rs980815160 2909 dbSNP
rs559105073 2910 dbSNP
rs774640414 2911 dbSNP
rs1242486927 2912 dbSNP
rs531099751 2913 dbSNP
rs1338542436 2921 dbSNP
rs961885580 2924 dbSNP
rs565459529 2932 dbSNP
rs79854977 2933 dbSNP
rs888505896 2934 dbSNP
rs749820924 2936 dbSNP
rs777944116 2939 dbSNP
rs190691725 2950 dbSNP
rs888381484 2951 dbSNP
rs1374518148 2963 dbSNP
rs1158708475 2967 dbSNP
rs186338095 2968 dbSNP
rs1047321185 2970 dbSNP
rs1448214215 2975 dbSNP
rs1170955123 2977 dbSNP
rs1355253871 2995 dbSNP
rs1465595443 2998 dbSNP
rs1041361213 3001 dbSNP
rs144467852 3005 dbSNP
rs1404579118 3009 dbSNP
rs1453601199 3023 dbSNP
rs545390247 3024 dbSNP
rs748337287 3025 dbSNP
rs1158230999 3029 dbSNP
rs906274114 3029 dbSNP
rs1299730523 3054 dbSNP
rs947796437 3057 dbSNP
rs936445218 3064 dbSNP
rs1484040107 3066 dbSNP
rs78401709 3076 dbSNP
rs1044801027 3077 dbSNP
rs752515070 3087 dbSNP
rs1420817390 3091 dbSNP
rs947761499 3099 dbSNP
rs936890267 3100 dbSNP
rs781440880 3109 dbSNP
rs1219092277 3110 dbSNP
rs573986654 3111 dbSNP
rs954934052 3115 dbSNP
rs1030463371 3123 dbSNP
rs1432623056 3133 dbSNP
rs1290613033 3134 dbSNP
rs1362541126 3156 dbSNP
rs755199908 3163 dbSNP
rs1246110600 3170 dbSNP
rs560813302 3174 dbSNP
rs1324082343 3176 dbSNP
rs1310992487 3181 dbSNP
rs1233131367 3183 dbSNP
rs992044814 3184 dbSNP
rs964780935 3187 dbSNP
rs73299508 3200 dbSNP
rs1243015685 3206 dbSNP
rs575187652 3210 dbSNP
rs35014047 3212 dbSNP
rs1269567003 3213 dbSNP
rs1480803633 3226 dbSNP
rs907461746 3237 dbSNP
rs1158784729 3238 dbSNP
rs888341121 3241 dbSNP
rs1455484367 3244 dbSNP
rs1027510097 3245 dbSNP
rs773712594 3251 dbSNP
rs758262799 3252 dbSNP
rs1346923408 3254 dbSNP
rs1404998232 3256 dbSNP
rs766492144 3259 dbSNP
rs1424080038 3260 dbSNP
rs1019595631 3265 dbSNP
rs536908150 3267 dbSNP
rs1196066088 3271 dbSNP
rs538866769 3273 dbSNP
rs1285399343 3274 dbSNP
rs1321437540 3276 dbSNP
rs572804722 3282 dbSNP
rs553041093 3294 dbSNP
rs751741 3295 dbSNP
rs535836793 3303 dbSNP
rs1053437192 3310 dbSNP
rs1489753187 3313 dbSNP
rs1408519397 3317 dbSNP
rs182398991 3322 dbSNP
rs1162647443 3326 dbSNP
rs567290431 3328 dbSNP
rs1045249952 3329 dbSNP
rs1318985380 3330 dbSNP
rs148702441 3333 dbSNP
rs1279755128 3334 dbSNP
rs917585733 3343 dbSNP
rs1378983566 3345 dbSNP
rs1226930359 3350 dbSNP
rs144671565 3359 dbSNP
rs940625967 3370 dbSNP
rs114699685 3375 dbSNP
rs984708382 3378 dbSNP
rs1272594032 3385 dbSNP
rs974892846 3387 dbSNP
rs1386902594 3394 dbSNP
rs1205576761 3397 dbSNP
rs952013607 3400 dbSNP
rs551676606 3405 dbSNP
rs113772135 3406 dbSNP
rs12356916 3415 dbSNP
rs559550570 3417 dbSNP
rs1400697531 3421 dbSNP
rs950784159 3424 dbSNP
rs751740 3430 dbSNP
rs994062045 3431 dbSNP
rs1368229428 3434 dbSNP
rs1411149771 3435 dbSNP
rs1329172098 3441 dbSNP
rs906469253 3450 dbSNP
rs1445290460 3451 dbSNP
rs1317644131 3452 dbSNP
rs1024785763 3463 dbSNP
rs1012115994 3467 dbSNP
rs956672172 3478 dbSNP
rs529246513 3484 dbSNP
rs1296045024 3489 dbSNP
rs117871394 3492 dbSNP
rs543446545 3493 dbSNP
rs1001030016 3495 dbSNP
rs1440942100 3498 dbSNP
rs1199661475 3501 dbSNP
rs1434912035 3503 dbSNP
rs904026018 3505 dbSNP
rs1045196576 3509 dbSNP
rs1011969584 3517 dbSNP
rs1265394595 3518 dbSNP
rs560383279 3520 dbSNP
rs896211889 3524 dbSNP
rs1193502553 3530 dbSNP
rs1388211589 3533 dbSNP
rs1458641048 3534 dbSNP
rs1476135168 3535 dbSNP
rs1168012036 3536 dbSNP
rs1423804476 3540 dbSNP
rs1260360489 3552 dbSNP
rs575178643 3553 dbSNP
rs933544738 3554 dbSNP
rs1056129910 3568 dbSNP
rs564882548 3574 dbSNP
rs1197216291 3575 dbSNP
rs775461640 3577 dbSNP
rs1338283923 3580 dbSNP
rs1407389105 3603 dbSNP
rs1337026203 3611 dbSNP
rs551956709 3621 dbSNP
rs1039158668 3623 dbSNP
rs940385662 3631 dbSNP
rs1274342983 3632 dbSNP
rs1342888599 3634 dbSNP
rs544834951 3639 dbSNP
rs1049485844 3643 dbSNP
rs930545745 3644 dbSNP
rs1207852614 3652 dbSNP
rs573009608 3666 dbSNP
rs1440054408 3667 dbSNP
rs1259338561 3685 dbSNP
rs760315951 3691 dbSNP
rs149359284 3699 dbSNP
rs1245686886 3705 dbSNP
rs950867760 3705 dbSNP
rs944507512 3706 dbSNP
rs1178197381 3712 dbSNP
rs1429530867 3714 dbSNP
rs1456337473 3717 dbSNP
rs1157445642 3719 dbSNP
rs1387513623 3734 dbSNP
rs1333117502 3740 dbSNP
rs1408061736 3742 dbSNP
rs1395509082 3744 dbSNP
rs912672916 3747 dbSNP
rs536322422 3748 dbSNP
rs573812698 3758 dbSNP
rs986878522 3759 dbSNP
rs1284220665 3760 dbSNP
rs1328774797 3762 dbSNP
rs956955285 3763 dbSNP
rs919243238 3769 dbSNP
rs1258740400 3788 dbSNP
rs1467791693 3788 dbSNP
rs1205717297 3789 dbSNP
rs1030966810 3791 dbSNP
rs1375972767 3799 dbSNP
rs377036157 3799 dbSNP
rs980095179 3800 dbSNP
rs1200989585 3801 dbSNP
rs1268930080 3811 dbSNP
rs970620195 3832 dbSNP
rs968305106 3834 dbSNP
rs1024921664 3835 dbSNP
rs774713383 3841 dbSNP
rs1163228864 3843 dbSNP
rs1389175279 3849 dbSNP
rs1012398350 3850 dbSNP
rs1303867340 3851 dbSNP
rs1408243448 3855 dbSNP
rs556776577 3855 dbSNP
rs896641348 3857 dbSNP
rs1337357203 3862 dbSNP
rs556983568 3869 dbSNP
rs1177326666 3882 dbSNP
rs1953600 3884 dbSNP
rs1283337019 3885 dbSNP
rs1357236320 3887 dbSNP
rs1224545599 3888 dbSNP
rs1257341916 3891 dbSNP
rs1291886963 3894 dbSNP
rs1482435604 3896 dbSNP
rs1193783869 3901 dbSNP
rs1252191428 3902 dbSNP
rs1200630011 3903 dbSNP
rs1187310428 3904 dbSNP
rs1383726676 3906 dbSNP
rs1000597165 3912 dbSNP
rs1164704387 3913 dbSNP
rs1004582611 3914 dbSNP
rs1042040748 3917 dbSNP
rs1300170453 3918 dbSNP
rs1277538076 3919 dbSNP
rs116792242 3920 dbSNP
rs902098791 3924 dbSNP
rs1380233269 3928 dbSNP
rs1248158500 3937 dbSNP
rs1048687062 3944 dbSNP
rs1311297904 3950 dbSNP
rs943632700 3950 dbSNP
rs1252503543 3955 dbSNP
rs773884502 3959 dbSNP
rs1049715398 3962 dbSNP
rs770459469 3963 dbSNP
rs1334896312 3970 dbSNP
rs1462922030 3972 dbSNP
rs139751074 3976 dbSNP
rs1397970870 3979 dbSNP
rs1038949851 3989 dbSNP
rs944559811 3992 dbSNP
rs1334954477 3994 dbSNP
rs911718091 4013 dbSNP
rs1173074434 4019 dbSNP
rs548049833 4025 dbSNP
rs1420320004 4034 dbSNP
rs971427503 4035 dbSNP
rs1380416221 4036 dbSNP
rs748233309 4037 dbSNP
rs1297101467 4039 dbSNP
rs1307505722 4040 dbSNP
rs935396164 4045 dbSNP
rs923951406 4055 dbSNP
rs1157342268 4067 dbSNP
rs979433213 4069 dbSNP
rs796438648 4070 dbSNP
rs1247756967 4073 dbSNP
rs374351040 4076 dbSNP
rs1369388810 4079 dbSNP
rs534874656 4084 dbSNP
rs990695014 4099 dbSNP
rs1262590447 4101 dbSNP
rs1443785569 4104 dbSNP
rs1432667075 4107 dbSNP
rs1023869841 4111 dbSNP
rs566285812 4113 dbSNP
rs1032146734 4120 dbSNP
rs991023087 4134 dbSNP
rs1344313202 4145 dbSNP
rs1451559548 4153 dbSNP
rs188999545 4162 dbSNP
rs1035110651 4167 dbSNP
rs966465460 4168 dbSNP
rs1403778877 4174 dbSNP
rs75381932 4183 dbSNP
rs1221979126 4184 dbSNP
rs1349917384 4186 dbSNP
rs997130023 4187 dbSNP
rs111843142 4192 dbSNP
rs1246793324 4193 dbSNP
rs901485024 4194 dbSNP
rs1017228529 4195 dbSNP
rs1488225391 4197 dbSNP
rs1197390226 4198 dbSNP
rs768918573 4199 dbSNP
rs1027801542 4200 dbSNP
rs569856810 4207 dbSNP
rs1400876898 4210 dbSNP
rs994543288 4211 dbSNP
rs1161248827 4215 dbSNP
rs1345741885 4229 dbSNP
rs1423885538 4231 dbSNP
rs1300756457 4233 dbSNP
rs1366835216 4236 dbSNP
rs1405241479 4239 dbSNP
rs900161458 4241 dbSNP
rs1039010441 4254 dbSNP
rs1400605943 4259 dbSNP
rs1008781333 4261 dbSNP
rs150634262 4268 dbSNP
rs1052912411 4283 dbSNP
rs1308093760 4284 dbSNP
rs1359391150 4285 dbSNP
rs935432932 4289 dbSNP
rs1165355558 4301 dbSNP
rs1474399240 4306 dbSNP
rs1417602097 4309 dbSNP
rs924073651 4311 dbSNP
rs897908344 4313 dbSNP
rs1471255108 4314 dbSNP
rs551084106 4321 dbSNP
rs1044186058 4333 dbSNP
rs747198268 4336 dbSNP
rs916577846 4337 dbSNP
rs116960995 4348 dbSNP
rs1424711551 4361 dbSNP
rs925213465 4368 dbSNP
rs1352422392 4379 dbSNP
rs1443872785 4381 dbSNP
rs1299104245 4387 dbSNP
rs960909156 4393 dbSNP
rs1290434823 4399 dbSNP
rs758221891 4410 dbSNP
rs1211569011 4412 dbSNP
rs928146811 4415 dbSNP
rs966977914 4417 dbSNP
rs1439783907 4422 dbSNP
rs1205421088 4427 dbSNP
rs1233304950 4430 dbSNP
rs1460702677 4441 dbSNP
rs983612302 4451 dbSNP
rs950938030 4457 dbSNP
rs1181721254 4467 dbSNP
rs1027442701 4471 dbSNP
rs564998737 4477 dbSNP
rs1383446383 4479 dbSNP
rs1445117294 4480 dbSNP
rs1332354576 4484 dbSNP
rs1166839414 4485 dbSNP
rs13376882 4489 dbSNP
rs528402964 4490 dbSNP
rs1405889830 4500 dbSNP
rs1342655012 4501 dbSNP
rs1339323551 4502 dbSNP
rs1384227374 4503 dbSNP
rs1017197000 4508 dbSNP
rs1008832244 4510 dbSNP
rs890355236 4514 dbSNP
rs1053427613 4522 dbSNP
rs142870721 4526 dbSNP
rs1430180723 4528 dbSNP
rs998727725 4532 dbSNP
rs904346086 4538 dbSNP
rs1201560685 4541 dbSNP
rs1028363271 4555 dbSNP
rs1442937149 4558 dbSNP
rs1192307747 4563 dbSNP
rs71481555 4564 dbSNP
rs1239919040 4570 dbSNP
rs993674156 4580 dbSNP
rs181264672 4583 dbSNP
rs1045948928 4584 dbSNP
rs946750124 4589 dbSNP
rs1467856182 4590 dbSNP
rs1179042436 4591 dbSNP
rs1407229094 4594 dbSNP
rs1400701029 4600 dbSNP
rs916587662 4607 dbSNP
rs950084078 4611 dbSNP
rs1055018617 4612 dbSNP
rs1055785686 4617 dbSNP
rs757244623 4619 dbSNP
rs939621806 4626 dbSNP
rs1225510162 4627 dbSNP
rs1264783173 4628 dbSNP
rs1465811110 4629 dbSNP
rs1345437178 4640 dbSNP
rs1204554536 4663 dbSNP
rs928251253 4664 dbSNP
rs1282023841 4667 dbSNP
rs1448273664 4668 dbSNP
rs1193777544 4671 dbSNP
rs984103904 4682 dbSNP
rs925213416 4685 dbSNP
rs1474755458 4688 dbSNP
rs1378647007 4709 dbSNP
rs1246814301 4711 dbSNP
rs769022957 4724 dbSNP
rs1157389977 4730 dbSNP
rs76372198 4733 dbSNP
rs920723209 4740 dbSNP
rs1401755109 4741 dbSNP
rs973186001 4761 dbSNP
rs1199110432 4764 dbSNP
rs964429438 4764 dbSNP
rs975903404 4774 dbSNP
rs1284158305 4777 dbSNP
rs1017300031 4784 dbSNP
rs1008591569 4785 dbSNP
rs557093534 4786 dbSNP
rs954347919 4789 dbSNP
rs1031620937 4795 dbSNP
rs1320258205 4796 dbSNP
rs1271081522 4805 dbSNP
rs752243801 4813 dbSNP
rs910325835 4814 dbSNP
rs189953645 4815 dbSNP
rs1276733166 4825 dbSNP
rs138384433 4837 dbSNP
rs1021841291 4842 dbSNP
rs1436816695 4846 dbSNP
rs1180148324 4852 dbSNP
rs1365844051 4860 dbSNP
rs1440858053 4863 dbSNP
rs558140916 4869 dbSNP
rs1383540377 4888 dbSNP
rs1010957250 4890 dbSNP
rs1332439740 4892 dbSNP
rs1304028159 4903 dbSNP
rs951837752 4904 dbSNP
rs529685630 4905 dbSNP
rs1167827481 4913 dbSNP
rs994131026 4916 dbSNP
rs1409031667 4919 dbSNP
rs962332722 4924 dbSNP
rs1314261499 4926 dbSNP
rs1425231715 4929 dbSNP
rs145801439 4932 dbSNP
rs1014453932 4949 dbSNP
rs939392271 4950 dbSNP
rs1193657507 4954 dbSNP
rs906527540 4955 dbSNP
rs184276469 4959 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... Verification of miR-122 target genes using 3'UTR reporter assay is shown in Supporting Table 4. ...

- Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al., 2009, Hepatology (Baltimore, Md.).

Article - Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al.
- Hepatology (Baltimore, Md.), 2009
UNLABELLED: MicroRNAs (miRNAs), which are inhibitors of gene expression, participate in diverse biological functions and in carcinogenesis. In this study, we show that liver-specific microRNA-122 (miR-122) is significantly down-regulated in liver cancers with intrahepatic metastasis and negatively regulates tumorigenesis. Restoration of miR-122 in metastatic Mahlavu and SK-HEP-1 cells significantly reduced in vitro migration, invasion, and anchorage-independent growth as well as in vivo tumorigenesis, angiogenesis, and intrahepatic metastasis in an orthotopic liver cancer model. Because an inverse expression pattern is often present between an miRNA and its target genes, we used a computational approach and identified multiple miR-122 candidate target genes from two independent expression microarray datasets. Thirty-two target genes were empirically verified, and this group of genes was enriched with genes regulating cell movement, cell morphology, cell-cell signaling, and transcription. We further showed that one of the miR-122 targets, ADAM17 (a disintegrin and metalloprotease 17) is involved in metastasis. Silencing of ADAM17 resulted in a dramatic reduction of in vitro migration, invasion, in vivo tumorigenesis, angiogenesis, and local invasion in the livers of nude mice, which is similar to that which occurs with the restoration of miR-122. CONCLUSION: Our study suggests that miR-122, a tumor suppressor microRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, exerts some of its action via regulation of ADAM17. Restoration of miR-122 has a far-reaching effect on the cell. Using the concomitant down-regulation of its targets, including ADAM17, a rational therapeutic strategy based on miR-122 may prove to be beneficial for patients with hepatocellular carcinoma.
LinkOut: [PMID: 19296470]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*