miRTarBase - #MIRT003006 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CCNG1   
Synonyms CCNG
Description cyclin G1
Transcript NM_004060   
Other Transcripts NM_199246   
Expression
Putative miRNA Targets on CCNG1
3'UTR of CCNG1
(miRNA target sites are highlighted)
>CCNG1|NM_004060|3'UTR
   1 CTGGATTATTACAGCACCAAAAAACTTCTCTGAAGCCTTTCTCCACAACCTTGTTCTATGGATTCCATAATGTTACAATG
  81 GATTTAAGCTATGAAGCCTCAAAACATCACGAGATAAGCATGATGGTCTCAGACTTGGGAAAACTGCCTAATATTATGCT
 161 GTAGTGGAATTATGTTTAGATTTGAATTCATCTGTGAAGCATTCAAATCAAAGCTAAAAGCCTAAATGTGAAATGCTAAT
 241 GACAAGCCTGAGAAGGTAAACTGTGAATCTTCATTTCTATCATTGATCTAACTTTAGATATTGGATCAATATATTTAGGT
 321 GGTATTGAAAATGCTATTGGAGGAGTCACACTAATACTATCAACTATCAGTCTTCCCACAGCTTCAATCACTGTCATTAT
 401 TCTAATCCTACTCCTACTTAAATTTTAAGTTATGAGGTTTATGTCAAAAGCAACATTTCACAAATGTACTTTTAAGGCAT
 481 AATAAGGGTTAACATTCTAGGCAGTATAAACACACCCCATAATGCAAGTAATAGGTAATCTAGAGATGTGGACTTTATTG
 561 CTATATGGGAATTACATTTAAATTTGAGGGCATTTTATATAAAGAAAAATACAGACCTATAAAGTTTGGCATATTCATTA
 641 AGTTATCTTTTAATATTTTTTTCTAGAAAACAGGTGACATTTGTATCTACGATAAAAATTTTTATACAGAACCTACTGCC
 721 TCAAACTGAATCCCATCAAGAAAACTAGTTTCTATTGTATTAGTAACTCAAAATAAATTATCACTTCGAAAACTTGCTTT
 801 CCCACACTAAGGTAAGTTCAGACTAGATTGAACACTCCAGAATTTTTTACTACAGACTGTTTTTAAGTTAGAAGTGATGG
 881 CAATTTTATAAATAGAGAATATACTTCCACTGATGCCCTTACTGTGCCAAAACAAAAATCTTAAGAAAAGCAAGTAGACA
 961 CCTTCATAACTATGAATGAAGCTGCTGAAGTAGTGTTTAGGATCCTCCATGGCAGTTAGTGAATGTAAGAAGTACAGTGT
1041 TAAAGTGTTGTAAACAGTTACTCAGTGCAATGTATAGCCTGAGTCTATCCATGATGGCTATATCCAATTTGACATCACGT
1121 TATGGATCAGTACACAATGAAAAACCAAAGAACCACAGTATATCTTATTCTTAACTTTTGTAAACCATGTTTTATGGGTA
1201 ACTTTTTAGTTTTCCCAAAAGGCTGATAAATTTCAATATTTTGAATACATCATTGTTAATTTTGAGTTGGCAGAGGTAAA
1281 CTAACCAACTACCATTATGTTTTAGTACTAAGGGATATACCTTTCAATAAAGTTAATGAAATTCAAAAAAAAAAAAAAAA
1361 AA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGG--UAACAGUGUGAGGu 5'
             | ||:  ||||  ||||||| 
Target 5' ttcAGACTAGATTG-AACACTCCa 3'
817 - 839 152.00 -18.60
2
miRNA  3' guUUGUGGUAA------CAGUGUGAggu 5'
            ||::|:|||      ||||||||   
Target 5' aaAATGCTATTGGAGGAGTCACACTaat 3'
328 - 355 130.00 -13.22
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ::|| :||   ||||| || 
Target 5' taGGCAGTATAAACACACCCCa 3'
498 - 519 124.00 -15.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN22802298 478 COSMIC
COSN28186572 1091 COSMIC
COSN24404698 1130 COSMIC
COSN2083019 1138 COSMIC
COSN16641068 1279 COSMIC
COSN31579430 1324 COSMIC
COSN31551797 1410 COSMIC
COSN26636791 1439 COSMIC
COSN9931419 1446 COSMIC
COSN31608013 1675 COSMIC
COSN28067905 1768 COSMIC
COSN31528003 1893 COSMIC
COSN31566152 1894 COSMIC
COSN31601089 1914 COSMIC
COSN31566627 2144 COSMIC
COSN31483591 2217 COSMIC
COSN20983069 2379 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1159356788 5 dbSNP
rs1387345244 6 dbSNP
rs866178200 6 dbSNP
rs1017722573 16 dbSNP
rs146472121 17 dbSNP
rs767507276 17 dbSNP
rs1399175673 18 dbSNP
rs773896011 22 dbSNP
rs1230235527 23 dbSNP
rs759171679 25 dbSNP
rs373723183 26 dbSNP
rs1047210367 29 dbSNP
rs1301932098 30 dbSNP
rs1329996791 32 dbSNP
rs1398080415 34 dbSNP
rs752293307 36 dbSNP
rs1261987920 44 dbSNP
rs760459789 47 dbSNP
rs763817081 48 dbSNP
rs1447430671 50 dbSNP
rs1005794435 55 dbSNP
rs1347603243 66 dbSNP
rs982725811 76 dbSNP
rs1023882958 92 dbSNP
rs1419036550 93 dbSNP
rs1170361223 101 dbSNP
rs908427300 105 dbSNP
rs1266039160 106 dbSNP
rs941049572 116 dbSNP
rs1358451901 121 dbSNP
rs1488236843 131 dbSNP
rs1245043566 134 dbSNP
rs1399258038 139 dbSNP
rs2069356 144 dbSNP
rs1341162702 147 dbSNP
rs1216620774 152 dbSNP
rs926402084 155 dbSNP
rs1384015143 163 dbSNP
rs1001124539 166 dbSNP
rs1278836551 174 dbSNP
rs1218557308 182 dbSNP
rs1299341773 184 dbSNP
rs1294707594 195 dbSNP
rs1436790110 199 dbSNP
rs1035330048 209 dbSNP
rs959792189 210 dbSNP
rs988987869 211 dbSNP
rs1020101213 214 dbSNP
rs1426229038 216 dbSNP
rs145304923 218 dbSNP
rs1234317799 220 dbSNP
rs1258080082 221 dbSNP
rs968989904 221 dbSNP
rs1351971572 223 dbSNP
rs1216473848 225 dbSNP
rs978673065 241 dbSNP
rs532214629 247 dbSNP
rs17881803 249 dbSNP
rs1458966863 261 dbSNP
rs1251611520 264 dbSNP
rs1209339428 275 dbSNP
rs942600421 276 dbSNP
rs976726786 284 dbSNP
rs896645983 285 dbSNP
rs922622284 287 dbSNP
rs1219354238 288 dbSNP
rs761146067 288 dbSNP
rs1306714912 289 dbSNP
rs535525236 289 dbSNP
rs567143917 297 dbSNP
rs2069357 300 dbSNP
rs1466010350 302 dbSNP
rs1357885473 311 dbSNP
rs1266136151 312 dbSNP
rs116208158 316 dbSNP
rs1379748023 317 dbSNP
rs1017604697 321 dbSNP
rs1200565360 324 dbSNP
rs1378178614 326 dbSNP
rs1418895641 328 dbSNP
rs1199614304 330 dbSNP
rs900608430 331 dbSNP
rs1159122416 333 dbSNP
rs1211505530 343 dbSNP
rs1362352469 344 dbSNP
rs190782335 363 dbSNP
rs1352417692 364 dbSNP
rs1283190899 369 dbSNP
rs941488637 370 dbSNP
rs1456364748 372 dbSNP
rs1489294167 374 dbSNP
rs538099031 376 dbSNP
rs1308192878 384 dbSNP
rs1395862970 385 dbSNP
rs1045219252 391 dbSNP
rs1291848404 395 dbSNP
rs1305168749 398 dbSNP
rs1435817529 403 dbSNP
rs1359980635 416 dbSNP
rs772230207 425 dbSNP
rs1003767116 428 dbSNP
rs1387504480 443 dbSNP
rs556609351 448 dbSNP
rs955236967 452 dbSNP
rs577723192 456 dbSNP
rs1421907350 465 dbSNP
rs544953545 467 dbSNP
rs2069358 468 dbSNP
rs1260455658 469 dbSNP
rs1009978922 474 dbSNP
rs1375084887 479 dbSNP
rs962587890 483 dbSNP
rs1264536198 484 dbSNP
rs572767045 498 dbSNP
rs1310502509 506 dbSNP
rs1320302940 508 dbSNP
rs1319245711 511 dbSNP
rs540504264 512 dbSNP
rs1415970344 513 dbSNP
rs926287671 516 dbSNP
rs561882065 517 dbSNP
rs991932467 518 dbSNP
rs978556991 520 dbSNP
rs1018133415 521 dbSNP
rs1456530346 528 dbSNP
rs1369984045 530 dbSNP
rs980709155 532 dbSNP
rs1477470288 541 dbSNP
rs1235998676 549 dbSNP
rs917619881 550 dbSNP
rs1178985701 552 dbSNP
rs418358 556 dbSNP
rs386694408 560 dbSNP
rs62394890 561 dbSNP
rs426308 563 dbSNP
rs1317644499 570 dbSNP
rs2069359 572 dbSNP
rs1458495299 573 dbSNP
rs1328064402 578 dbSNP
rs1322897611 579 dbSNP
rs1398340093 581 dbSNP
rs1396905566 585 dbSNP
rs1326806679 600 dbSNP
rs867714446 601 dbSNP
rs11740842 602 dbSNP
rs963939741 603 dbSNP
rs1039094812 606 dbSNP
rs1332441422 608 dbSNP
rs2069360 609 dbSNP
rs1227037694 610 dbSNP
rs1312673777 611 dbSNP
rs551363419 612 dbSNP
rs2069361 616 dbSNP
rs982807560 617 dbSNP
rs1253283012 618 dbSNP
rs1197620586 626 dbSNP
rs527314867 628 dbSNP
rs941463033 630 dbSNP
rs1340628816 632 dbSNP
rs1239704963 636 dbSNP
rs1231225612 639 dbSNP
rs1482173200 639 dbSNP
rs1397850030 640 dbSNP
rs1412668956 640 dbSNP
rs1330589884 641 dbSNP
rs1045184856 642 dbSNP
rs1410483010 644 dbSNP
rs1401468522 647 dbSNP
rs766933142 652 dbSNP
rs2069362 664 dbSNP
rs1177641302 665 dbSNP
rs1414417880 672 dbSNP
rs939589405 673 dbSNP
rs299321 678 dbSNP
rs2069363 679 dbSNP
rs1010278567 680 dbSNP
rs1019955494 692 dbSNP
rs765176854 693 dbSNP
rs1171657579 696 dbSNP
rs999970429 702 dbSNP
rs375134030 703 dbSNP
rs1302679564 704 dbSNP
rs1033981986 705 dbSNP
rs1339649607 705 dbSNP
rs959074325 706 dbSNP
rs571378148 710 dbSNP
rs546294526 711 dbSNP
rs1157489285 713 dbSNP
rs998100616 714 dbSNP
rs992213949 720 dbSNP
rs1275697452 726 dbSNP
rs1316758708 727 dbSNP
rs565891313 729 dbSNP
rs1274709089 733 dbSNP
rs1310126337 735 dbSNP
rs1186049933 738 dbSNP
rs1209127460 742 dbSNP
rs1216042851 743 dbSNP
rs1237910619 745 dbSNP
rs1486604828 746 dbSNP
rs1224528224 747 dbSNP
rs1286689942 747 dbSNP
rs1297482222 747 dbSNP
rs1346454715 747 dbSNP
rs1355961285 747 dbSNP
rs1397640892 747 dbSNP
rs1416579391 747 dbSNP
rs35396845 747 dbSNP
rs1029956891 749 dbSNP
rs77154908 750 dbSNP
rs1477553923 751 dbSNP
rs966437354 755 dbSNP
rs1421882651 757 dbSNP
rs1163160927 758 dbSNP
rs1476376896 759 dbSNP
rs553883852 760 dbSNP
rs983161229 761 dbSNP
rs1193567198 762 dbSNP
rs369945382 764 dbSNP
rs1036406357 765 dbSNP
rs925440318 765 dbSNP
rs909904462 766 dbSNP
rs1287498573 768 dbSNP
rs1234960373 770 dbSNP
rs962748659 772 dbSNP
rs1437055215 773 dbSNP
rs919019217 774 dbSNP
rs980848296 775 dbSNP
rs1216713451 791 dbSNP
rs926784462 796 dbSNP
rs1288898498 797 dbSNP
rs1435329124 798 dbSNP
rs182432020 798 dbSNP
rs542697608 803 dbSNP
rs34378390 808 dbSNP
rs1347805302 818 dbSNP
rs939559596 821 dbSNP
rs1327462273 826 dbSNP
rs1463404994 827 dbSNP
rs1395652446 836 dbSNP
rs1056637495 838 dbSNP
rs1170609911 842 dbSNP
rs936941386 849 dbSNP
rs772982129 855 dbSNP
rs1400061410 859 dbSNP
rs1421781906 864 dbSNP
rs1187134997 870 dbSNP
rs1477728137 879 dbSNP
rs375228155 879 dbSNP
rs2069364 883 dbSNP
rs1215786953 889 dbSNP
rs1468796033 895 dbSNP
rs1365047597 902 dbSNP
rs922152775 912 dbSNP
rs2069365 921 dbSNP
rs144016678 923 dbSNP
rs1041752723 924 dbSNP
rs1305251610 924 dbSNP
rs567560390 928 dbSNP
rs1004918056 929 dbSNP
rs999939017 941 dbSNP
rs1395676495 953 dbSNP
rs1214306997 955 dbSNP
rs1460938778 959 dbSNP
rs1356843760 960 dbSNP
rs1036858345 970 dbSNP
rs1285248944 977 dbSNP
rs1039513267 981 dbSNP
rs1195751839 988 dbSNP
rs1454826496 989 dbSNP
rs1237362638 990 dbSNP
rs17881666 992 dbSNP
rs1193948677 998 dbSNP
rs1481473127 1000 dbSNP
rs1251884495 1005 dbSNP
rs1209317680 1006 dbSNP
rs533200121 1014 dbSNP
rs1345135295 1015 dbSNP
rs995263436 1025 dbSNP
rs997987658 1026 dbSNP
rs2069366 1027 dbSNP
rs1375634149 1030 dbSNP
rs758692122 1039 dbSNP
rs951352955 1041 dbSNP
rs1306602977 1044 dbSNP
rs1390069124 1050 dbSNP
rs1375979883 1052 dbSNP
rs1299304701 1056 dbSNP
rs1273558465 1065 dbSNP
rs2069367 1066 dbSNP
rs1211739643 1069 dbSNP
rs1373718669 1074 dbSNP
rs1266661507 1081 dbSNP
rs576642275 1083 dbSNP
rs1182538343 1087 dbSNP
rs1365641422 1088 dbSNP
rs1435389570 1092 dbSNP
rs1229234086 1094 dbSNP
rs1157186035 1109 dbSNP
rs1471707461 1109 dbSNP
rs1158774005 1110 dbSNP
rs1181212066 1119 dbSNP
rs1395635271 1128 dbSNP
rs760879982 1130 dbSNP
rs867994245 1131 dbSNP
rs962717622 1138 dbSNP
rs980817794 1139 dbSNP
rs1013284298 1142 dbSNP
rs1025044288 1143 dbSNP
rs1352295733 1147 dbSNP
rs1392511481 1150 dbSNP
rs926670034 1154 dbSNP
rs2069368 1156 dbSNP
rs548708771 1160 dbSNP
rs1333527361 1164 dbSNP
rs766545484 1165 dbSNP
rs992706892 1166 dbSNP
rs1336654028 1167 dbSNP
rs1231161046 1173 dbSNP
rs1319123414 1175 dbSNP
rs751747655 1178 dbSNP
rs1437839527 1181 dbSNP
rs1480897631 1182 dbSNP
rs1197510445 1184 dbSNP
rs1235371464 1185 dbSNP
rs914091666 1186 dbSNP
rs766343551 1188 dbSNP
rs191618240 1198 dbSNP
rs1359963149 1203 dbSNP
rs1287347396 1216 dbSNP
rs565093529 1217 dbSNP
rs925608643 1231 dbSNP
rs1474090876 1236 dbSNP
rs935614299 1243 dbSNP
rs1032061398 1250 dbSNP
rs958210827 1251 dbSNP
rs1258990311 1254 dbSNP
rs1206535614 1260 dbSNP
rs1039397240 1261 dbSNP
rs550314620 1263 dbSNP
rs1485969950 1264 dbSNP
rs1261707219 1265 dbSNP
rs571492146 1269 dbSNP
rs899555959 1273 dbSNP
rs997966972 1283 dbSNP
rs1237660922 1285 dbSNP
rs538874609 1289 dbSNP
rs1295712359 1310 dbSNP
rs751080292 1321 dbSNP
rs1354317569 1329 dbSNP
rs547476702 1336 dbSNP
rs987526549 1341 dbSNP
rs1004527203 1345 dbSNP
rs746775628 1358 dbSNP
rs1384157969 1361 dbSNP
rs759039482 1364 dbSNP
rs940659906 1369 dbSNP
rs1459742185 1370 dbSNP
rs1037754610 1379 dbSNP
rs1165583424 1379 dbSNP
rs1477418165 1383 dbSNP
rs1194640585 1385 dbSNP
rs898419201 1386 dbSNP
rs1002125349 1388 dbSNP
rs1253847014 1394 dbSNP
rs767105467 1405 dbSNP
rs1211419178 1406 dbSNP
rs960754561 1410 dbSNP
rs2069369 1415 dbSNP
rs931164033 1418 dbSNP
rs1055356076 1422 dbSNP
rs1250103173 1424 dbSNP
rs1229756775 1429 dbSNP
rs1455781755 1439 dbSNP
rs1303027257 1442 dbSNP
rs1438909957 1443 dbSNP
rs1177156176 1444 dbSNP
rs1326292771 1449 dbSNP
rs1465063467 1462 dbSNP
rs992278729 1463 dbSNP
rs1169570764 1465 dbSNP
rs1462113827 1476 dbSNP
rs766423181 1486 dbSNP
rs1191378404 1488 dbSNP
rs754546531 1493 dbSNP
rs1455268834 1496 dbSNP
rs895087859 1498 dbSNP
rs1194698907 1511 dbSNP
rs1013918775 1525 dbSNP
rs1380137808 1529 dbSNP
rs1470766309 1530 dbSNP
rs1340156756 1539 dbSNP
rs1279622793 1547 dbSNP
rs1160805626 1568 dbSNP
rs1232395466 1571 dbSNP
rs1231832067 1572 dbSNP
rs565847062 1586 dbSNP
rs1021533521 1593 dbSNP
rs1410937208 1599 dbSNP
rs1404266020 1600 dbSNP
rs1441290137 1612 dbSNP
rs2291790 1615 dbSNP
rs980013359 1628 dbSNP
rs1391842333 1639 dbSNP
rs149348306 1640 dbSNP
rs943617302 1662 dbSNP
rs1032106676 1681 dbSNP
rs1444205555 1682 dbSNP
rs1330405788 1688 dbSNP
rs1470005955 1694 dbSNP
rs1377377682 1701 dbSNP
rs1231467619 1706 dbSNP
rs1184616423 1711 dbSNP
rs1438847834 1719 dbSNP
rs756560845 1723 dbSNP
rs957761278 1725 dbSNP
rs1486679435 1726 dbSNP
rs371481198 1732 dbSNP
rs1348295575 1734 dbSNP
rs1282380664 1735 dbSNP
rs376581128 1735 dbSNP
rs1355619120 1737 dbSNP
rs574467199 1743 dbSNP
rs1239722671 1745 dbSNP
rs1273968273 1750 dbSNP
rs1354788431 1750 dbSNP
rs1029570505 1752 dbSNP
rs17883523 1753 dbSNP
rs1237886526 1760 dbSNP
rs1317201429 1761 dbSNP
rs1438783709 1765 dbSNP
rs1050896730 1768 dbSNP
rs1406265449 1772 dbSNP
rs1160613571 1780 dbSNP
rs955015812 1782 dbSNP
rs1236203713 1783 dbSNP
rs1417831781 1784 dbSNP
rs988134922 1796 dbSNP
rs754246739 1797 dbSNP
rs1165003747 1803 dbSNP
rs908093092 1810 dbSNP
rs1419462170 1817 dbSNP
rs537736408 1826 dbSNP
rs886937533 1828 dbSNP
rs757742297 1830 dbSNP
rs973349574 1841 dbSNP
rs1286572652 1844 dbSNP
rs1205552345 1847 dbSNP
rs1463681303 1851 dbSNP
rs1169520265 1852 dbSNP
rs1333871794 1858 dbSNP
rs939829571 1858 dbSNP
rs1396884561 1862 dbSNP
rs920709878 1873 dbSNP
rs1392898381 1881 dbSNP
rs1355555181 1885 dbSNP
rs1269028025 1889 dbSNP
rs188233605 1893 dbSNP
rs898388260 1894 dbSNP
rs1055005899 1912 dbSNP
rs894964538 1913 dbSNP
rs193188036 1918 dbSNP
rs545261408 1921 dbSNP
rs1163422646 1934 dbSNP
rs1476447043 1940 dbSNP
rs1414667875 1946 dbSNP
rs949214090 1948 dbSNP
rs1046747597 1954 dbSNP
rs1244114500 1954 dbSNP
rs1033622254 1956 dbSNP
rs1194163447 1958 dbSNP
rs1467872115 1965 dbSNP
rs902401376 1965 dbSNP
rs1215507751 1978 dbSNP
rs1335347959 1982 dbSNP
rs1315292227 1996 dbSNP
rs185471595 2002 dbSNP
rs1272162753 2007 dbSNP
rs1293927504 2008 dbSNP
rs1337049848 2010 dbSNP
rs1270419245 2021 dbSNP
rs1370751057 2033 dbSNP
rs999220016 2033 dbSNP
rs1216990011 2048 dbSNP
rs896519936 2052 dbSNP
rs1170345176 2053 dbSNP
rs1014085108 2056 dbSNP
rs1189470073 2062 dbSNP
rs1197888481 2067 dbSNP
rs1277031750 2068 dbSNP
rs1442336689 2080 dbSNP
rs1189283718 2082 dbSNP
rs1020999567 2083 dbSNP
rs967204973 2086 dbSNP
rs369896651 2091 dbSNP
rs571921717 2092 dbSNP
rs1028705124 2096 dbSNP
rs1202346757 2110 dbSNP
rs1308766644 2113 dbSNP
rs955046302 2114 dbSNP
rs1233154189 2116 dbSNP
rs560246257 2121 dbSNP
rs1015145022 2123 dbSNP
rs962258420 2127 dbSNP
rs1298109171 2131 dbSNP
rs1368743076 2131 dbSNP
rs1440571257 2150 dbSNP
rs17883275 2154 dbSNP
rs1356375356 2165 dbSNP
rs1463262977 2169 dbSNP
rs1434148884 2173 dbSNP
rs973401967 2174 dbSNP
rs1175739515 2178 dbSNP
rs779450810 2189 dbSNP
rs572046790 2193 dbSNP
rs12657994 2197 dbSNP
rs1406907166 2201 dbSNP
rs1401255218 2207 dbSNP
rs958852779 2217 dbSNP
rs975023210 2222 dbSNP
rs920921860 2224 dbSNP
rs190798116 2225 dbSNP
rs986873915 2228 dbSNP
rs1282101142 2235 dbSNP
rs112172238 2241 dbSNP
rs1313164838 2243 dbSNP
rs923877142 2249 dbSNP
rs1398201802 2259 dbSNP
rs908250717 2260 dbSNP
rs1376214439 2263 dbSNP
rs192535026 2271 dbSNP
rs1373701189 2275 dbSNP
rs756949850 2277 dbSNP
rs1315006621 2284 dbSNP
rs1804633 2290 dbSNP
rs1053481657 2306 dbSNP
rs1327240177 2312 dbSNP
rs565278287 2315 dbSNP
rs1229964311 2327 dbSNP
rs1038144142 2334 dbSNP
rs1420635880 2341 dbSNP
rs893481582 2347 dbSNP
rs898357254 2355 dbSNP
rs1254571653 2358 dbSNP
rs532529210 2359 dbSNP
rs534968287 2375 dbSNP
rs547589899 2381 dbSNP
rs1258934994 2382 dbSNP
rs1200697051 2384 dbSNP
rs1050616118 2391 dbSNP
rs1055006009 2416 dbSNP
rs1212171520 2419 dbSNP
rs896397036 2420 dbSNP
rs1214151788 2436 dbSNP
rs1013554593 2452 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEP3B , SNU449
Location of target site 3'UTR
Tools used in this research TargetScan , PicTar
Original Description (Extracted from the article) ... cyclin G1 is a target of miR-122a and expand our knowledge of the molecular alterations involved in HCC pathogenesis and of the role of miRNAs in human cancer. ...

- Gramantieri L; Ferracin M; Fornari F; et al., 2007, Cancer research.

Article - Gramantieri L; Ferracin M; Fornari F; et al.
- Cancer research, 2007
We investigated the role of microRNAs (miRNAs) in the pathogenesis of human hepatocellular carcinoma (HCC). A genome-wide miRNA microarray was used to identify differentially expressed miRNAs in HCCs arisen on cirrhotic livers. Thirty-five miRNAs were identified. Several of these miRNAs were previously found deregulated in other human cancers, such as members of the let-7 family, mir-221, and mir-145. In addition, the hepato-specific miR-122a was found down-regulated in approximately 70% of HCCs and in all HCC-derived cell lines. Microarray data for let-7a, mir-221, and mir-122a were validated by Northern blot and real-time PCR analysis. Understanding the contribution of deregulated miRNAs to cancer requires the identification of gene targets. Here, we show that miR-122a can modulate cyclin G1 expression in HCC-derived cell lines and an inverse correlation between miR-122a and cyclin G1 expression exists in primary liver carcinomas. These results indicate that cyclin G1 is a target of miR-122a and expand our knowledge of the molecular alterations involved in HCC pathogenesis and of the role of miRNAs in human cancer.
LinkOut: [PMID: 17616664]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Lin CJ; Gong HY; Tseng HC; Wang WL; Wu JL
- Biochemical and biophysical research communications, 2008
miR-122, a hepato-specific microRNA (miRNA), is frequently down-regulated in human hepatocellular carcinoma (HCC). In an effort to identify novel miR-122 targets, we performed an in silico analysis and detected a putative binding site in the 3'-untranslated region (3'-UTR) of Bcl-w, an anti-apoptotic Bcl-2 family member. In the HCC-derived cell lines, Hep3B and HepG2, we confirmed that miR-122 modulates Bcl-w expression by directly targeting binding site within the 3'-UTR. The cellular mRNA and protein levels of Bcl-w were repressed by elevated levels of miR-122, which subsequently led to reduction of cell viability and activation of caspase-3. Thus, Bcl-w is a direct target of miR-122 that functions as an endogenous apoptosis regulator in these HCC-derived cell lines.
LinkOut: [PMID: 18692484]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Hep G2 , Huh7
Original Description (Extracted from the article) ... By WB analysis, miR-122–overexpressing HepG2 cells showed a decreased cyclin G1 expression, accompanied by an increase of p53 protein (Fig. 2A). Conversely, anti–miR-122 transfected Huh-7 cells showed an increase in cyclin G1 expression (Fig. 2B). ...

- Fornari F; Gramantieri L; Giovannini C; et al., 2009, Cancer research.

Article - Fornari F; Gramantieri L; Giovannini C; et al.
- Cancer research, 2009
The identification of target genes is a key step for assessing the role of aberrantly expressed microRNAs (miRNA) in human cancer and for the further development of miRNA-based gene therapy. MiR-122 is a liver-specific miRNA accounting for 70% of the total miRNA population. Its down-regulation is a common feature of both human and mouse hepatocellular carcinoma (HCC). We have previously shown that miR-122 can regulate the expression of cyclin G1, whose high levels have been reported in several human cancers. We evaluated the role of miR-122 and cyclin G1 expression in hepatocarcinogenesis and in response to treatment with doxorubicin and their relevance on survival and time to recurrence (TTR) of HCC patients. We proved that, by modulating cyclin G1, miR-122 influences p53 protein stability and transcriptional activity and reduces invasion capability of HCC-derived cell lines. In addition, in a therapeutic perspective, we assayed the effects of a restored miR-122 expression in triggering doxorubicin-induced apoptosis and we proved that miR-122, as well as cyclin G1 silencing, increases sensitivity to doxorubicin challenge. In patients resected for HCC, lower miR-122 levels were associated with a shorter TTR, whereas higher cyclin G1 expression was related to a lower survival, suggesting that miR-122 might represent an effective molecular target for HCC. Our findings establish a basis toward the development of combined chemo- and miRNA-based therapy for HCC treatment.
LinkOut: [PMID: 19584283]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions J6/JFH , Huh-7.5
Original Description (Extracted from the article) ... EtOH Inhibits Cyclin G1 Via miR-122 ...

- Hou W; Bukong TN; Kodys K; Szabo G, 2013, Alcoholism, clinical and experimental research.

Article - Hou W; Bukong TN; Kodys K; Szabo G
- Alcoholism, clinical and experimental research, 2013
BACKGROUND: Clinical studies demonstrate synergistic liver damage by alcohol and hepatitis C virus (HCV); however, the mechanisms by which alcohol promotes HCV infection remain obscure. The liver-specific microRNA-122 (miR-122) regulates HCV replication and expression of host genes, including Cyclin G1. Here, we hypothesized that alcohol regulates miR-122 expression and thereby modulates HCV RNA replication. METHODS: The J6/JFH/Huh-7.5 model of HCV infection was used in this study. Real-time quantitative polymerase chain reaction, Western blotting, electrophoretic mobility shift assay, and confocal microscopy were used for experimental analysis. RESULTS: We found that acute alcohol exposure (25 mM) significantly increased intracellular HCV RNA as well as miR-122 levels in Huh-7.5 and Huh-7.5/CYP2E1 expressing cells in the presence and absence of J6/JFH-HCV infection. Expression of the miR-122 target, Cyclin G1, was inhibited by alcohol both in J6/JFH-infected and uninfected Huh-7.5 cells. The use of a miR-122 inhibitor increased Cyclin G1 expression and prevented the alcohol-induced increase in HCV RNA and protein levels, suggesting a mechanistic role for alcohol-induced miR122 in HCV replication. We discovered that siRNA-mediated silencing of Cyclin G1 significantly increased intracellular HCV RNA levels compared with controls, suggesting a mechanistic role for Cyclin G1 in HCV replication. Alcohol-induced increase in miR-122 was associated with increased nuclear translocation and DNA binding of the nuclear regulatory factor-kappaB and could be prevented by NF-kappaB inhibition. CONCLUSIONS: Our novel data indicate a miR-122-mediated mechanism for alcohol increasing HCV RNA replication. We show for the first time that Cyclin G1, a miR-122 target gene, has regulatory effects on HCV replication and that alcohol increases HCV replication by regulating miR-122 and Cyclin G1.
LinkOut: [PMID: 23126531]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*