>CCNE1|NM_001238|3'UTR
   1 CCACCCCATCCTTCTCCACCAAAGACAGTTGCGCGCCTGCTCCACGTTCTCTTCTGTCTGTTGCAGCGGAGGCGTGCGTT
  81 TGCTTTTACAGATATCTGAATGGAAGAGTGTTTCTTCCACAACAGAAGTATTTCTGTGGATGGCATCAAACAGGGCAAAG
 161 TGTTTTTTATTGAATGCTTATAGGTTTTTTTTAAATAAGTGGGTCAAGTACACCAGCCACCTCCAGACACCAGTGCGTGC
 241 TCCCGATGCTGCTATGGAAGGTGCTACTTGACCTAAGGGACTCCCACAACAACAAAAGCTTGAAGCTGTGGAGGGCCACG
 321 GTGGCGTGGCTCTCCTCGCAGGTGTTCTGGGCTCCGTTGTACCAAGTGGAGCAGGTGGTTGCGGGCAAGCGTTGTGCAGA
 401 GCCCATAGCCAGCTGGGCAGGGGGCTGCCCTCTCCACATTATCAGTTGACAGTGTACAATGCCTTTGATGAACTGTTTTG
 481 TAAGTGCTGCTATATCTATCCATTTTTTAATAAAGATAATACTGTTTTTGAGACAGCTGGAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' guGUUUGGUA----AUACACGACGAu 5' ::|||::| || |||||||| Target 5' gaTGAACTGTTTTGTAAGTGCTGCTa 3'	467 - 492	162.00	-14.70
2	miRNA 3' gugUUUGGUAA--UAC-------ACGACGAu 5' | |||| | :|| ||||||| Target 5' cagACACCAGTGCGTGCTCCCGATGCTGCTa 3'	224 - 254	145.00	-15.40
3	miRNA 3' guguuuGGUAAUAC--ACGACGau 5' |: || || ||:||| Target 5' cacgttCTCTTCTGTCTGTTGCag 3'	43 - 66	114.00	-11.60

Mutant ID	Mutant Position	Mutant Source
COSN30480490	8	COSMIC
COSN30457465	12	COSMIC
COSN24396057	34	COSMIC
COSN24400322	36	COSMIC
COSN30498150	37	COSMIC
COSN30143164	46	COSMIC
COSN30499882	47	COSMIC
COSN30102280	55	COSMIC
COSN13796013	68	COSMIC
COSN30514505	75	COSMIC
COSN30187906	76	COSMIC
COSN20046611	78	COSMIC
COSN31514875	79	COSMIC
COSN31587757	135	COSMIC
COSN8605557	144	COSMIC
COSN31526675	157	COSMIC
COSN31532566	193	COSMIC
COSN31562027	200	COSMIC
COSN31570069	383	COSMIC
COSN31528433	451	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs778967626	4	dbSNP
rs748164154	7	dbSNP
rs1306982894	11	dbSNP
rs1348426165	14	dbSNP
rs1437595879	14	dbSNP
rs371960938	18	dbSNP
rs1307699658	20	dbSNP
rs772121723	22	dbSNP
rs1423303439	24	dbSNP
rs1182857220	32	dbSNP
rs1230899340	33	dbSNP
rs773487372	34	dbSNP
rs368525829	35	dbSNP
rs771378452	36	dbSNP
rs1251328261	40	dbSNP
rs776814675	41	dbSNP
rs760124807	46	dbSNP
rs1409433079	47	dbSNP
rs765772570	52	dbSNP
rs1317543699	63	dbSNP
rs1271996385	65	dbSNP
rs1283302737	68	dbSNP
rs878995611	69	dbSNP
rs977000598	71	dbSNP
rs1282300744	74	dbSNP
rs530453430	75	dbSNP
rs202195306	78	dbSNP
rs932866935	79	dbSNP
rs1043236848	84	dbSNP
rs1463717760	89	dbSNP
rs1353606557	93	dbSNP
rs570331880	96	dbSNP
rs1407497130	102	dbSNP
rs1412091075	105	dbSNP
rs1181716294	118	dbSNP
rs561079816	122	dbSNP
rs1240046158	135	dbSNP
rs1486087005	136	dbSNP
rs189158036	137	dbSNP
rs1051213653	140	dbSNP
rs546729018	141	dbSNP
rs566562252	145	dbSNP
rs889857228	148	dbSNP
rs934463761	167	dbSNP
rs1052846561	170	dbSNP
rs1425955828	177	dbSNP
rs777389026	182	dbSNP
rs1444028494	184	dbSNP
rs1372144185	185	dbSNP
rs1293692227	193	dbSNP
rs1013907834	195	dbSNP
rs1438170629	204	dbSNP
rs142360338	207	dbSNP
rs750689376	212	dbSNP
rs1044064016	216	dbSNP
rs1174190895	219	dbSNP
rs1420818820	229	dbSNP
rs1382743347	232	dbSNP
rs1156925520	235	dbSNP
rs552526974	237	dbSNP
rs1454660662	238	dbSNP
rs1300362939	241	dbSNP
rs994053033	243	dbSNP
rs770491148	245	dbSNP
rs368989147	246	dbSNP
rs1487641622	247	dbSNP
rs1303298354	250	dbSNP
rs1221526173	253	dbSNP
rs773867144	255	dbSNP
rs745388220	256	dbSNP
rs533007909	258	dbSNP
rs896175805	267	dbSNP
rs1013655139	268	dbSNP
rs965374463	274	dbSNP
rs1023417465	276	dbSNP
rs118142197	286	dbSNP
rs1242071817	294	dbSNP
rs1453718303	300	dbSNP
rs1002014698	308	dbSNP
rs1269783145	309	dbSNP
rs181971575	317	dbSNP
rs112118851	320	dbSNP
rs1223096659	321	dbSNP
rs73925742	326	dbSNP
rs1198409859	327	dbSNP
rs1477994329	330	dbSNP
rs1265062420	332	dbSNP
rs3218073	333	dbSNP
rs1485513603	335	dbSNP
rs1382075551	338	dbSNP
rs760544447	339	dbSNP
rs987200809	343	dbSNP
rs1440488320	347	dbSNP
rs1160880902	354	dbSNP
rs1052877786	356	dbSNP
rs186190859	357	dbSNP
rs911352459	360	dbSNP
rs1352087272	370	dbSNP
rs1403592793	370	dbSNP
rs1455941554	371	dbSNP
rs949755495	376	dbSNP
rs1044093704	383	dbSNP
rs577392030	384	dbSNP
rs748153237	385	dbSNP
rs145951198	392	dbSNP
rs1405461309	399	dbSNP
rs1171573418	405	dbSNP
rs796304226	407	dbSNP
rs1467407719	410	dbSNP
rs562877398	424	dbSNP
rs1406	429	dbSNP
rs543852265	430	dbSNP
rs865984037	431	dbSNP
rs1375849036	432	dbSNP
rs1459543689	437	dbSNP
rs190557131	445	dbSNP
rs778737557	447	dbSNP
rs776582571	451	dbSNP
rs1018711306	467	dbSNP
rs529759974	479	dbSNP
rs965441073	481	dbSNP
rs1457802599	487	dbSNP
rs1256528382	490	dbSNP
rs1341584116	493	dbSNP
rs3218074	493	dbSNP
rs1028363177	499	dbSNP
rs1315377686	502	dbSNP
rs1394808508	509	dbSNP
rs181434503	517	dbSNP
rs1332150725	520	dbSNP
rs979063781	521	dbSNP
rs186353947	523	dbSNP
rs777341273	525	dbSNP
rs1165935653	533	dbSNP

- Cancer research, 2009

Protein kinase Calpha (PKCalpha) has been implicated in cancer, but the mechanism is largely unknown. Here, we show that PKCalpha promotes head and neck squamous cell carcinoma (SCCHN) by a feed-forward network leading to cell cycle deregulation. PKCalpha inhibitors decrease proliferation in SCCHN cell lines and xenografted tumors. PKCalpha inhibition or depletion in tumor cells decreases DNA synthesis by suppressing extracellular signal-regulated kinase phosphorylation and cyclin E synthesis. Additionally, PKCalpha down-regulates miR-15a, a microRNA that directly inhibits protein synthesis of cyclin E, as well as other cell cycle regulators. Furthermore, both PKCalpha and cyclin E protein expression are increased in primary tumors, and PKCalpha inversely correlates with miR-15a expression in primary tumors. Finally, PKCalpha is associated with poor prognosis in SCCHN. These results identify PKCalpha as a key regulator of SCCHN tumor cell growth by a mechanism involving activation of mitogen-activated protein kinase, an initiator of the cell cycle, and suppression of miR-15a, an inhibitor of DNA synthesis. Although the specific components may be different, this type of feed-forward loop network, consisting of a stimulus that activates a positive signal and removes a negative brake, is likely to be a general one that enables induction of DNA synthesis by a variety of growth or oncogenic stimuli.

- Cancer research, 2009

MicroRNAs (miRNA) are negative regulators of gene expression at the posttranscriptional level, which are involved in tumorigenesis. Two miRNAs, miR-15a and miR-16, which are located at chromosome 13q14, have been implicated in cell cycle control and apoptosis, but little information is available about their role in solid tumors. To address this question, we established a protocol to quantify miRNAs from laser capture microdissected tissues. Here, we show that miR-15a/miR-16 are frequently deleted or down-regulated in squamous cell carcinomas and adenocarcinomas of the lung. In these tumors, expression of miR-15a/miR-16 inversely correlates with the expression of cyclin D1. In non-small cell lung cancer (NSCLC) cell lines, cyclins D1, D2, and E1 are directly regulated by physiologic concentrations of miR-15a/miR-16. Consistent with these results, overexpression of these miRNAs induces cell cycle arrest in G(1)-G(0). Interestingly, H2009 cells lacking Rb are resistant to miR-15a/miR-16-induced cell cycle arrest, whereas reintroduction of functional Rb resensitizes these cells to miRNA activity. In contrast, down-regulation of Rb in A549 cells by RNA interference confers resistance to these miRNAs. Thus, cell cycle arrest induced by these miRNAs depends on the expression of Rb, confirming that G(1) cyclins are major targets of miR-15a/miR-16 in NSCLC. Our results indicate that miR-15a/miR-16 are implicated in cell cycle control and likely contribute to the tumorigenesis of NSCLC.

- Experimental cell research, 2009

The microRNAs miR-15a and miR-16-1 are downregulated in multiple tumor types and are frequently deleted in chronic lymphocytic leukemia (CLL), myeloma and mantle cell lymphoma. Despite their abundance in most cells the transcriptional regulation of miR-15a/16-1 remains unclear. Here we demonstrate that the putative tumor suppressor DLEU2 acts as a host gene of these microRNAs. Mature miR-15a/miR-16-1 are produced in a Drosha-dependent process from DLEU2 and binding of the Myc oncoprotein to two alterative DLEU2 promoters represses both the host gene transcript and levels of mature miR-15a/miR-16-1. In line with a functional role for DLEU2 in the expression of the microRNAs, the miR-15a/miR-16-1 locus is retained in four CLL cases that delete both promoters of this gene and expression analysis indicates that this leads to functional loss of mature miR-15a/16-1. We additionally show that DLEU2 negatively regulates the G1 Cyclins E1 and D1 through miR-15a/miR-16-1 and provide evidence that these oncoproteins are subject to miR-15a/miR-16-1-mediated repression under normal conditions. We also demonstrate that DLEU2 overexpression blocks cellular proliferation and inhibits the colony-forming ability of tumor cell lines in a miR-15a/miR-16-1-dependent way. Together the data illuminate how inactivation of DLEU2 promotes cell proliferation and tumor progression through functional loss of miR-15a/miR-16-1.

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Current cancer drug targets, 2011

Hypermethylation of the Wnt inhibitory factor-1 (WIF-1) promoter has been implicated in the overactivation of the Wnt pathway in human lung cancer. Curcuminoids exert anti-cancer effects and have been reported to act as hypomethylating agents. Previously, we have investigated and compared the demethylation effects of three curcuminoids and observed that bisdemethoxycurcumin exhibited the strongest demethylation potency. In this study, we used lung cancer cell lines with WIF-1 promoter hypermethylated as a model to study the demethylating effect of bisdemethoxycurcumin on WIF-1 restoration, Wnt signaling activity and cell death. Bisdemethoxycurcumin directly suppressed the activity of DNA methyltransferase-1 (DNMT1) but did not influence DNMT1 expression. In addition, it induced WIF-1 promoter demethylation and protein re-expression. WIF-1 restoration in lung cancer cells down-regulated nuclear beta-catenin and the canonical Wnt cascade. Furthermore, we also showed that down-regulation of Wnt signaling by WIF-1 was required for bisdemethoxycurcumin-induced apoptosis in certain lung cancer cell types. This report is the first to show that bisdemethoxycurcumin induces apoptosis by reactivating WIF-1 from a silenced state. Our results provide new insights into the anti-cancer actions of bisdemethoxycurcumin.

- The EMBO journal, 2012

Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.

- International journal of oncology, 2013

MicroRNAs (miRNAs) are a small class of non-coding RNAs that are widely dysregulated in various cancers. They act as either oncogenes or tumor suppressor genes in human cancer. The purpose of this study was to examine the expression levels of miR-15a in human breast cancer and its potential role in disease pathogenesis. The expression levels of miR-15a were measured by quantitative polymerase chain reaction (qPCR) in 40 breast cancer specimens and adjacent normal breast tissues. MTT assays, colony formation assays, transwell chamber migration assays, cell cycle and apoptosis assays were used to explore the potential function of miR-15a in MDA-MB-231 human breast cancer cells. Luciferase reporter assays were performed to validate the regulation of a putative target of miR-15a, in corroboration with qPCR and western blot assays. We found that the expression of miR-15a was lower in breast cancer specimens compared with adjacent normal tissues (p<0.05). Overexpression of miR-15a inhibited cellular growth, suppressed migration and arrested cells at the G1 phase, but did not promote cellular apoptosis. Luciferase assays indicated that miR-15a can bind with its putative target site in the 3'-untranslated region (3'-UTR) of CCNE1, suggesting that CCNE1 is a direct target of miR-15a. qPCR and western blot analysis indicated that the overexpression of miR-15a results in the downregulation of CCNE1 at the mRNA and protein levels. Taken together, the upregulation of miR-15a expression causes cellular growth inhibition, suppression of migration and G1 phase arrest by targeting CCNE1. These findings suggest that miR-15a may act as a tumor suppressor gene in breast cancer and that, in the future, it could be used as a therapeutic target for the treatment of breast cancer.

- Oncotarget, 2015

About 50-70% of breast cancers are estrogen receptor alpha (ERalpha) positive and most of them are sensitive to endocrine therapy including tamoxifen. However, one third of these patients will eventually develop resistance and relapse. We found that the expression of miR-15a and miR-16 were significantly decreased in tamoxifen resistant ER positive breast cancer cell lines. Exogenous expression of miR-15a/16 mimics re-sensitized resistant cells to tamoxifen by inhibiting Cyclin E1 and B cell lymphoma-2 (Bcl-2) to induce cell growth arrest and apoptosis respectively. Further, we identified that a repressive member of E2F family, E2F7, was responsible for the suppression of miR-15a/16 cluster by competing with E2F1 for E2F binding site at the promoter of their host gene DLEU2. Moreover, high expression of E2F7 is correlated with high risk of relapse and poor prognosis in breast cancer patients receiving tamoxifen treatment. Together, our results suggest that overexpression of E2F7 represses miR-15a/16 and then increases Cyclin E1 and Bcl-2 that result in tamoxifen resistance. E2F7 may be a valuable prognostic marker and a therapeutic target of tamoxifen resistance in breast cancer.