miRTarBase - #MIRT001227
-
| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-15a |
| Genomic Coordinates | chr13: 50049119 - 50049201 |
| Synonyms | MIRN15A, hsa-mir-15a, miRNA15A, MIR15A |
| Description | Homo sapiens miR-15a stem-loop |
| Comment | Reference . |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |
|---|---|
| Mature miRNA | hsa-miR-15a-5p |
| Sequence | 14| UAGCAGCACAUAAUGGUUUGUG |35 |
| Evidence | Experimental |
| Experiments | Cloned |
| SNPs in miRNA | |
| Putative Targets | |
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | Circulating MicroRNA Expression Profiling |
|---|
| Gene Information | |
|---|---|
| Gene Symbol | CCND1 |
| Synonyms | BCL1, D11S287E, PRAD1, U21B31 |
| Description | cyclin D1 |
| Transcript | NM_053056 |
| Expression | |
| Putative miRNA Targets on CCND1 | |
| 3'UTR of CCND1 (miRNA target sites are highlighted) |
>CCND1|NM_053056|3'UTR 1 GGGCGCCAGGCAGGCGGGCGCCACCGCCACCCGCAGCGAGGGCGGAGCCGGCCCCAGGTGCTCCCCTGACAGTCCCTCCT 81 CTCCGGAGCATTTTGATACCAGAAGGGAAAGCTTCATTCTCCTTGTTGTTGGTTGTTTTTTCCTTTGCTCTTTCCCCCTT 161 CCATCTCTGACTTAAGCAAAAGAAAAAGATTACCCAAAAACTGTCTTTAAAAGAGAGAGAGAGAAAAAAAAAATAGTATT 241 TGCATAACCCTGAGCGGTGGGGGAGGAGGGTTGTGCTACAGATGATAGAGGATTTTATACCCCAATAATCAACTCGTTTT 321 TATATTAATGTACTTGTTTCTCTGTTGTAAGAATAGGCATTAACACAAAGGAGGCGTCTCGGGAGAGGATTAGGTTCCAT 401 CCTTTACGTGTTTAAAAAAAAGCATAAAAACATTTTAAAAACATAGAAAAATTCAGCAAACCATTTTTAAAGTAGAAGAG 481 GGTTTTAGGTAGAAAAACATATTCTTGTGCTTTTCCTGATAAAGCACAGCTGTAGTGGGGTTCTAGGCATCTCTGTACTT 561 TGCTTGCTCATATGCATGTAGTCACTTTATAAGTCATTGTATGTTATTATATTCCGTAGGTAGATGTGTAACCTCTTCAC 641 CTTATTCATGGCTGAAGTCACCTCTTGGTTACAGTAGCGTAGCGTGCCCGTGTGCATGTCCTTTGCGCCTGTGACCACCA 721 CCCCAACAAACCATCCAGTGACAAACCATCCAGTGGAGGTTTGTCGGGCACCAGCCAGCGTAGCAGGGTCGGGAAAGGCC 801 ACCTGTCCCACTCCTACGATACGCTACTATAAAGAGAAGACGAAATAGTGACATAATATATTCTATTTTTATACTCTTCC 881 TATTTTTGTAGTGACCTGTTTATGAGATGCTGGTTTTCTACCCAACGGCCCTGCAGCCAGCTCACGTCCAGGTTCAACCC 961 ACAGCTACTTGGTTTGTGTTCTTCTTCATATTCTAAAACCATTCCATTTCCAAGCACTTTCAGTCCAATAGGTGTAGGAA 1041 ATAGCGCTGTTTTTGTTGTGTGTGCAGGGAGGGCAGTTTTCTAATGGAATGGTTTGGGAATATCCATGTACTTGTTTGCA 1121 AGCAGGACTTTGAGGCAAGTGTGGGCCACTGTGGTGGCAGTGGAGGTGGGGTGTTTGGGAGGCTGCGTGCCAGTCAAGAA 1201 GAAAAAGGTTTGCATTCTCACATTGCCAGGATGATAAGTTCCTTTCCTTTTCTTTAAAGAAGTTGAAGTTTAGGAATCCT 1281 TTGGTGCCAACTGGTGTTTGAAAGTAGGGACCTCAGAGGTTTACCTAGAGAACAGGTGGTTTTTAAGGGTTATCTTAGAT 1361 GTTTCACACCGGAAGGTTTTTAAACACTAAAATATATAATTTATAGTTAAGGCTAAAAAGTATATTTATTGCAGAGGATG 1441 TTCATAAGGCCAGTATGATTTATAAATGCAATCTCCCCTTGATTTAAACACACAGATACACACACACACACACACACACA 1521 CAAACCTTCTGCCTTTGATGTTACAGATTTAATACAGTTTATTTTTAAAGATAGATCCTTTTATAGGTGAGAAAAAAACA 1601 ATCTGGAAGAAAAAAACCACACAAAGACATTGATTCAGCCTGTTTGGCGTTTCCCAGAGTCATCTGATTGGACAGGCATG 1681 GGTGCAAGGAAAATTAGGGTACTCAACCTAAGTTCGGTTCCGATGAATTCTTATCCCCTGCCCCTTCCTTTAAAAAACTT 1761 AGTGACAAAATAGACAATTTGCACATCTTGGCTATGTAATTCTTGTAATTTTTATTTAGGAAGTGTTGAAGGGAGGTGGC 1841 AAGAGTGTGGAGGCTGACGTGTGAGGGAGGACAGGCGGGAGGAGGTGTGAGGAGGAGGCTCCCGAGGGGAAGGGGCGGTG 1921 CCCACACCGGGGACAGGCCGCAGCTCCATTTTCTTATTGCGCTGCTACCGTTGACTTCCAGGCACGGTTTGGAAATATTC 2001 ACATCGCTTCTGTGTATCTCTTTCACATTGTTTGCTGCTATTGGAGGATCAGTTTTTTGTTTTACAATGTCATATACTGC 2081 CATGTACTAGTTTTAGTTTTCTCTTAGAACATTGTATTACAGATGCCTTTTTTGTAGTTTTTTTTTTTTTTATGTGATCA 2161 ATTTTGACTTAATGTGATTACTGCTCTATTCCAAAAAGGTTGCTGTTTCACAATACCTCATGCTTCACTTAGCCATGGTG 2241 GACCCAGCGGGCAGGTTCTGCCTGCTTTGGCGGGCAGACACGCGGGCGCGATCCCACACAGGCTGGCGGGGGCCGGCCCC 2321 GAGGCCGCGTGCGTGAGAACCGCGCCGGTGTCCCCAGAGACCAGGCTGTGTCCCTCTTCTCTTCCCTGCGCCTGTGATGC 2401 TGGGCACTTCATCTGATCGGGGGCGTAGCATCATAGTAGTTTTTACAGCTGTGTTATTCTTTGCGTGTAGCTATGGAAGT 2481 TGCATAATTATTATTATTATTATTATAACAAGTGTGTCTTACGTGCCACCACGGCGTTGTACCTGTAGGACTCTCATTCG 2561 GGATGATTGGAATAGCTTCTGGAATTTGTTCAAGTTTTGGGTATGTTTAATCTGTTATGTACTAGTGTTCTGTTTGTTAT 2641 TGTTTTGTTAATTACACCATAATGCTAATTTAAAGAGACTCCAAATCTCAATGAAGCCAGCTCACAGTGCTGTGTGCCCC 2721 GGTCACCTAGCAAGCTGCCGAACCAAAAGAATTTGCACCCCGCTGCGGGCCCACGTGGTTGGGGCCCTGCCCTGGCAGGG 2801 TCATCCTGTGCTCGGAGGCCATCTCGGGCACAGGCCCACCCCGCCCCACCCCTCCAGAACACGGCTCACGCTTACCTCAA 2881 CCATCCTGGCTGCGGCGTCTGTCTGAACCACGCGGGGGCCTTGAGGGACGCTTTGTCTGTCGTGATGGGGCAAGGGCACA 2961 AGTCCTGGATGTTGTGTGTATCGAGAGGCCAAAGGCTGGTGGCAAGTGCACGGGGCACAGCGGAGTCTGTCCTGTGACGC 3041 GCAAGTCTGAGGGTCTGGGCGGCGGGCGGCTGGGTCTGTGCATTTCTGGTTGCACCGCGGCGCTTCCCAGCACCAACATG 3121 TAACCGGCATGTTTCCAGCAGAAGACAAAAAGACAAACATGAAAGTCTAGAAATAAAACTGGTAAAACCCCAAAAAAAAA 3201 AAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
DRVs in gene 3'UTRs |
| SNPs in gene 3'UTRs | |
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Article |
- Bonci D; Coppola V; Musumeci M; Addario A; et al. - Nature medicine, 2008
MicroRNAs (miRNAs) are noncoding small RNAs that repress protein translation by targeting specific messenger RNAs. miR-15a and miR-16-1 act as putative tumor suppressors by targeting the oncogene BCL2. These miRNAs form a cluster at the chromosomal region 13q14, which is frequently deleted in cancer. Here, we report that the miR-15a and miR-16-1 cluster targets CCND1 (encoding cyclin D1) and WNT3A, which promotes several tumorigenic features such as survival, proliferation and invasion. In cancer cells of advanced prostate tumors, the miR-15a and miR-16 level is significantly decreased, whereas the expression of BCL2, CCND1 and WNT3A is inversely upregulated. Delivery of antagomirs specific for miR-15a and miR-16 to normal mouse prostate results in marked hyperplasia, and knockdown of miR-15a and miR-16 promotes survival, proliferation and invasiveness of untransformed prostate cells, which become tumorigenic in immunodeficient NOD-SCID mice. Conversely, reconstitution of miR-15a and miR-16-1 expression results in growth arrest, apoptosis and marked regression of prostate tumor xenografts. Altogether, we propose that miR-15a and miR-16 act as tumor suppressor genes in prostate cancer through the control of cell survival, proliferation and invasion. These findings have therapeutic implications and may be exploited for future treatment of prostate cancer.
LinkOut: [PMID: 18931683]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Article |
- Bandi N; Zbinden S; Gugger M; Arnold M; et al. - Cancer research, 2009
MicroRNAs (miRNA) are negative regulators of gene expression at the posttranscriptional level, which are involved in tumorigenesis. Two miRNAs, miR-15a and miR-16, which are located at chromosome 13q14, have been implicated in cell cycle control and apoptosis, but little information is available about their role in solid tumors. To address this question, we established a protocol to quantify miRNAs from laser capture microdissected tissues. Here, we show that miR-15a/miR-16 are frequently deleted or down-regulated in squamous cell carcinomas and adenocarcinomas of the lung. In these tumors, expression of miR-15a/miR-16 inversely correlates with the expression of cyclin D1. In non-small cell lung cancer (NSCLC) cell lines, cyclins D1, D2, and E1 are directly regulated by physiologic concentrations of miR-15a/miR-16. Consistent with these results, overexpression of these miRNAs induces cell cycle arrest in G(1)-G(0). Interestingly, H2009 cells lacking Rb are resistant to miR-15a/miR-16-induced cell cycle arrest, whereas reintroduction of functional Rb resensitizes these cells to miRNA activity. In contrast, down-regulation of Rb in A549 cells by RNA interference confers resistance to these miRNAs. Thus, cell cycle arrest induced by these miRNAs depends on the expression of Rb, confirming that G(1) cyclins are major targets of miR-15a/miR-16 in NSCLC. Our results indicate that miR-15a/miR-16 are implicated in cell cycle control and likely contribute to the tumorigenesis of NSCLC.
LinkOut: [PMID: 19549910]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | PicTar , miRBase Target Database |
| Original Description (Extracted from the article) |
...
We additionally show that DLEU2 negatively regulates the G1 Cyclins E1 and D1 through miR-15a/miR-16-1 and provide evidence that these oncoproteins are subject to miR-15a/miR-16-1-mediated repression under normal conditions
... - Lerner M; Harada M; Loven J; Castro J; et al., 2009, Experimental cell research. |
| Article |
- Lerner M; Harada M; Loven J; Castro J; et al. - Experimental cell research, 2009
The microRNAs miR-15a and miR-16-1 are downregulated in multiple tumor types and are frequently deleted in chronic lymphocytic leukemia (CLL), myeloma and mantle cell lymphoma. Despite their abundance in most cells the transcriptional regulation of miR-15a/16-1 remains unclear. Here we demonstrate that the putative tumor suppressor DLEU2 acts as a host gene of these microRNAs. Mature miR-15a/miR-16-1 are produced in a Drosha-dependent process from DLEU2 and binding of the Myc oncoprotein to two alterative DLEU2 promoters represses both the host gene transcript and levels of mature miR-15a/miR-16-1. In line with a functional role for DLEU2 in the expression of the microRNAs, the miR-15a/miR-16-1 locus is retained in four CLL cases that delete both promoters of this gene and expression analysis indicates that this leads to functional loss of mature miR-15a/16-1. We additionally show that DLEU2 negatively regulates the G1 Cyclins E1 and D1 through miR-15a/miR-16-1 and provide evidence that these oncoproteins are subject to miR-15a/miR-16-1-mediated repression under normal conditions. We also demonstrate that DLEU2 overexpression blocks cellular proliferation and inhibits the colony-forming ability of tumor cell lines in a miR-15a/miR-16-1-dependent way. Together the data illuminate how inactivation of DLEU2 promotes cell proliferation and tumor progression through functional loss of miR-15a/miR-16-1.
LinkOut: [PMID: 19591824]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Article |
- Deshpande A; Pastore A; Deshpande AJ; et al. - Cell cycle (Georgetown, Tex.), 2009
In mantle cell lymphoma (MCL), overexpression of cyclin D1 is the hallmark of malignant transformation and results from it's juxtaposition to the immunoglobulin heavy chain enhancer. In addition, genomic deletions or point mutations leading to premature truncation of the cyclin D1 3' untranslated region (UTR) have been reported in a several MCL patients as well as in cell lines isolated from various tumors types. We demonstrate that the expression of cyclin D1 with or without the 3'UTR has different phenotypic consequences in stably transduced fibroblasts, with the hyper-proliferative phenotype of cyclin D1 closely linked to the deletion of its 3'UTR. In our study, the loss of the cyclin D1 3'UTR led to a significant upregulation of the protein. However, the loss of AU-rich elements (AREs) from the cyclin D1 3'UTR results in a significant decrease in cyclin D1 protein and UTR-tagged reporter expression. In contrast, the levels of cyclin D1 protein can be significantly reduced by microRNAs of the miR-15/16 family and the miR17-92 cluster that directly target the cyclin D1 3'UTR. Most importantly, these microRNAs regulated the levels of the endogenous cyclin D1 protein encoded by an mRNA with a full 3'UTR but not with 3' UTR deletions. Taken together, our data highlight the regulatory role of the cyclin D1 3'UTR in the expression and phenotype of cyclin D1 and suggest that in MCL and solid tumors with cyclin D1 3'UTR mutations, the loss of microRNA target sites, rather than ARE elements contribute to the pathogenic overexpression of the cyclin D1 protein.
LinkOut: [PMID: 19823025]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Article |
- Liu YL; Yang HP; Zhou XD; Gong L; Tang CL; Wang HJ - Current cancer drug targets, 2011
Hypermethylation of the Wnt inhibitory factor-1 (WIF-1) promoter has been implicated in the overactivation of the Wnt pathway in human lung cancer. Curcuminoids exert anti-cancer effects and have been reported to act as hypomethylating agents. Previously, we have investigated and compared the demethylation effects of three curcuminoids and observed that bisdemethoxycurcumin exhibited the strongest demethylation potency. In this study, we used lung cancer cell lines with WIF-1 promoter hypermethylated as a model to study the demethylating effect of bisdemethoxycurcumin on WIF-1 restoration, Wnt signaling activity and cell death. Bisdemethoxycurcumin directly suppressed the activity of DNA methyltransferase-1 (DNMT1) but did not influence DNMT1 expression. In addition, it induced WIF-1 promoter demethylation and protein re-expression. WIF-1 restoration in lung cancer cells down-regulated nuclear beta-catenin and the canonical Wnt cascade. Furthermore, we also showed that down-regulation of Wnt signaling by WIF-1 was required for bisdemethoxycurcumin-induced apoptosis in certain lung cancer cell types. This report is the first to show that bisdemethoxycurcumin induces apoptosis by reactivating WIF-1 from a silenced state. Our results provide new insights into the anti-cancer actions of bisdemethoxycurcumin.
LinkOut: [PMID: 21933103]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Flp-In T-REx 293-hAGO1 cells |
| Location of target site | 3'UTR |
| Original Description (Extracted from the article) |
...
Validation of interactions identified by CLASH suppports their reliability.
... - Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell. |
| Article |
- Helwak A; Kudla G; Dudnakova T; Tollervey D - Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
|
| Experimental Support 7 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| CLIP-seq Support 1 for dataset SRR1045082 | |
| Method / RBP | PAR-CLIP / AGO2 |
|---|---|
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000227507.2 | 3UTR | AUCGCUUCUGUGUAUCUCUUUCACAUUGUUUGCUGCUAUUGGA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
Transcription factor regulation Circular RNA sponge
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
| ID | Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
  |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT000280 | BMI1 | BMI1 proto-oncogene, polycomb ring finger |  |
|
|
|
|
5 | 3 | |||
| MIRT000282 | WNT3A | Wnt family member 3A | |
|
|
3 | 2 | |||||
| MIRT000283 | MYB | MYB proto-oncogene, transcription factor | |
|
|
|
|
5 | 3 | |||
| MIRT000284 | CDC25A | cell division cycle 25A | |
|
|
3 | 3 | |||||
| MIRT000285 | CCND2 | cyclin D2 | |
|
|
3 | 5 | |||||
| MIRT000815 | BCL2 | BCL2, apoptosis regulator | |
|
|
|
|
|
6 | 13 | ||
| MIRT001227 | CCND1 | cyclin D1 | |
|
|
|
|
5 | 7 | |||
| MIRT001228 | CCNE1 | cyclin E1 | |
|
|
|
|
|
6 | 8 | ||
| MIRT001802 | BACE1 | beta-secretase 1 | |
|
2 | 1 | ||||||
| MIRT006181 | MN1 | MN1 proto-oncogene, transcriptional regulator | |
|
|
|
4 | 1 | ||||
| MIRT006177 | CRKL | CRK like proto-oncogene, adaptor protein | |
|
|
|
|
5 | 2 | |||
| MIRT006176 | CLCN3 | chloride voltage-gated channel 3 | |
|
|
|
4 | 1 | ||||
| MIRT002946 | DMTF1 | cyclin D binding myb like transcription factor 1 | |
|
|
3 | 3 | |||||
| MIRT003333 | BRCA1 | BRCA1, DNA repair associated | |
|
2 | 2 | ||||||
| MIRT003334 | AKT3 | AKT serine/threonine kinase 3 | |
|
2 | 4 | ||||||
| MIRT006027 | FGF7 | fibroblast growth factor 7 | |
|
2 | 1 | ||||||
| MIRT003888 | CADM1 | cell adhesion molecule 1 | |
|
|
3 | 1 | |||||
| MIRT003891 | TMEM184B | transmembrane protein 184B | |
|
2 | 1 | ||||||
| MIRT003899 | APP | amyloid beta precursor protein | |
|
|
3 | 2 | |||||
| MIRT004046 | UCP2 | uncoupling protein 2 | |
|
|
3 | 1 | |||||
| MIRT004275 | VEGFA | vascular endothelial growth factor A | |
|
|
|
|
|
6 | 11 | ||
| MIRT004680 | TSPYL2 | TSPY like 2 | |
|
2 | 1 | ||||||
| MIRT005552 | CHUK | conserved helix-loop-helix ubiquitous kinase | |
|
|
|
4 | 1 | ||||
| MIRT005763 | TP53 | tumor protein p53 | |
1 | 1 | |||||||
| MIRT006801 | HMGA1 | high mobility group AT-hook 1 | |
|
|
|
4 | 2 | ||||
| MIRT006805 | HMGA2 | high mobility group AT-hook 2 | |
|
|
3 | 1 | |||||
| MIRT006913 | IFNG | interferon gamma | |
|
2 | 1 | ||||||
| MIRT006998 | PURA | purine rich element binding protein A | |
|
2 | 2 | ||||||
| MIRT007090 | RECK | reversion inducing cysteine rich protein with kazal motifs | |
|
|
3 | 2 | |||||
| MIRT051345 | FOXO1 | forkhead box O1 | |
|
|
|
4 | 2 | ||||
| MIRT052930 | REPIN1 | replication initiator 1 | |
|
2 | 1 | ||||||
| MIRT054283 | YAP1 | Yes associated protein 1 | |
|
|
3 | 1 | |||||
| MIRT054424 | CARM1 | coactivator associated arginine methyltransferase 1 | |
|
|
3 | 1 | |||||
| MIRT054895 | SOX5 | SRY-box 5 | |
|
2 | 1 | ||||||
| MIRT100364 | HSPA1B | heat shock protein family A (Hsp70) member 1B | |
|
2 | 5 | ||||||
| MIRT438163 | PHLPP1 | PH domain and leucine rich repeat protein phosphatase 1 | |
|
|
3 | 1 | |||||
| MIRT438610 | RET | ret proto-oncogene | |
1 | 1 | |||||||
| MIRT731341 | CXCL10 | C-X-C motif chemokine ligand 10 | |
1 | 1 | |||||||
| MIRT000804 | RAB9B | RAB9B, member RAS oncogene family | |
1 | 1 | |||||||
| MIRT000806 | ACTR1A | ARP1 actin related protein 1 homolog A | |
1 | 1 | |||||||
| MIRT000808 | TPI1 | triosephosphate isomerase 1 | |
1 | 1 | |||||||
| MIRT000810 | PDCD4 | programmed cell death 4 | |
|
|
3 | 2 | |||||
| MIRT000812 | RAB21 | RAB21, member RAS oncogene family | |
|
2 | 1 | ||||||
| MIRT000817 | WT1 | Wilms tumor 1 | |
|
2 | 1 | ||||||
| MIRT000819 | ASXL2 | additional sex combs like 2, transcriptional regulator | |
|
2 | 1 | ||||||
| MIRT000823 | TMEM251 | transmembrane protein 251 | |
|
2 | 1 | ||||||
| MIRT000825 | CARD8 | caspase recruitment domain family member 8 | |
|
2 | 1 | ||||||
| MIRT000827 | CDC14B | cell division cycle 14B | |
|
2 | 1 | ||||||
| MIRT000829 | CENPJ | centromere protein J | |
|
2 | 1 | ||||||
| MIRT000831 | CEP63 | centrosomal protein 63 | |
|
2 | 1 | ||||||
| MIRT000833 | CREBL2 | cAMP responsive element binding protein like 2 | |
|
|
3 | 3 | |||||
| MIRT000835 | ECHDC1 | ethylmalonyl-CoA decarboxylase 1 | |
|
2 | 1 | ||||||
| MIRT000847 | GOLGA5 | golgin A5 | |
|
2 | 1 | ||||||
| MIRT000849 | GOLPH3L | golgi phosphoprotein 3 like | |
|
2 | 1 | ||||||
| MIRT000851 | GTF2H1 | general transcription factor IIH subunit 1 | |
|
2 | 1 | ||||||
| MIRT000853 | H3F3B | H3 histone family member 3B | |
|
2 | 1 | ||||||
| MIRT000855 | HACE1 | HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 | |
|
2 | 1 | ||||||
| MIRT000857 | HDHD2 | haloacid dehalogenase like hydrolase domain containing 2 | |
|
2 | 1 | ||||||
| MIRT000859 | HERC6 | HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 | |
|
2 | 1 | ||||||
| MIRT000863 | HRSP12 | reactive intermediate imine deaminase A homolog | |
|
2 | 1 | ||||||
| MIRT000865 | HSDL2 | hydroxysteroid dehydrogenase like 2 | |
|
2 | 1 | ||||||
| MIRT000866 | HSPA1A | heat shock protein family A (Hsp70) member 1A | |
|
2 | 1 | ||||||
| MIRT000868 | JUN | Jun proto-oncogene, AP-1 transcription factor subunit | |
|
2 | 1 | ||||||
| MIRT000878 | MCL1 | MCL1, BCL2 family apoptosis regulator | |
|
2 | 1 | ||||||
| MIRT000880 | MSH2 | mutS homolog 2 | |
|
2 | 1 | ||||||
| MIRT000884 | OMA1 | OMA1 zinc metallopeptidase | |
|
2 | 1 | ||||||
| MIRT000886 | OSGEPL1 | O-sialoglycoprotein endopeptidase like 1 | |
|
2 | 1 | ||||||
| MIRT000888 | PDCD6IP | programmed cell death 6 interacting protein | |
|
2 | 1 | ||||||
| MIRT000890 | PHKB | phosphorylase kinase regulatory subunit beta | |
|
2 | 1 | ||||||
| MIRT000892 | PMS1 | PMS1 homolog 1, mismatch repair system component | |
|
2 | 1 | ||||||
| MIRT000894 | PNN | pinin, desmosome associated protein | |
|
2 | 1 | ||||||
| MIRT000896 | PRIM1 | DNA primase subunit 1 | |
|
2 | 1 | ||||||
| MIRT000898 | RAD51C | RAD51 paralog C | |
|
2 | 1 | ||||||
| MIRT000900 | RHOT1 | ras homolog family member T1 | |
|
2 | 1 | ||||||
| MIRT000902 | RNASEL | ribonuclease L | |
|
2 | 1 | ||||||
| MIRT000906 | SLC35A1 | solute carrier family 35 member A1 | |
|
2 | 1 | ||||||
| MIRT000908 | SLC35B3 | solute carrier family 35 member B3 | |
|
2 | 1 | ||||||
| MIRT000910 | TIA1 | TIA1 cytotoxic granule associated RNA binding protein | |
|
2 | 1 | ||||||
| MIRT000914 | UGDH | UDP-glucose 6-dehydrogenase | |
|
2 | 1 | ||||||
| MIRT000916 | UGP2 | UDP-glucose pyrophosphorylase 2 | |
|
2 | 1 | ||||||
| MIRT000922 | ZNF559 | zinc finger protein 559 | |
|
2 | 1 | ||||||
| MIRT003872 | WIPF1 | WAS/WASL interacting protein family member 1 | |
|
2 | 1 | ||||||
| MIRT003873 | VPS45 | vacuolar protein sorting 45 homolog | |
|
2 | 1 | ||||||
| MIRT003874 | HSP90B1 | heat shock protein 90 beta family member 1 | |
|
2 | 1 | ||||||
| MIRT003875 | SKAP2 | src kinase associated phosphoprotein 2 | |
|
|
3 | 1 | |||||
| MIRT003876 | NT5DC1 | 5'-nucleotidase domain containing 1 | |
|
2 | 1 | ||||||
| MIRT003877 | FAM69A | family with sequence similarity 69 member A | |
|
2 | 1 | ||||||
| MIRT003878 | C2orf74 | chromosome 2 open reading frame 74 | |
1 | 1 | |||||||
| MIRT003879 | FAM122C | family with sequence similarity 122C | |
|
2 | 1 | ||||||
| MIRT003880 | PWWP2A | PWWP domain containing 2A | |
|
2 | 1 | ||||||
| MIRT003881 | C17orf80 | chromosome 17 open reading frame 80 | |
|
2 | 1 | ||||||
| MIRT003882 | CCDC111 | primase and DNA directed polymerase | |
|
2 | 1 | ||||||
| MIRT003883 | C2orf43 | lipid droplet associated hydrolase | |
|
2 | 1 | ||||||
| MIRT003884 | C4orf27 | histone PARylation factor 1 | |
|
2 | 1 | ||||||
| MIRT003885 | NIPAL2 | NIPA like domain containing 2 | |
|
2 | 1 | ||||||
| MIRT003886 | TRMT13 | tRNA methyltransferase 13 homolog | |
|
2 | 1 | ||||||
| MIRT003887 | ANAPC16 | anaphase promoting complex subunit 16 | |
|
2 | 1 | ||||||
| MIRT004829 | NFKB1 | nuclear factor kappa B subunit 1 | |
|
|
3 | 1 | |||||
| MIRT006658 | Ccnd1 | cyclin D1 | |
1 | 1 | |||||||
| MIRT032077 | DLK1 | delta like non-canonical Notch ligand 1 | |
|
2 | 1 | ||||||
| MIRT051311 | PLA2G2D | phospholipase A2 group IID | |
1 | 1 | |||||||
| MIRT051312 | ACVR1B | activin A receptor type 1B | |
1 | 1 | |||||||
| MIRT051313 | IKBKG | inhibitor of nuclear factor kappa B kinase subunit gamma | |
1 | 1 | |||||||
| MIRT051314 | GCLM | glutamate-cysteine ligase modifier subunit | |
1 | 1 | |||||||
| MIRT051315 | PCF11 | PCF11 cleavage and polyadenylation factor subunit | |
1 | 1 | |||||||
| MIRT051316 | HIST1H2BK | histone cluster 1 H2B family member k | |
1 | 1 | |||||||
| MIRT051317 | ODC1 | ornithine decarboxylase 1 | |
1 | 1 | |||||||
| MIRT051318 | CALD1 | caldesmon 1 | |
1 | 1 | |||||||
| MIRT051319 | RPP30 | ribonuclease P/MRP subunit p30 | |
1 | 1 | |||||||
| MIRT051320 | ASNSD1 | asparagine synthetase domain containing 1 | |
1 | 1 | |||||||
| MIRT051321 | CCNYL1 | cyclin Y like 1 | |
1 | 1 | |||||||
| MIRT051322 | RGPD5 | RANBP2-like and GRIP domain containing 5 | |
1 | 1 | |||||||
| MIRT051323 | PREB | prolactin regulatory element binding | |
1 | 1 | |||||||
| MIRT051324 | PDHX | pyruvate dehydrogenase complex component X | |
1 | 1 | |||||||
| MIRT051325 | SNX6 | sorting nexin 6 | |
1 | 1 | |||||||
| MIRT051326 | CNN3 | calponin 3 | |
1 | 1 | |||||||
| MIRT051327 | KIF1A | kinesin family member 1A | |
1 | 1 | |||||||
| MIRT051328 | NAB1 | NGFI-A binding protein 1 | |
1 | 1 | |||||||
| MIRT051329 | CCT6B | chaperonin containing TCP1 subunit 6B | |
1 | 1 | |||||||
| MIRT051330 | CHD4 | chromodomain helicase DNA binding protein 4 | |
1 | 1 | |||||||
| MIRT051331 | CLCC1 | chloride channel CLIC like 1 | |
1 | 1 | |||||||
| MIRT051332 | GDI2 | GDP dissociation inhibitor 2 | |
1 | 1 | |||||||
| MIRT051333 | BRWD1 | bromodomain and WD repeat domain containing 1 | |
1 | 1 | |||||||
| MIRT051334 | MAPK6 | mitogen-activated protein kinase 6 | |
1 | 1 | |||||||
| MIRT051335 | PSMC4 | proteasome 26S subunit, ATPase 4 | |
1 | 1 | |||||||
| MIRT051336 | ATF2 | activating transcription factor 2 | |
1 | 1 | |||||||
| MIRT051337 | ATP6AP1 | ATPase H+ transporting accessory protein 1 | |
1 | 1 | |||||||
| MIRT051338 | FBXO3 | F-box protein 3 | |
1 | 1 | |||||||
| MIRT051339 | PRDX3 | peroxiredoxin 3 | |
1 | 1 | |||||||
| MIRT051340 | CABIN1 | calcineurin binding protein 1 | |
1 | 1 | |||||||
| MIRT051341 | FASN | fatty acid synthase | |
1 | 3 | |||||||
| MIRT051342 | SEC63 | SEC63 homolog, protein translocation regulator | |
1 | 1 | |||||||
| MIRT051343 | PTAR1 | protein prenyltransferase alpha subunit repeat containing 1 | |
1 | 1 | |||||||
| MIRT051344 | DSTYK | dual serine/threonine and tyrosine protein kinase | |
1 | 1 | |||||||
| MIRT051346 | TMEM214 | transmembrane protein 214 | |
1 | 1 | |||||||
| MIRT051347 | TRIM28 | tripartite motif containing 28 | |
1 | 1 | |||||||
| MIRT051348 | NOP2 | NOP2 nucleolar protein | |
1 | 1 | |||||||
| MIRT051349 | MYBL1 | MYB proto-oncogene like 1 | |
1 | 1 | |||||||
| MIRT051350 | TTC1 | tetratricopeptide repeat domain 1 | |
1 | 1 | |||||||
| MIRT051351 | BTRC | beta-transducin repeat containing E3 ubiquitin protein ligase | |
1 | 2 | |||||||
| MIRT053079 | KLF4 | Kruppel like factor 4 | |
1 | 1 | |||||||
| MIRT055421 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | |
1 | 6 | |||||||
| MIRT055811 | PLEKHA1 | pleckstrin homology domain containing A1 | |
1 | 1 | |||||||
| MIRT057514 | CEP55 | centrosomal protein 55 | |
1 | 4 | |||||||
| MIRT057729 | ZDHHC16 | zinc finger DHHC-type containing 16 | |
1 | 1 | |||||||
| MIRT057906 | STXBP3 | syntaxin binding protein 3 | |
1 | 1 | |||||||
| MIRT061005 | C1ORF21 | chromosome 1 open reading frame 21 | |
1 | 3 | |||||||
| MIRT061244 | AMOTL1 | angiomotin like 1 | |
1 | 6 | |||||||
| MIRT061529 | BTG2 | BTG anti-proliferation factor 2 | |
1 | 1 | |||||||
| MIRT063394 | ETNK1 | ethanolamine kinase 1 | |
1 | 1 | |||||||
| MIRT065711 | TARBP2 | TARBP2, RISC loading complex RNA binding subunit | |
1 | 2 | |||||||
| MIRT066291 | MTFR1L | mitochondrial fission regulator 1 like | |
1 | 1 | |||||||
| MIRT066312 | USP15 | ubiquitin specific peptidase 15 | |
1 | 1 | |||||||
| MIRT068655 | AKAP11 | A-kinase anchoring protein 11 | |
1 | 1 | |||||||
| MIRT071206 | FCF1 | FCF1, rRNA-processing protein | |
1 | 1 | |||||||
| MIRT072822 | ARIH1 | ariadne RBR E3 ubiquitin protein ligase 1 | |
1 | 3 | |||||||
| MIRT074530 | PAGR1 | PAXIP1 associated glutamate rich protein 1 | |
1 | 2 | |||||||
| MIRT075249 | SNTB2 | syntrophin beta 2 | |
1 | 2 | |||||||
| MIRT075273 | VPS4A | vacuolar protein sorting 4 homolog A | |
1 | 4 | |||||||
| MIRT075891 | C16ORF72 | chromosome 16 open reading frame 72 | |
1 | 4 | |||||||
| MIRT076791 | GOSR1 | golgi SNAP receptor complex member 1 | |
1 | 1 | |||||||
| MIRT077781 | MINK1 | misshapen like kinase 1 | |
1 | 1 | |||||||
| MIRT078282 | RPS6KB1 | ribosomal protein S6 kinase B1 | |
1 | 1 | |||||||
| MIRT079655 | NAPG | NSF attachment protein gamma | |
1 | 6 | |||||||
| MIRT080011 | GALNT1 | polypeptide N-acetylgalactosaminyltransferase 1 | |
1 | 2 | |||||||
| MIRT082985 | PNPLA6 | patatin like phospholipase domain containing 6 | |
1 | 1 | |||||||
| MIRT083265 | ZCCHC3 | zinc finger CCHC-type containing 3 | |
1 | 3 | |||||||
| MIRT084462 | SOWAHC | sosondowah ankyrin repeat domain family member C | |
1 | 2 | |||||||
| MIRT085215 | CCNT2 | cyclin T2 | |
1 | 1 | |||||||
| MIRT086005 | UBR3 | ubiquitin protein ligase E3 component n-recognin 3 (putative) | |
1 | 1 | |||||||
| MIRT087424 | ZNRF3 | zinc and ring finger 3 | |
1 | 1 | |||||||
| MIRT087554 | YWHAH | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta | |
1 | 1 | |||||||
| MIRT088102 | SEPT2 | septin 2 | |
1 | 1 | |||||||
| MIRT089105 | B3GNT2 | UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 | |
1 | 2 | |||||||
| MIRT089206 | ACTR2 | ARP2 actin related protein 2 homolog | |
1 | 2 | |||||||
| MIRT090446 | CDV3 | CDV3 homolog | |
1 | 1 | |||||||
| MIRT090688 | U2SURP | U2 snRNP associated SURP domain containing | |
1 | 1 | |||||||
| MIRT091667 | RARB | retinoic acid receptor beta | |
1 | 3 | |||||||
| MIRT092190 | ITPR1 | inositol 1,4,5-trisphosphate receptor type 1 | |
1 | 1 | |||||||
| MIRT092209 | BHLHE40 | basic helix-loop-helix family member e40 | |
1 | 1 | |||||||
| MIRT093682 | PI4K2B | phosphatidylinositol 4-kinase type 2 beta | |
1 | 3 | |||||||
| MIRT096234 | CANX | calnexin | |
1 | 1 | |||||||
| MIRT098827 | PCMT1 | protein-L-isoaspartate (D-aspartate) O-methyltransferase | |
1 | 1 | |||||||
| MIRT099631 | E2F3 | E2F transcription factor 3 | |
1 | 1 | |||||||
| MIRT100207 | PPP1R11 | protein phosphatase 1 regulatory inhibitor subunit 11 | |
1 | 1 | |||||||
| MIRT100566 | PIM1 | Pim-1 proto-oncogene, serine/threonine kinase | |
1 | 1 | |||||||
| MIRT100896 | CD2AP | CD2 associated protein | |
1 | 1 | |||||||
| MIRT102434 | CALU | calumenin | |
1 | 2 | |||||||
| MIRT102632 | UBN2 | ubinuclein 2 | |
1 | 6 | |||||||
| MIRT102971 | EN2 | engrailed homeobox 2 | |
1 | 3 | |||||||
| MIRT103092 | MAFK | MAF bZIP transcription factor K | |
1 | 3 | |||||||
| MIRT103856 | FOXK1 | forkhead box K1 | |
1 | 2 | |||||||
| MIRT104015 | USP42 | ubiquitin specific peptidase 42 | |
1 | 3 | |||||||
| MIRT106292 | ZFHX4 | zinc finger homeobox 4 | |
1 | 3 | |||||||
| MIRT106733 | RAD23B | RAD23 homolog B, nucleotide excision repair protein | |
1 | 2 | |||||||
| MIRT107218 | ZBTB34 | zinc finger and BTB domain containing 34 | |
1 | 1 | |||||||
| MIRT108983 | SLC9A6 | solute carrier family 9 member A6 | |
1 | 1 | |||||||
| MIRT109240 | ZNF275 | zinc finger protein 275 | |
1 | 1 | |||||||
| MIRT110051 | OGT | O-linked N-acetylglucosamine (GlcNAc) transferase | |
1 | 4 | |||||||
| MIRT112969 | LUZP1 | leucine zipper protein 1 | |
1 | 3 | |||||||
| MIRT114923 | CHAC1 | ChaC glutathione specific gamma-glutamylcyclotransferase 1 | |
1 | 1 | |||||||
| MIRT117655 | SCAMP4 | secretory carrier membrane protein 4 | |
1 | 1 | |||||||
| MIRT120680 | PAK2 | p21 (RAC1) activated kinase 2 | |
1 | 1 | |||||||
| MIRT127725 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | |
1 | 2 | |||||||
| MIRT128798 | UBE4A | ubiquitination factor E4A | |
1 | 1 | |||||||
| MIRT129055 | ARCN1 | archain 1 | |
1 | 1 | |||||||
| MIRT130380 | PTPRJ | protein tyrosine phosphatase, receptor type J | |
1 | 1 | |||||||
| MIRT131097 | TMEM138 | transmembrane protein 138 | |
1 | 1 | |||||||
| MIRT132734 | RASSF5 | Ras association domain family member 5 | |
1 | 1 | |||||||
| MIRT132831 | MAPKAPK2 | mitogen-activated protein kinase-activated protein kinase 2 | |
1 | 1 | |||||||
| MIRT133334 | BCL7A | BCL tumor suppressor 7A | |
1 | 1 | |||||||
| MIRT133769 | SKI | SKI proto-oncogene | |
1 | 2 | |||||||
| MIRT137517 | RCOR1 | REST corepressor 1 | |
1 | 1 | |||||||
| MIRT140146 | SPRED1 | sprouty related EVH1 domain containing 1 | |
1 | 2 | |||||||
| MIRT140820 | SMAD3 | SMAD family member 3 | |
1 | 1 | |||||||
| MIRT141243 | SCAMP5 | secretory carrier membrane protein 5 | |
1 | 1 | |||||||
| MIRT141279 | UBE2Q2 | ubiquitin conjugating enzyme E2 Q2 | |
1 | 1 | |||||||
| MIRT142237 | DCTN5 | dynactin subunit 5 | |
1 | 5 | |||||||
| MIRT144019 | PSKH1 | protein serine kinase H1 | |
1 | 1 | |||||||
| MIRT145377 | ANKRD13B | ankyrin repeat domain 13B | |
1 | 1 | |||||||
| MIRT146014 | EZH1 | enhancer of zeste 1 polycomb repressive complex 2 subunit | |
1 | 1 | |||||||
| MIRT146351 | PNPO | pyridoxamine 5'-phosphate oxidase | |
1 | 1 | |||||||
| MIRT146496 | SNX11 | sorting nexin 11 | |
1 | 1 | |||||||
| MIRT148302 | RNF138 | ring finger protein 138 | |
1 | 1 | |||||||
| MIRT150354 | IER2 | immediate early response 2 | |
1 | 1 | |||||||
| MIRT152274 | TNFSF9 | TNF superfamily member 9 | |
1 | 2 | |||||||
| MIRT152503 | ENTPD6 | ectonucleoside triphosphate diphosphohydrolase 6 (putative) | |
1 | 1 | |||||||
| MIRT152736 | KIF3B | kinesin family member 3B | |
1 | 1 | |||||||
| MIRT152922 | NOL4L | nucleolar protein 4 like | |
1 | 1 | |||||||
| MIRT154043 | RASSF2 | Ras association domain family member 2 | |
1 | 1 | |||||||
| MIRT154392 | CDS2 | CDP-diacylglycerol synthase 2 | |
1 | 1 | |||||||
| MIRT156452 | ATP5G3 | ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) | |
1 | 1 | |||||||
| MIRT158519 | TNRC6B | trinucleotide repeat containing 6B | |
1 | 3 | |||||||
| MIRT158990 | EPT1 | selenoprotein I | |
1 | 1 | |||||||
| MIRT159580 | PEX13 | peroxisomal biogenesis factor 13 | |
1 | 1 | |||||||
| MIRT160169 | TET3 | tet methylcytosine dioxygenase 3 | |
1 | 1 | |||||||
| MIRT163253 | PRKCD | protein kinase C delta | |
1 | 1 | |||||||
| MIRT164260 | CPEB2 | cytoplasmic polyadenylation element binding protein 2 | |
1 | 1 | |||||||
| MIRT164952 | TADA2B | transcriptional adaptor 2B | |
1 | 1 | |||||||
| MIRT165172 | GRAMD3 | GRAM domain containing 2B | |
1 | 2 | |||||||
| MIRT165883 | CREBRF | CREB3 regulatory factor | |
1 | 2 | |||||||
| MIRT168680 | CDKN1A | cyclin dependent kinase inhibitor 1A | |
1 | 1 | |||||||
| MIRT169058 | IRF4 | interferon regulatory factor 4 | |
1 | 1 | |||||||
| MIRT170136 | KLHDC10 | kelch domain containing 10 | |
1 | 1 | |||||||
| MIRT170733 | UBE3C | ubiquitin protein ligase E3C | |
1 | 1 | |||||||
| MIRT171597 | SUN1 | Sad1 and UNC84 domain containing 1 | |
1 | 1 | |||||||
| MIRT172813 | HMBOX1 | homeobox containing 1 | |
1 | 1 | |||||||
| MIRT174781 | RNF38 | ring finger protein 38 | |
1 | 1 | |||||||
| MIRT175232 | PSAT1 | phosphoserine aminotransferase 1 | |
1 | 4 | |||||||
| MIRT175524 | ZBTB33 | zinc finger and BTB domain containing 33 | |
1 | 1 | |||||||
| MIRT179008 | PAFAH1B2 | platelet activating factor acetylhydrolase 1b catalytic subunit 2 | |
1 | 1 | |||||||
| MIRT180909 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | |
1 | 4 | |||||||
| MIRT186371 | PNRC2 | proline rich nuclear receptor coactivator 2 | |
1 | 1 | |||||||
| MIRT189760 | CDADC1 | cytidine and dCMP deaminase domain containing 1 | |
1 | 1 | |||||||
| MIRT189961 | AGO4 | argonaute 4, RISC catalytic component | |
1 | 1 | |||||||
| MIRT190184 | GPR180 | G protein-coupled receptor 180 | |
1 | 3 | |||||||
| MIRT191454 | PPM1A | protein phosphatase, Mg2+/Mn2+ dependent 1A | |
1 | 1 | |||||||
| MIRT191625 | SLC39A9 | solute carrier family 39 member 9 | |
1 | 3 | |||||||
| MIRT194237 | FAM103A1 | family with sequence similarity 103 member A1 | |
1 | 3 | |||||||
| MIRT194903 | RBBP6 | RB binding protein 6, ubiquitin ligase | |
1 | 4 | |||||||
| MIRT196275 | PAFAH1B1 | platelet activating factor acetylhydrolase 1b regulatory subunit 1 | |
1 | 1 | |||||||
| MIRT196450 | TAOK1 | TAO kinase 1 | |
1 | 1 | |||||||
| MIRT201456 | SNRPB2 | small nuclear ribonucleoprotein polypeptide B2 | |
1 | 4 | |||||||
| MIRT204592 | HSPE1-MOB4 | HSPE1-MOB4 readthrough | |
1 | 4 | |||||||
| MIRT204623 | MOB4 | MOB family member 4, phocein | |
1 | 4 | |||||||
| MIRT204741 | BZW1 | basic leucine zipper and W2 domains 1 | |
1 | 6 | |||||||
| MIRT206020 | NUP50 | nucleoporin 50 | |
1 | 4 | |||||||
| MIRT211199 | FGF2 | fibroblast growth factor 2 | |
1 | 2 | |||||||
| MIRT211314 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | |
1 | 2 | |||||||
| MIRT212604 | RBPJ | recombination signal binding protein for immunoglobulin kappa J region | |
1 | 4 | |||||||
| MIRT217743 | TBPL1 | TATA-box binding protein like 1 | |
1 | 2 | |||||||
| MIRT223681 | FZD6 | frizzled class receptor 6 | |
1 | 3 | |||||||
| MIRT224965 | BAG4 | BCL2 associated athanogene 4 | |
1 | 1 | |||||||
| MIRT229343 | ZNF449 | zinc finger protein 449 | |
1 | 1 | |||||||
| MIRT229860 | YIPF6 | Yip1 domain family member 6 | |
1 | 1 | |||||||
| MIRT230120 | DDX3Y | DEAD-box helicase 3, Y-linked | |
1 | 1 | |||||||
| MIRT234342 | MSL1 | male specific lethal 1 homolog | |
1 | 4 | |||||||
| MIRT245003 | ENTPD7 | ectonucleoside triphosphate diphosphohydrolase 7 | |
1 | 1 | |||||||
| MIRT246938 | PRRC2C | proline rich coiled-coil 2C | |
1 | 1 | |||||||
| MIRT247095 | WEE1 | WEE1 G2 checkpoint kinase | |
1 | 2 | |||||||
| MIRT247236 | ELK4 | ELK4, ETS transcription factor | |
1 | 2 | |||||||
| MIRT247368 | GABARAPL1 | GABA type A receptor associated protein like 1 | |
1 | 3 | |||||||
| MIRT248550 | PDIK1L | PDLIM1 interacting kinase 1 like | |
1 | 1 | |||||||
| MIRT248765 | ATXN7L3B | ataxin 7 like 3B | |
1 | 2 | |||||||
| MIRT249449 | ZNF691 | zinc finger protein 691 | |
1 | 2 | |||||||
| MIRT251487 | DYNLL2 | dynein light chain LC8-type 2 | |
1 | 2 | |||||||
| MIRT255333 | SRPRB | SRP receptor beta subunit | |
1 | 3 | |||||||
| MIRT256305 | CDC42SE2 | CDC42 small effector 2 | |
1 | 1 | |||||||
| MIRT258410 | WIPI2 | WD repeat domain, phosphoinositide interacting 2 | |
1 | 2 | |||||||
| MIRT265056 | TBRG1 | transforming growth factor beta regulator 1 | |
1 | 1 | |||||||
| MIRT265076 | CHEK1 | checkpoint kinase 1 | |
1 | 2 | |||||||
| MIRT267254 | TMEM109 | transmembrane protein 109 | |
1 | 1 | |||||||
| MIRT267527 | C1ORF226 | chromosome 1 open reading frame 226 | |
1 | 1 | |||||||
| MIRT270454 | SIRT4 | sirtuin 4 | |
1 | 1 | |||||||
| MIRT270552 | SETD1B | SET domain containing 1B | |
1 | 1 | |||||||
| MIRT273665 | HOXC8 | homeobox C8 | |
1 | 1 | |||||||
| MIRT274741 | RAB3IP | RAB3A interacting protein | |
1 | 1 | |||||||
| MIRT277504 | PPP2R5C | protein phosphatase 2 regulatory subunit B'gamma | |
1 | 2 | |||||||
| MIRT282532 | SLCO3A1 | solute carrier organic anion transporter family member 3A1 | |
1 | 1 | |||||||
| MIRT286968 | MLLT6 | MLLT6, PHD finger containing | |
1 | 1 | |||||||
| MIRT289625 | CBX2 | chromobox 2 | |
1 | 1 | |||||||
| MIRT294283 | ZFP28 | ZFP28 zinc finger protein | |
1 | 1 | |||||||
| MIRT295810 | CHMP4B | charged multivesicular body protein 4B | |
1 | 1 | |||||||
| MIRT297778 | GABPA | GA binding protein transcription factor alpha subunit | |
1 | 2 | |||||||
| MIRT300100 | STRADB | STE20-related kinase adaptor beta | |
1 | 1 | |||||||
| MIRT300992 | MTMR3 | myotubularin related protein 3 | |
1 | 1 | |||||||
| MIRT302611 | CRIM1 | cysteine rich transmembrane BMP regulator 1 | |
1 | 3 | |||||||
| MIRT302825 | SOCS5 | suppressor of cytokine signaling 5 | |
1 | 1 | |||||||
| MIRT307141 | CTDSPL | CTD small phosphatase like | |
1 | 2 | |||||||
| MIRT313675 | ITGA2 | integrin subunit alpha 2 | |
1 | 1 | |||||||
| MIRT314051 | PIK3R1 | phosphoinositide-3-kinase regulatory subunit 1 | |
1 | 4 | |||||||
| MIRT317722 | PPIL1 | peptidylprolyl isomerase like 1 | |
1 | 4 | |||||||
| MIRT319331 | CAPZA2 | capping actin protein of muscle Z-line alpha subunit 2 | |
1 | 1 | |||||||
| MIRT320626 | ZNRF2 | zinc and ring finger 2 | |
1 | 1 | |||||||
| MIRT324839 | IFT74 | intraflagellar transport 74 | |
1 | 1 | |||||||
| MIRT326301 | OCRL | OCRL, inositol polyphosphate-5-phosphatase | |
1 | 1 | |||||||
| MIRT327962 | CHIC1 | cysteine rich hydrophobic domain 1 | |
1 | 3 | |||||||
| MIRT437998 | KLF6 | Kruppel like factor 6 | |
|
2 | 1 | ||||||
| MIRT443809 | SIDT2 | SID1 transmembrane family member 2 | |
|
2 | 1 | ||||||
| MIRT446508 | ASCC1 | activating signal cointegrator 1 complex subunit 1 | |
1 | 1 | |||||||
| MIRT447778 | DMRT2 | doublesex and mab-3 related transcription factor 2 | |
1 | 1 | |||||||
| MIRT448440 | TLL1 | tolloid like 1 | |
1 | 1 | |||||||
| MIRT449190 | LUC7L3 | LUC7 like 3 pre-mRNA splicing factor | |
1 | 1 | |||||||
| MIRT451839 | ALDH3B1 | aldehyde dehydrogenase 3 family member B1 | |
1 | 1 | |||||||
| MIRT453288 | EFTUD2 | elongation factor Tu GTP binding domain containing 2 | |
1 | 1 | |||||||
| MIRT453754 | CSNK1E | casein kinase 1 epsilon | |
1 | 1 | |||||||
| MIRT454970 | TPM2 | tropomyosin 2 | |
1 | 1 | |||||||
| MIRT456867 | ZNF460 | zinc finger protein 460 | |
1 | 5 | |||||||
| MIRT460224 | FGFR4 | fibroblast growth factor receptor 4 | |
1 | 1 | |||||||
| MIRT460438 | DOCK11 | dedicator of cytokinesis 11 | |
1 | 1 | |||||||
| MIRT461564 | ACTR3B | ARP3 actin related protein 3 homolog B | |
1 | 1 | |||||||
| MIRT463167 | ZNF367 | zinc finger protein 367 | |
1 | 5 | |||||||
| MIRT464668 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | |
1 | 4 | |||||||
| MIRT464751 | UBE2Q1 | ubiquitin conjugating enzyme E2 Q1 | |
1 | 2 | |||||||
| MIRT465165 | TSC22D2 | TSC22 domain family member 2 | |
1 | 1 | |||||||
| MIRT465570 | TOB2 | transducer of ERBB2, 2 | |
1 | 1 | |||||||
| MIRT465926 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | |
1 | 4 | |||||||
| MIRT466008 | TMEM189 | transmembrane protein 189 | |
1 | 4 | |||||||
| MIRT466298 | TM4SF1 | transmembrane 4 L six family member 1 | |
1 | 1 | |||||||
| MIRT466436 | TFAP2A | transcription factor AP-2 alpha | |
1 | 4 | |||||||
| MIRT466917 | STK38 | serine/threonine kinase 38 | |
1 | 5 | |||||||
| MIRT467002 | SSRP1 | structure specific recognition protein 1 | |
1 | 3 | |||||||
| MIRT468052 | SIK1 | salt inducible kinase 1 | |
1 | 2 | |||||||
| MIRT468151 | SH3BP4 | SH3 domain binding protein 4 | |
1 | 1 | |||||||
| MIRT468676 | SEC24A | SEC24 homolog A, COPII coat complex component | |
1 | 2 | |||||||
| MIRT469090 | RNF168 | ring finger protein 168 | |
1 | 1 | |||||||
| MIRT469415 | REL | REL proto-oncogene, NF-kB subunit | |
1 | 3 | |||||||
| MIRT471038 | PISD | phosphatidylserine decarboxylase | |
1 | 5 | |||||||
| MIRT471495 | PDE4D | phosphodiesterase 4D | |
1 | 2 | |||||||
| MIRT471956 | NR6A1 | nuclear receptor subfamily 6 group A member 1 | |
1 | 1 | |||||||
| MIRT472263 | NFIC | nuclear factor I C | |
1 | 1 | |||||||
| MIRT472665 | NAA25 | N(alpha)-acetyltransferase 25, NatB auxiliary subunit | |
1 | 2 | |||||||
| MIRT474318 | LAMC1 | laminin subunit gamma 1 | |
1 | 1 | |||||||
| MIRT474828 | KIAA0226 | RUN and cysteine rich domain containing beclin 1 interacting protein | |
1 | 1 | |||||||
| MIRT475068 | IVNS1ABP | influenza virus NS1A binding protein | |
1 | 3 | |||||||
| MIRT475123 | IPPK | inositol-pentakisphosphate 2-kinase | |
1 | 1 | |||||||
| MIRT475539 | HOXA3 | homeobox A3 | |
1 | 4 | |||||||
| MIRT475720 | HEYL | hes related family bHLH transcription factor with YRPW motif-like | |
1 | 1 | |||||||
| MIRT475843 | HDGF | heparin binding growth factor | |
1 | 2 | |||||||
| MIRT476259 | GNB1 | G protein subunit beta 1 | |
1 | 4 | |||||||
| MIRT476276 | GNAL | G protein subunit alpha L | |
1 | 3 | |||||||
| MIRT476698 | FURIN | furin, paired basic amino acid cleaving enzyme | |
1 | 1 | |||||||
| MIRT477565 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | |
1 | 4 | |||||||
| MIRT477849 | DYRK3 | dual specificity tyrosine phosphorylation regulated kinase 3 | |
1 | 1 | |||||||
| MIRT478911 | CPSF7 | cleavage and polyadenylation specific factor 7 | |
1 | 3 | |||||||
| MIRT479457 | CDK6 | cyclin dependent kinase 6 | |
1 | 1 | |||||||
| MIRT479988 | CARD10 | caspase recruitment domain family member 10 | |
1 | 1 | |||||||
| MIRT481181 | AVL9 | AVL9 cell migration associated | |
1 | 3 | |||||||
| MIRT482370 | AGO2 | argonaute 2, RISC catalytic component | |
1 | 1 | |||||||
| MIRT482556 | ABL2 | ABL proto-oncogene 2, non-receptor tyrosine kinase | |
1 | 5 | |||||||
| MIRT482581 | ABHD2 | abhydrolase domain containing 2 | |
1 | 1 | |||||||
| MIRT484778 | ABCC6 | ATP binding cassette subfamily C member 6 | |
1 | 2 | |||||||
| MIRT485215 | PRKAR2A | protein kinase cAMP-dependent type II regulatory subunit alpha | |
1 | 4 | |||||||
| MIRT487394 | C10orf54 | V-set immunoregulatory receptor | |
1 | 1 | |||||||
| MIRT492715 | PHYHIP | phytanoyl-CoA 2-hydroxylase interacting protein | |
1 | 1 | |||||||
| MIRT494354 | CASKIN1 | CASK interacting protein 1 | |
1 | 1 | |||||||
| MIRT495146 | ZNRF1 | zinc and ring finger 1 | |
1 | 1 | |||||||
| MIRT496019 | CD180 | CD180 molecule | |
1 | 1 | |||||||
| MIRT497776 | KIAA0895 | KIAA0895 | |
1 | 1 | |||||||
| MIRT498984 | ORC4 | origin recognition complex subunit 4 | |
1 | 4 | |||||||
| MIRT499456 | ODF2L | outer dense fiber of sperm tails 2 like | |
1 | 4 | |||||||
| MIRT499619 | DNAJA1 | DnaJ heat shock protein family (Hsp40) member A1 | |
1 | 4 | |||||||
| MIRT500097 | L2HGDH | L-2-hydroxyglutarate dehydrogenase | |
1 | 4 | |||||||
| MIRT500321 | ZNF622 | zinc finger protein 622 | |
1 | 5 | |||||||
| MIRT500425 | ZMAT3 | zinc finger matrin-type 3 | |
1 | 2 | |||||||
| MIRT500580 | USP53 | ubiquitin specific peptidase 53 | |
1 | 1 | |||||||
| MIRT500860 | SYPL1 | synaptophysin like 1 | |
1 | 4 | |||||||
| MIRT500936 | SRPR | SRP receptor alpha subunit | |
1 | 4 | |||||||
| MIRT500953 | SREK1 | splicing regulatory glutamic acid and lysine rich protein 1 | |
1 | 4 | |||||||
| MIRT501089 | SMAD7 | SMAD family member 7 | |
1 | 4 | |||||||
| MIRT501506 | PRICKLE2 | prickle planar cell polarity protein 2 | |
1 | 1 | |||||||
| MIRT502038 | LRIG2 | leucine rich repeats and immunoglobulin like domains 2 | |
1 | 1 | |||||||
| MIRT502151 | KIF5B | kinesin family member 5B | |
1 | 5 | |||||||
| MIRT502496 | FAM122B | family with sequence similarity 122B | |
1 | 4 | |||||||
| MIRT502570 | E2F7 | E2F transcription factor 7 | |
1 | 6 | |||||||
| MIRT502643 | DDX3X | DEAD-box helicase 3, X-linked | |
1 | 4 | |||||||
| MIRT502922 | CDCA4 | cell division cycle associated 4 | |
1 | 5 | |||||||
| MIRT502950 | CDC37L1 | cell division cycle 37 like 1 | |
1 | 5 | |||||||
| MIRT503140 | ATG9A | autophagy related 9A | |
1 | 4 | |||||||
| MIRT504338 | ASGR2 | asialoglycoprotein receptor 2 | |
1 | 3 | |||||||
| MIRT504540 | ZNF620 | zinc finger protein 620 | |
1 | 3 | |||||||
| MIRT504855 | HAUS3 | HAUS augmin like complex subunit 3 | |
1 | 3 | |||||||
| MIRT505116 | YTHDC1 | YTH domain containing 1 | |
1 | 3 | |||||||
| MIRT505349 | TMEM245 | transmembrane protein 245 | |
1 | 3 | |||||||
| MIRT505398 | TMEM100 | transmembrane protein 100 | |
1 | 1 | |||||||
| MIRT505505 | SRSF1 | serine and arginine rich splicing factor 1 | |
1 | 3 | |||||||
| MIRT505549 | SNX16 | sorting nexin 16 | |
1 | 3 | |||||||
| MIRT505686 | SESTD1 | SEC14 and spectrin domain containing 1 | |
1 | 3 | |||||||
| MIRT505911 | RIMS3 | regulating synaptic membrane exocytosis 3 | |
1 | 3 | |||||||
| MIRT505930 | RCAN3 | RCAN family member 3 | |
1 | 2 | |||||||
| MIRT506112 | PPIG | peptidylprolyl isomerase G | |
1 | 3 | |||||||
| MIRT506138 | PLRG1 | pleiotropic regulator 1 | |
1 | 2 | |||||||
| MIRT506166 | PLAG1 | PLAG1 zinc finger | |
1 | 5 | |||||||
| MIRT506194 | PHKA1 | phosphorylase kinase regulatory subunit alpha 1 | |
1 | 3 | |||||||
| MIRT506487 | MYO5A | myosin VA | |
1 | 4 | |||||||
| MIRT506854 | KIF23 | kinesin family member 23 | |
1 | 4 | |||||||
| MIRT507002 | HNRNPDL | heterogeneous nuclear ribonucleoprotein D like | |
1 | 3 | |||||||
| MIRT507820 | CDK1 | cyclin dependent kinase 1 | |
1 | 3 | |||||||
| MIRT507853 | CCNE2 | cyclin E2 | |
1 | 3 | |||||||
| MIRT507877 | CBX6 | chromobox 6 | |
1 | 1 | |||||||
| MIRT508041 | AXIN2 | axin 2 | |
1 | 3 | |||||||
| MIRT508644 | CASK | calcium/calmodulin dependent serine protein kinase | |
1 | 2 | |||||||
| MIRT509368 | DMPK | DM1 protein kinase | |
1 | 5 | |||||||
| MIRT509693 | ATAD5 | ATPase family, AAA domain containing 5 | |
1 | 2 | |||||||
| MIRT510047 | AKR1B10 | aldo-keto reductase family 1 member B10 | |
1 | 2 | |||||||
| MIRT511847 | GPATCH8 | G-patch domain containing 8 | |
1 | 3 | |||||||
| MIRT512288 | ARHGDIA | Rho GDP dissociation inhibitor alpha | |
1 | 4 | |||||||
| MIRT512646 | CPEB3 | cytoplasmic polyadenylation element binding protein 3 | |
1 | 3 | |||||||
| MIRT513854 | JARID2 | jumonji and AT-rich interaction domain containing 2 | |
1 | 4 | |||||||
| MIRT514020 | CAMSAP1 | calmodulin regulated spectrin associated protein 1 | |
1 | 3 | |||||||
| MIRT514042 | ATG14 | autophagy related 14 | |
1 | 1 | |||||||
| MIRT518095 | TRIM35 | tripartite motif containing 35 | |
1 | 1 | |||||||
| MIRT518533 | FLCN | folliculin | |
1 | 3 | |||||||
| MIRT518998 | NNT | nicotinamide nucleotide transhydrogenase | |
1 | 2 | |||||||
| MIRT521055 | SLC2A3 | solute carrier family 2 member 3 | |
1 | 2 | |||||||
| MIRT521207 | SBNO1 | strawberry notch homolog 1 | |
1 | 3 | |||||||
| MIRT521818 | POM121C | POM121 transmembrane nucleoporin C | |
1 | 1 | |||||||
| MIRT522098 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | |
1 | 3 | |||||||
| MIRT522778 | LAMP2 | lysosomal associated membrane protein 2 | |
1 | 3 | |||||||
| MIRT537815 | EFNB2 | ephrin B2 | |
1 | 2 | |||||||
| MIRT539902 | RPL14 | ribosomal protein L14 | |
1 | 2 | |||||||
| MIRT540847 | GNAT1 | G protein subunit alpha transducin 1 | |
1 | 2 | |||||||
| MIRT541217 | HOXA10 | homeobox A10 | |
1 | 1 | |||||||
| MIRT541432 | CBX4 | chromobox 4 | |
1 | 2 | |||||||
| MIRT542810 | PHC3 | polyhomeotic homolog 3 | |
1 | 2 | |||||||
| MIRT542837 | PDCD1 | programmed cell death 1 | |
1 | 3 | |||||||
| MIRT543062 | BAZ2A | bromodomain adjacent to zinc finger domain 2A | |
1 | 1 | |||||||
| MIRT543310 | ZNF585B | zinc finger protein 585B | |
1 | 1 | |||||||
| MIRT543411 | ANAPC13 | anaphase promoting complex subunit 13 | |
1 | 1 | |||||||
| MIRT543529 | PRSS21 | protease, serine 21 | |
1 | 1 | |||||||
| MIRT543801 | RALGAPB | Ral GTPase activating protein non-catalytic beta subunit | |
1 | 2 | |||||||
| MIRT543839 | GSG1 | germ cell associated 1 | |
1 | 1 | |||||||
| MIRT544575 | POLDIP3 | DNA polymerase delta interacting protein 3 | |
1 | 1 | |||||||
| MIRT544593 | AP5Z1 | adaptor related protein complex 5 zeta 1 subunit | |
1 | 2 | |||||||
| MIRT544916 | CLSPN | claspin | |
1 | 1 | |||||||
| MIRT544969 | UGT2B4 | UDP glucuronosyltransferase family 2 member B4 | |
1 | 1 | |||||||
| MIRT545190 | MAP4K2 | mitogen-activated protein kinase kinase kinase kinase 2 | |
1 | 2 | |||||||
| MIRT545351 | CCDC83 | coiled-coil domain containing 83 | |
1 | 1 | |||||||
| MIRT545686 | DECR1 | 2,4-dienoyl-CoA reductase 1 | |
1 | 1 | |||||||
| MIRT545961 | ZBTB10 | zinc finger and BTB domain containing 10 | |
1 | 1 | |||||||
| MIRT545973 | YWHAQ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta | |
1 | 1 | |||||||
| MIRT546118 | USP48 | ubiquitin specific peptidase 48 | |
1 | 2 | |||||||
| MIRT546611 | SALL1 | spalt like transcription factor 1 | |
1 | 2 | |||||||
| MIRT546619 | RUNX1T1 | RUNX1 translocation partner 1 | |
1 | 1 | |||||||
| MIRT546640 | RTN4 | reticulon 4 | |
1 | 1 | |||||||
| MIRT547069 | PNISR | PNN interacting serine and arginine rich protein | |
1 | 2 | |||||||
| MIRT547131 | PHLPP2 | PH domain and leucine rich repeat protein phosphatase 2 | |
1 | 1 | |||||||
| MIRT547233 | PAG1 | phosphoprotein membrane anchor with glycosphingolipid microdomains 1 | |
1 | 2 | |||||||
| MIRT547305 | NUCKS1 | nuclear casein kinase and cyclin dependent kinase substrate 1 | |
1 | 2 | |||||||
| MIRT547406 | MKX | mohawk homeobox | |
1 | 1 | |||||||
| MIRT547463 | MBD4 | methyl-CpG binding domain 4, DNA glycosylase | |
1 | 1 | |||||||
| MIRT547546 | LRRFIP2 | LRR binding FLII interacting protein 2 | |
1 | 2 | |||||||
| MIRT547661 | KPNA3 | karyopherin subunit alpha 3 | |
1 | 1 | |||||||
| MIRT547702 | KPNA1 | karyopherin subunit alpha 1 | |
1 | 2 | |||||||
| MIRT547968 | HIGD1A | HIG1 hypoxia inducible domain family member 1A | |
1 | 2 | |||||||
| MIRT548001 | HCFC2 | host cell factor C2 | |
1 | 2 | |||||||
| MIRT548018 | GRB2 | growth factor receptor bound protein 2 | |
1 | 2 | |||||||
| MIRT548219 | FKBP1A | FK506 binding protein 1A | |
1 | 1 | |||||||
| MIRT548275 | FBXL20 | F-box and leucine rich repeat protein 20 | |
1 | 1 | |||||||
| MIRT548727 | CRK | CRK proto-oncogene, adaptor protein | |
1 | 1 | |||||||
| MIRT548809 | CLIP4 | CAP-Gly domain containing linker protein family member 4 | |
1 | 2 | |||||||
| MIRT548946 | CDK17 | cyclin dependent kinase 17 | |
1 | 2 | |||||||
| MIRT549076 | CACUL1 | CDK2 associated cullin domain 1 | |
1 | 1 | |||||||
| MIRT549123 | C11orf24 | chromosome 11 open reading frame 24 | |
1 | 2 | |||||||
| MIRT549278 | ASH1L | ASH1 like histone lysine methyltransferase | |
1 | 2 | |||||||
| MIRT549389 | AMOT | angiomotin | |
1 | 1 | |||||||
| MIRT550405 | SLC29A1 | solute carrier family 29 member 1 (Augustine blood group) | |
1 | 2 | |||||||
| MIRT550470 | OSCAR | osteoclast associated, immunoglobulin-like receptor | |
1 | 2 | |||||||
| MIRT550619 | MTHFR | methylenetetrahydrofolate reductase | |
1 | 1 | |||||||
| MIRT550827 | FAM229B | family with sequence similarity 229 member B | |
1 | 1 | |||||||
| MIRT551383 | EPM2AIP1 | EPM2A interacting protein 1 | |
1 | 1 | |||||||
| MIRT551621 | ZNF267 | zinc finger protein 267 | |
1 | 1 | |||||||
| MIRT551740 | SSU72 | SSU72 homolog, RNA polymerase II CTD phosphatase | |
1 | 1 | |||||||
| MIRT552039 | DNAJC10 | DnaJ heat shock protein family (Hsp40) member C10 | |
1 | 1 | |||||||
| MIRT552348 | ZNF704 | zinc finger protein 704 | |
1 | 1 | |||||||
| MIRT552744 | YRDC | yrdC N6-threonylcarbamoyltransferase domain containing | |
1 | 1 | |||||||
| MIRT553442 | TPM3 | tropomyosin 3 | |
1 | 1 | |||||||
| MIRT553565 | TMEM161B | transmembrane protein 161B | |
1 | 1 | |||||||
| MIRT553620 | TM7SF3 | transmembrane 7 superfamily member 3 | |
1 | 1 | |||||||
| MIRT553777 | TAF13 | TATA-box binding protein associated factor 13 | |
1 | 2 | |||||||
| MIRT553812 | SZRD1 | SUZ RNA binding domain containing 1 | |
1 | 2 | |||||||
| MIRT554702 | RNF149 | ring finger protein 149 | |
1 | 1 | |||||||
| MIRT554965 | RACGAP1 | Rac GTPase activating protein 1 | |
1 | 1 | |||||||
| MIRT555035 | RAB23 | RAB23, member RAS oncogene family | |
1 | 1 | |||||||
| MIRT555143 | PTPRD | protein tyrosine phosphatase, receptor type D | |
1 | 1 | |||||||
| MIRT555229 | PRKAA1 | protein kinase AMP-activated catalytic subunit alpha 1 | |
1 | 2 | |||||||
| MIRT555278 | PRDM4 | PR/SET domain 4 | |
1 | 1 | |||||||
| MIRT555431 | PPAP2B | phospholipid phosphatase 3 | |
1 | 1 | |||||||
| MIRT556385 | LURAP1L | leucine rich adaptor protein 1 like | |
1 | 1 | |||||||
| MIRT556861 | KANK1 | KN motif and ankyrin repeat domains 1 | |
1 | 2 | |||||||
| MIRT557284 | HIST2H2BE | histone cluster 2 H2B family member e | |
1 | 1 | |||||||
| MIRT557484 | GPR27 | G protein-coupled receptor 27 | |
1 | 2 | |||||||
| MIRT558041 | EXT1 | exostosin glycosyltransferase 1 | |
1 | 1 | |||||||
| MIRT558511 | CYP26B1 | cytochrome P450 family 26 subfamily B member 1 | |
1 | 2 | |||||||
| MIRT558664 | CNKSR3 | CNKSR family member 3 | |
1 | 1 | |||||||
| MIRT559006 | CA8 | carbonic anhydrase 8 | |
1 | 1 | |||||||
| MIRT559155 | BTN3A3 | butyrophilin subfamily 3 member A3 | |
1 | 1 | |||||||
| MIRT559536 | ARHGAP12 | Rho GTPase activating protein 12 | |
1 | 3 | |||||||
| MIRT560855 | OSBPL3 | oxysterol binding protein like 3 | |
1 | 1 | |||||||
| MIRT561153 | KRT33B | keratin 33B | |
1 | 1 | |||||||
| MIRT561404 | TUBB2A | tubulin beta 2A class IIa | |
1 | 1 | |||||||
| MIRT561878 | MSANTD4 | Myb/SANT DNA binding domain containing 4 with coiled-coils | |
1 | 1 | |||||||
| MIRT562031 | LANCL1 | LanC like 1 | |
1 | 1 | |||||||
| MIRT562204 | HNRNPA2B1 | heterogeneous nuclear ribonucleoprotein A2/B1 | |
1 | 1 | |||||||
| MIRT562881 | KIAA1456 | KIAA1456 | |
1 | 1 | |||||||
| MIRT563090 | SLC25A12 | solute carrier family 25 member 12 | |
1 | 2 | |||||||
| MIRT563507 | DLGAP3 | DLG associated protein 3 | |
1 | 1 | |||||||
| MIRT563705 | THRAP3 | thyroid hormone receptor associated protein 3 | |
1 | 1 | |||||||
| MIRT563849 | SMDT1 | single-pass membrane protein with aspartate rich tail 1 | |
1 | 1 | |||||||
| MIRT563900 | RAPH1 | Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 | |
1 | 1 | |||||||
| MIRT564336 | CCNT1 | cyclin T1 | |
1 | 1 | |||||||
| MIRT564482 | ZNF391 | zinc finger protein 391 | |
1 | 1 | |||||||
| MIRT564556 | CCDC80 | coiled-coil domain containing 80 | |
1 | 1 | |||||||
| MIRT564838 | ZBTB16 | zinc finger and BTB domain containing 16 | |
1 | 1 | |||||||
| MIRT564954 | XKR7 | XK related 7 | |
1 | 1 | |||||||
| MIRT564987 | WNK3 | WNK lysine deficient protein kinase 3 | |
1 | 1 | |||||||
| MIRT565041 | VAV2 | vav guanine nucleotide exchange factor 2 | |
1 | 1 | |||||||
| MIRT565400 | TGFBR3 | transforming growth factor beta receptor 3 | |
1 | 1 | |||||||
| MIRT566122 | RASEF | RAS and EF-hand domain containing | |
1 | 1 | |||||||
| MIRT566654 | NCKAP1 | NCK associated protein 1 | |
1 | 1 | |||||||
| MIRT566834 | MAP3K7 | mitogen-activated protein kinase kinase kinase 7 | |
1 | 1 | |||||||
| MIRT567017 | KLHL15 | kelch like family member 15 | |
1 | 1 | |||||||
| MIRT567450 | GNG12 | G protein subunit gamma 12 | |
1 | 1 | |||||||
| MIRT567482 | FZD9 | frizzled class receptor 9 | |
1 | 1 | |||||||
| MIRT568025 | CMTM4 | CKLF like MARVEL transmembrane domain containing 4 | |
1 | 1 | |||||||
| MIRT568143 | CCDC88C | coiled-coil domain containing 88C | |
1 | 1 | |||||||
| MIRT568477 | ARMC12 | armadillo repeat containing 12 | |
1 | 1 | |||||||
| MIRT568575 | AHNAK2 | AHNAK nucleoprotein 2 | |
1 | 1 | |||||||
| MIRT56 | ||||||||||||