miRTarBase - #MIRT000910 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TIA1   
Synonyms TIA-1, WDM
Description TIA1 cytotoxic granule associated RNA binding protein
Transcript NM_022037   
Other Transcripts NM_022173   
Expression
Putative miRNA Targets on TIA1
3'UTR of TIA1
(miRNA target sites are highlighted)
>TIA1|NM_022037|3'UTR
   1 ATAAGGACTCCAGAATCTAAAGCCAGTGGCTTGAGGCTACAGGGAGTGTAGTAAAGCCGTTGTTTACTTAAAGATTTATC
  81 AAATCAGTCAGTGCAAATGTCAGATACAATGTATTTATTTAAAAGATTCATTTTTAATCATGAAATTACTTATCATCCAC
 161 ATTGTTTTAAAAAGAAACAAGATGCTGGATGTCTGCCAATTTTTGCCTTCATTACCTTTTTTGATAAAGTTTCTCAGATC
 241 CTTGTTTCAAACACAAATGCAGGGATTGCTGCCACTTTTTAACTATTAAGAGGCAGAAAATTGCACAATATTGAACTTTT
 321 TTCCACTGAAGTAGTGTGCAGTTCTAGTTTGCATTCCTGATATGATTTAAAACATGTAATATAAAGATGTTAAAAAAAAA
 401 AACCAAAACTGTGCAGAGTCTAGAAGTTGTTTGTCATCTTCAGCTTGTGCACAATTCTGTTTTAGGTTAAAAAAAGGCAT
 481 TGTTTGAGCTGTCCCATCTCCACTGTTATCCCTTTGGGGTTTTTTAATATAAATTATTAGTTTACATCATTTTTGTATCT
 561 ACATCTTTTTTCACAAATTTGTCTTGCCTTATTAAAGTTCTGTAAAATATACTTAAATGGAAAAAATGATGTTCATTTAG
 641 ATTGAAAACTTTTCTCAGATGGATTGATAATTGCATTCATCTTGTGTTTTATATGAGAAGGTGCCTCAAGAATTTCCTGT
 721 TGGATTTGTTTAAAAGGATTTTTATCTTTCGTGATAAACTTTGCTGTGTACCAGGAACTATAAAAACAAAAACTTGTTAC
 801 TAAAGAAAATATCTGAAATGTGATAAGTTCTTATGCCATGTTAATTTCATGTGTCAACTTCAACATTTACATGTATTATT
 881 TCATTATGTAAAATGTTTTAGCAATTTAATATTTTGCACAGTTAGCAAACTTTGTATGTCATTTCCTTCAAGGCATCATG
 961 CAGAGTTGACATGAGATTTATAAGGTTTTAAGTTGTTTGCATGTGAAAATCAAATACATACTTTGGTAGTCTTTGAATAC
1041 AAAGTCATCTGCTCTTGTTTTTCAAGAATTTTGAGACACAAAGTTGTATGTAAAGGAATATATTAATTTGCCGTTTTCTA
1121 GGTAGATTTGCTCAAAAAGAGTGAATCAACTTAATATGTACAAATGATAGCTGTGAAACTGTAGAATATCTTTGTGTCAG
1201 GCTTGGAGTTCATTGTGACCTCCAAATTTTGCCTGAAGGACCAGCTGGGCAAAGCATCTTTTAAATGTTCAGAGGCCAAA
1281 AGATAAACAAAAAAAAAACCTTAAAATCCTACCTCTTTAAACAGCCTTCAGATAAGAGAATCCTCAGTGCAATCATTATT
1361 TTGATTCGTTTGGTACCTGTTTTCCTGGAGTTCCCGATTTTATTATTTTGGGGTGGCTCCAAGCATTAAGAGGTTTAATC
1441 TTTGATGGCATTGTTCTAGTTTTGAAATTTCTAGTATATTTCAGAGTCTCTTAGAAGACTTGTGTGGGAAGTTTCACTTT
1521 GTTTTCAGTGAAGATCACAAACCTCCTTCTTCCTTTACTCAAGAGGAAAGGTCCCAGTATACATATTTGAATGGTTGATG
1601 GTTTTCAAGACCTTCAGGGAGCTCCCTGCATTTTACCTAGAAACAGAAAAGGCCCGCAAAATCTTAAGTTTCCTGGCCTG
1681 CATTTCCCGGGTAGGGGCAAATGACTCCAAGCTGGTCTCTAAGCCAATACCCTTATAAACCAGAGCCCAGGAAAGACAGC
1761 TCGAGTGTATAATTCTCTGGAGCTCAATTCTATGCAGTTGTGCTGATATTTCATTAAGTCACTGTGTATTTTTAAGTGTT
1841 GATACATTAAAAGTCGCTTTATGGAAGATGAGTAAATTTTTTAAATACTTGGAAATTTTATTTCCTTGTTAACTTCTACA
1921 GATCAGGGCATGCAACCAAAAGCAGCTTAAATGAAATATTTTAAAATAAAATATCAGGAAGCTATTTTTAGATTTCTTCT
2001 GGCTTATGTTTCTACTTTAGGACCCTCATTGTTCTCTTATTAAAAAAAATTATTTCCTGTGCATCTCATGGACTGCAGGG
2081 TAAATTATTTGGGCATAAATAATTTAAATAGTTTTCTTTCATTTTGACTATCTCCAGTAATAACAGTTTTTATTATCCAG
2161 CATATTGGCTTATTGCACAAATCTTAAAATGTACATTGACTACTTTCTGAGAAGAAAGTGGTATCAGTACTCATGATGAA
2241 AAGGTTACTACTGAACAAATTCACATTTCAGGAACACCTCTATCTTTGGTTTAAATCTTACTCTTAGTTTTTCCGTCTAA
2321 AAATCATACTGGTATTAGTATCAGGTAAGGAAATTAAAGTTTTTAAAATGGTTTCATTCTCTGCAATATGCAAAATTTAG
2401 ATTTTACTTTCTGGTACTGTAAAGAACCTGAAGTGATTTACACTTAATGGGTGATTAATCCAGTATTCTTTACCCTGAAT
2481 GTTTGGATATTAAAGTTCCTTTATGTTTTCTATAACCTGTGGGATCTTCTTGCAGTGATTATTGTGTGTGAGATTTTTTT
2561 TCTTTTTGGTCTATCCATATTGTTATATTCACTCAGGTATTTTTTTTTTAATCTTATTCCAGAATCAGTGGTTTATATTG
2641 GGTTACTGTTTAACACCAAATGGAATTGGCATTCTGCAGATTTAATTAATTATGAAACCAGGGTCTCATTTTCCTTGCTG
2721 ATACTTGTTGAAAATGAGATTCACATTCTAGTCTTTATTTTCCTCCTGTTTTGTCCCTGTGCTTGTACATCTTCCTTTTA
2801 TTTGTGTGTTATAGTTCTATTCCATTTGAGAAGGCAGTTGGTAAGAACTAGATTGCATGTACAAAGACAGGTTTACTAAG
2881 TGCTGTACAGTGGTCCTGAGGTTACAGTTGAATTAGAAAAACGAAATGTACTTACAGGAAATAAGAAAGCAAACCTTTCA
2961 AATGAGAGTGATGATTTCTTTAAAAAAAATCAGTTTTTTTCTCTCAAATAATGTTCTTTATTTCACGAAATCGTCAATCT
3041 TAAGCATGAGCAGGGATAAACAACTCCTAGAAGGAACTCAATTCATTCTTCCTGGATTTTCTCTGTTGTTAAATCACAAA
3121 AATGATAGTCCCCAATCGTTTCTTTATAGGAGGTTATTACATTTCATTACAGTCACTGCATTTTGACTGTTGTGTTTAGA
3201 ATTTGAATGTACATCCAAAATGATGAGTTTCAATTTAAGAGCCTTAATAAAATGTGTGAGTGTGTCTCAATTGAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUG-GUAAUACACGACGau 5'
            ||||: ||  :  ||||||  
Target 5' caCAAATGCAGGGATTGCTGCca 3'
252 - 274 132.00 -13.50
2
miRNA  3' guGUUU-GGUAAUACACGACGau 5'
            ||:: ::| || ||||||:  
Target 5' gaCAGGTTTACTAAGTGCTGTac 3'
2866 - 2888 124.00 -12.30
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            | |  || | ||||||| | 
Target 5' ttCTATGCAGT-TGTGCTGATa 3'
1788 - 1808 123.00 -11.02
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30148646 6 COSMIC
COSN28247947 28 COSMIC
COSN30478324 32 COSMIC
COSN1852934 37 COSMIC
COSN31595709 41 COSMIC
COSN30189600 86 COSMIC
COSN24298719 158 COSMIC
COSN14004759 174 COSMIC
COSN30496665 185 COSMIC
COSN30103138 217 COSMIC
COSN28935972 392 COSMIC
COSN6684266 447 COSMIC
COSN31545648 486 COSMIC
COSN31550734 709 COSMIC
COSN23378595 816 COSMIC
COSN30161895 966 COSMIC
COSN31482175 1000 COSMIC
COSN31490328 1054 COSMIC
COSN21602161 1146 COSMIC
COSN30357352 1320 COSMIC
COSN9385293 1515 COSMIC
COSN16894971 1617 COSMIC
COSN10005921 1963 COSMIC
COSN25985405 2126 COSMIC
COSN20808841 2349 COSMIC
COSN30223378 2678 COSMIC
COSN5031738 2790 COSMIC
COSN9385292 2791 COSMIC
COSN5955341 2909 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1384079559 3 dbSNP
rs1467858466 6 dbSNP
rs1191531178 13 dbSNP
rs1181159998 19 dbSNP
rs1420839777 20 dbSNP
rs1251117404 25 dbSNP
rs1195062356 29 dbSNP
rs753303341 30 dbSNP
rs1440583970 33 dbSNP
rs745901576 33 dbSNP
rs765460029 33 dbSNP
rs1249904045 38 dbSNP
rs202071613 39 dbSNP
rs1014671596 41 dbSNP
rs766155218 44 dbSNP
rs1314485196 46 dbSNP
rs1016630302 47 dbSNP
rs367908555 48 dbSNP
rs1394408226 50 dbSNP
rs1439074176 57 dbSNP
rs1332098697 58 dbSNP
rs1449140426 59 dbSNP
rs867848399 80 dbSNP
rs1163338752 82 dbSNP
rs1004269257 83 dbSNP
rs951056088 89 dbSNP
rs1229592113 94 dbSNP
rs780518447 108 dbSNP
rs1404527411 127 dbSNP
rs1034948717 128 dbSNP
rs1003428828 129 dbSNP
rs1467982835 131 dbSNP
rs769364891 139 dbSNP
rs1463089696 156 dbSNP
rs754102968 158 dbSNP
rs1239801700 159 dbSNP
rs1055819472 164 dbSNP
rs1181328503 174 dbSNP
rs1231463563 181 dbSNP
rs1473783564 184 dbSNP
rs1379733626 191 dbSNP
rs1001549566 206 dbSNP
rs899236124 207 dbSNP
rs1460355931 211 dbSNP
rs1173514776 214 dbSNP
rs1023472033 223 dbSNP
rs1327749214 228 dbSNP
rs745461192 229 dbSNP
rs780584325 231 dbSNP
rs940862078 238 dbSNP
rs1052505450 248 dbSNP
rs1459636067 250 dbSNP
rs535415928 254 dbSNP
rs1242390947 258 dbSNP
rs935341194 260 dbSNP
rs1259967165 268 dbSNP
rs890428092 272 dbSNP
rs1195072184 281 dbSNP
rs1339828499 281 dbSNP
rs1271061865 283 dbSNP
rs1051969727 284 dbSNP
rs1444373474 285 dbSNP
rs569946456 286 dbSNP
rs1256866025 290 dbSNP
rs1418578540 302 dbSNP
rs1474289708 308 dbSNP
rs549634688 317 dbSNP
rs533165816 325 dbSNP
rs1238121012 326 dbSNP
rs1461747196 327 dbSNP
rs1353219361 346 dbSNP
rs973529708 352 dbSNP
rs1166524167 354 dbSNP
rs941143827 358 dbSNP
rs1415842266 359 dbSNP
rs909641880 361 dbSNP
rs1313165799 365 dbSNP
rs1380686322 369 dbSNP
rs1336569678 376 dbSNP
rs982524712 381 dbSNP
rs1397152562 384 dbSNP
rs13411462 392 dbSNP
rs1326955641 393 dbSNP
rs74979052 402 dbSNP
rs1211826079 403 dbSNP
rs1304312320 403 dbSNP
rs547535312 403 dbSNP
rs1279964504 408 dbSNP
rs969288583 411 dbSNP
rs1023494850 412 dbSNP
rs1218904388 413 dbSNP
rs757213800 414 dbSNP
rs186075663 430 dbSNP
rs1428476596 432 dbSNP
rs1380519134 435 dbSNP
rs1160101102 438 dbSNP
rs1545357 447 dbSNP
rs1173876292 449 dbSNP
rs1031510182 457 dbSNP
rs999576520 460 dbSNP
rs1188107881 465 dbSNP
rs890495468 465 dbSNP
rs1425462476 467 dbSNP
rs960048691 469 dbSNP
rs1293393793 476 dbSNP
rs1332601585 476 dbSNP
rs35824578 476 dbSNP
rs1051707381 481 dbSNP
rs567046885 489 dbSNP
rs1345996900 493 dbSNP
rs1242359764 495 dbSNP
rs1488525405 504 dbSNP
rs1485612562 506 dbSNP
rs570520560 509 dbSNP
rs1203869292 510 dbSNP
rs1286933087 512 dbSNP
rs1059359 515 dbSNP
rs932263771 521 dbSNP
rs1270185826 523 dbSNP
rs900745980 525 dbSNP
rs1219076346 527 dbSNP
rs182281774 533 dbSNP
rs1452207020 535 dbSNP
rs1160134594 540 dbSNP
rs1363837661 543 dbSNP
rs942207054 545 dbSNP
rs1001475925 554 dbSNP
rs899291460 555 dbSNP
rs1392811336 557 dbSNP
rs777733755 563 dbSNP
rs982944015 569 dbSNP
rs1308029477 572 dbSNP
rs576533204 576 dbSNP
rs1245668031 577 dbSNP
rs758279236 587 dbSNP
rs927650044 589 dbSNP
rs981762383 592 dbSNP
rs764136444 600 dbSNP
rs1294135091 610 dbSNP
rs1399720995 612 dbSNP
rs1023568456 617 dbSNP
rs3207592 618 dbSNP
rs563201949 621 dbSNP
rs1251494031 625 dbSNP
rs1052461103 626 dbSNP
rs531080623 627 dbSNP
rs1250865865 632 dbSNP
rs1422388091 632 dbSNP
rs933567706 634 dbSNP
rs922161764 635 dbSNP
rs989376446 642 dbSNP
rs1461914632 643 dbSNP
rs1164187751 654 dbSNP
rs1391977862 654 dbSNP
rs1364626544 661 dbSNP
rs1448806429 661 dbSNP
rs1298950254 664 dbSNP
rs1372891843 665 dbSNP
rs1314982786 686 dbSNP
rs562032454 695 dbSNP
rs1038750347 703 dbSNP
rs958112786 707 dbSNP
rs1030831037 712 dbSNP
rs925024894 718 dbSNP
rs1000050581 719 dbSNP
rs1371253167 720 dbSNP
rs1174923609 742 dbSNP
rs945213942 744 dbSNP
rs1187134090 750 dbSNP
rs374540991 751 dbSNP
rs917734995 764 dbSNP
rs1170889438 766 dbSNP
rs200131886 772 dbSNP
rs1030312952 775 dbSNP
rs996153056 776 dbSNP
rs1376136534 788 dbSNP
rs1414305135 791 dbSNP
rs139816575 793 dbSNP
rs1342941476 823 dbSNP
rs115151638 827 dbSNP
rs1295337473 830 dbSNP
rs1201968362 834 dbSNP
rs1282102780 835 dbSNP
rs1485706247 836 dbSNP
rs1209550353 846 dbSNP
rs1289519370 849 dbSNP
rs1210499579 857 dbSNP
rs1358583126 863 dbSNP
rs1006436884 871 dbSNP
rs886647929 875 dbSNP
rs1376305410 878 dbSNP
rs1434105645 887 dbSNP
rs963310662 891 dbSNP
rs1016769820 894 dbSNP
rs1218600173 901 dbSNP
rs1341467419 902 dbSNP
rs1432082739 904 dbSNP
rs1280465006 905 dbSNP
rs1360310958 917 dbSNP
rs1221353146 922 dbSNP
rs548797835 923 dbSNP
rs1004940241 929 dbSNP
rs1348163914 936 dbSNP
rs1403530758 936 dbSNP
rs375233375 940 dbSNP
rs1277605987 945 dbSNP
rs1448263457 949 dbSNP
rs1030525150 952 dbSNP
rs756381096 960 dbSNP
rs753006284 961 dbSNP
rs1039262123 962 dbSNP
rs1454012618 975 dbSNP
rs1047884429 995 dbSNP
rs1172060070 1000 dbSNP
rs1410213685 1002 dbSNP
rs936328656 1009 dbSNP
rs1159005163 1010 dbSNP
rs1343965144 1014 dbSNP
rs1443482831 1017 dbSNP
rs1327034349 1018 dbSNP
rs1371219354 1020 dbSNP
rs145951149 1024 dbSNP
rs927715364 1026 dbSNP
rs1046149342 1029 dbSNP
rs541155539 1037 dbSNP
rs1042548777 1041 dbSNP
rs1223863128 1047 dbSNP
rs1167217452 1054 dbSNP
rs1215280079 1066 dbSNP
rs947707012 1067 dbSNP
rs1253372835 1077 dbSNP
rs916208360 1087 dbSNP
rs1467900504 1095 dbSNP
rs1466095240 1106 dbSNP
rs989841961 1112 dbSNP
rs752517176 1113 dbSNP
rs1470521682 1115 dbSNP
rs1158075423 1122 dbSNP
rs945169213 1124 dbSNP
rs957973451 1126 dbSNP
rs1394196188 1133 dbSNP
rs35656482 1139 dbSNP
rs923797865 1139 dbSNP
rs1321105149 1142 dbSNP
rs1337166422 1146 dbSNP
rs1442247070 1149 dbSNP
rs1278466186 1150 dbSNP
rs1246290700 1160 dbSNP
rs546593317 1165 dbSNP
rs1235027763 1173 dbSNP
rs937844081 1196 dbSNP
rs1453361013 1199 dbSNP
rs954522962 1200 dbSNP
rs879471506 1202 dbSNP
rs1211604362 1232 dbSNP
rs143986697 1245 dbSNP
rs1438643331 1250 dbSNP
rs963362555 1252 dbSNP
rs964685470 1257 dbSNP
rs1319171749 1266 dbSNP
rs1260619165 1281 dbSNP
rs1222053093 1282 dbSNP
rs1344765084 1284 dbSNP
rs1275003679 1288 dbSNP
rs1016266348 1289 dbSNP
rs1016245097 1294 dbSNP
rs11454237 1298 dbSNP
rs535658389 1298 dbSNP
rs1170036648 1299 dbSNP
rs1398124889 1299 dbSNP
rs200228436 1299 dbSNP
rs201526234 1299 dbSNP
rs568088484 1299 dbSNP
rs1333424704 1300 dbSNP
rs200781425 1301 dbSNP
rs776233750 1301 dbSNP
rs199557583 1303 dbSNP
rs886682838 1308 dbSNP
rs1354750991 1309 dbSNP
rs1242291374 1315 dbSNP
rs997685528 1319 dbSNP
rs528657370 1326 dbSNP
rs1339893620 1330 dbSNP
rs1195416718 1334 dbSNP
rs1446972622 1334 dbSNP
rs900635353 1335 dbSNP
rs1486658716 1338 dbSNP
rs1048387011 1346 dbSNP
rs569701579 1351 dbSNP
rs1001092465 1352 dbSNP
rs904084596 1353 dbSNP
rs1003054026 1358 dbSNP
rs945029196 1361 dbSNP
rs1475330561 1362 dbSNP
rs1166947312 1366 dbSNP
rs760819652 1368 dbSNP
rs1046179913 1370 dbSNP
rs947780430 1373 dbSNP
rs528099475 1396 dbSNP
rs1425647269 1405 dbSNP
rs1374724167 1408 dbSNP
rs1056578233 1411 dbSNP
rs1320257786 1421 dbSNP
rs916266300 1422 dbSNP
rs556080931 1424 dbSNP
rs1226434110 1438 dbSNP
rs1173327902 1446 dbSNP
rs1479117867 1450 dbSNP
rs1053443418 1452 dbSNP
rs1350358161 1453 dbSNP
rs1235047990 1454 dbSNP
rs936607375 1458 dbSNP
rs1458317832 1460 dbSNP
rs559869687 1462 dbSNP
rs750715081 1469 dbSNP
rs1202330460 1476 dbSNP
rs1263118773 1480 dbSNP
rs1446726570 1485 dbSNP
rs10175751 1486 dbSNP
rs954553774 1487 dbSNP
rs923069417 1490 dbSNP
rs570543045 1494 dbSNP
rs974839381 1495 dbSNP
rs547374857 1502 dbSNP
rs1464168376 1507 dbSNP
rs1160165213 1510 dbSNP
rs1385581420 1511 dbSNP
rs139774009 1514 dbSNP
rs1016709749 1520 dbSNP
rs1318317404 1521 dbSNP
rs908442787 1526 dbSNP
rs568563864 1535 dbSNP
rs1348097942 1537 dbSNP
rs1308156581 1539 dbSNP
rs1240173393 1541 dbSNP
rs983507815 1546 dbSNP
rs1261759695 1547 dbSNP
rs950746321 1548 dbSNP
rs767628817 1553 dbSNP
rs1334561153 1563 dbSNP
rs767953230 1573 dbSNP
rs762024596 1574 dbSNP
rs146389173 1579 dbSNP
rs1359723711 1580 dbSNP
rs976133485 1585 dbSNP
rs1430897836 1595 dbSNP
rs1335906176 1615 dbSNP
rs1023130385 1621 dbSNP
rs1358844382 1622 dbSNP
rs1017807747 1626 dbSNP
rs1396393606 1636 dbSNP
rs1461828078 1643 dbSNP
rs1012031124 1648 dbSNP
rs537552583 1648 dbSNP
rs894876909 1655 dbSNP
rs1053923382 1656 dbSNP
rs1180568209 1659 dbSNP
rs936363602 1661 dbSNP
rs1227068194 1662 dbSNP
rs1275660586 1666 dbSNP
rs1021621648 1667 dbSNP
rs769310080 1685 dbSNP
rs1042289115 1686 dbSNP
rs933237378 1688 dbSNP
rs1487321222 1689 dbSNP
rs1238595451 1691 dbSNP
rs1197227156 1695 dbSNP
rs1009238581 1696 dbSNP
rs896106368 1701 dbSNP
rs923144373 1703 dbSNP
rs763516207 1711 dbSNP
rs1056156489 1717 dbSNP
rs1001886489 1726 dbSNP
rs974536924 1727 dbSNP
rs1463691013 1731 dbSNP
rs577575387 1741 dbSNP
rs1395842191 1749 dbSNP
rs1216931807 1759 dbSNP
rs747930702 1759 dbSNP
rs1355165074 1761 dbSNP
rs563061808 1762 dbSNP
rs564730278 1763 dbSNP
rs985243842 1767 dbSNP
rs1309685996 1769 dbSNP
rs1229143578 1775 dbSNP
rs1251598450 1783 dbSNP
rs950748247 1787 dbSNP
rs1227283616 1788 dbSNP
rs1379797894 1792 dbSNP
rs1285943643 1798 dbSNP
rs1026730134 1803 dbSNP
rs746208868 1806 dbSNP
rs11949 1809 dbSNP
rs780969067 1810 dbSNP
rs1411326066 1812 dbSNP
rs1023162932 1813 dbSNP
rs1171387690 1817 dbSNP
rs1297774300 1818 dbSNP
rs1047385837 1820 dbSNP
rs1314879836 1821 dbSNP
rs1376187903 1822 dbSNP
rs1447919718 1824 dbSNP
rs1301667714 1828 dbSNP
rs1420558378 1830 dbSNP
rs1013109709 1852 dbSNP
rs893266299 1853 dbSNP
rs189392399 1856 dbSNP
rs1281802377 1864 dbSNP
rs964818707 1868 dbSNP
rs1209317563 1873 dbSNP
rs1235728348 1878 dbSNP
rs1000985751 1883 dbSNP
rs368327434 1905 dbSNP
rs1186898684 1918 dbSNP
rs766906631 1919 dbSNP
rs1042030562 1922 dbSNP
rs933270039 1936 dbSNP
rs1184119922 1941 dbSNP
rs1477025589 1947 dbSNP
rs910631002 1959 dbSNP
rs1447859524 1968 dbSNP
rs763429479 1971 dbSNP
rs1395755770 1974 dbSNP
rs551115570 1976 dbSNP
rs772757987 1982 dbSNP
rs1174495858 1989 dbSNP
rs1347478261 1991 dbSNP
rs1431871034 1993 dbSNP
rs968582343 1996 dbSNP
rs1363514234 2000 dbSNP
rs149408088 2011 dbSNP
rs1305249974 2014 dbSNP
rs562683449 2018 dbSNP
rs184171773 2020 dbSNP
rs777221516 2024 dbSNP
rs960423607 2025 dbSNP
rs1489049890 2030 dbSNP
rs1289233040 2034 dbSNP
rs1216464873 2040 dbSNP
rs929372684 2042 dbSNP
rs1034672369 2050 dbSNP
rs1267238636 2050 dbSNP
rs1463425845 2051 dbSNP
rs1195729533 2056 dbSNP
rs1220167682 2057 dbSNP
rs1477706873 2064 dbSNP
rs1189568339 2069 dbSNP
rs919286573 2072 dbSNP
rs1401763430 2087 dbSNP
rs1159133485 2092 dbSNP
rs758334292 2095 dbSNP
rs576234977 2103 dbSNP
rs752570429 2104 dbSNP
rs192074221 2108 dbSNP
rs1463403644 2111 dbSNP
rs904986924 2116 dbSNP
rs1038084361 2122 dbSNP
rs981420694 2124 dbSNP
rs1374948398 2127 dbSNP
rs555920089 2132 dbSNP
rs747761417 2135 dbSNP
rs1046990570 2146 dbSNP
rs933923419 2152 dbSNP
rs1273992372 2157 dbSNP
rs992117857 2162 dbSNP
rs957563965 2164 dbSNP
rs1219694382 2172 dbSNP
rs1291855440 2181 dbSNP
rs1040431780 2183 dbSNP
rs1470586097 2193 dbSNP
rs539385080 2196 dbSNP
rs1182080355 2202 dbSNP
rs1410404213 2206 dbSNP
rs943347706 2212 dbSNP
rs570429252 2218 dbSNP
rs776292215 2222 dbSNP
rs189085698 2223 dbSNP
rs534202867 2234 dbSNP
rs753546029 2265 dbSNP
rs184813750 2271 dbSNP
rs1401655974 2272 dbSNP
rs1342605664 2275 dbSNP
rs1321245842 2277 dbSNP
rs1355771517 2282 dbSNP
rs1409910538 2288 dbSNP
rs946919159 2297 dbSNP
rs914034797 2305 dbSNP
rs544226733 2306 dbSNP
rs139851832 2308 dbSNP
rs1020602413 2312 dbSNP
rs1464501353 2314 dbSNP
rs767829686 2315 dbSNP
rs1355440297 2322 dbSNP
rs997159595 2327 dbSNP
rs548702546 2338 dbSNP
rs1275461544 2342 dbSNP
rs1438399022 2343 dbSNP
rs1204537595 2344 dbSNP
rs901490150 2344 dbSNP
rs1486956635 2350 dbSNP
rs1189335369 2361 dbSNP
rs192760611 2362 dbSNP
rs569499835 2365 dbSNP
rs1161031713 2381 dbSNP
rs1264753469 2385 dbSNP
rs1421224170 2391 dbSNP
rs1007884398 2395 dbSNP
rs1429775103 2413 dbSNP
rs1035228090 2417 dbSNP
rs1368210264 2419 dbSNP
rs980446387 2423 dbSNP
rs1488498734 2424 dbSNP
rs968989353 2427 dbSNP
rs887650745 2428 dbSNP
rs1049354153 2433 dbSNP
rs74320214 2436 dbSNP
rs1016649882 2441 dbSNP
rs529234958 2447 dbSNP
rs1317188810 2452 dbSNP
rs1005688349 2454 dbSNP
rs1258704560 2462 dbSNP
rs1350224987 2462 dbSNP
rs1201527452 2465 dbSNP
rs768377993 2474 dbSNP
rs929429678 2484 dbSNP
rs1220180976 2487 dbSNP
rs919357804 2498 dbSNP
rs1370636998 2499 dbSNP
rs1243450680 2512 dbSNP
rs1449666623 2513 dbSNP
rs532715081 2516 dbSNP
rs1167628602 2517 dbSNP
rs1387770644 2523 dbSNP
rs1045816091 2528 dbSNP
rs886842191 2532 dbSNP
rs1401424752 2533 dbSNP
rs1321160730 2544 dbSNP
rs950039636 2544 dbSNP
rs915874691 2546 dbSNP
rs1365706635 2551 dbSNP
rs991795327 2552 dbSNP
rs998020934 2554 dbSNP
rs957850220 2558 dbSNP
rs575329228 2559 dbSNP
rs1255872591 2562 dbSNP
rs1368634657 2562 dbSNP
rs1343535258 2564 dbSNP
rs1039602021 2565 dbSNP
rs943358876 2575 dbSNP
rs1464774206 2577 dbSNP
rs889092159 2578 dbSNP
rs1245819313 2585 dbSNP
rs746807265 2586 dbSNP
rs1444741879 2591 dbSNP
rs1043835539 2597 dbSNP
rs76795092 2599 dbSNP
rs75901155 2600 dbSNP
rs1160290123 2609 dbSNP
rs1491144035 2610 dbSNP
rs372298512 2610 dbSNP
rs398090387 2610 dbSNP
rs773394761 2610 dbSNP
rs80309223 2610 dbSNP
rs1400198486 2611 dbSNP
rs1332643332 2613 dbSNP
rs1467448110 2616 dbSNP
rs946815125 2631 dbSNP
rs1396991548 2635 dbSNP
rs913976294 2638 dbSNP
rs1300640100 2640 dbSNP
rs1174857694 2645 dbSNP
rs1241787812 2648 dbSNP
rs977975961 2654 dbSNP
rs1328835410 2656 dbSNP
rs1207233825 2660 dbSNP
rs560786641 2662 dbSNP
rs1426877822 2697 dbSNP
rs967498175 2714 dbSNP
rs1176230294 2720 dbSNP
rs988750646 2724 dbSNP
rs1456974320 2727 dbSNP
rs1020675948 2728 dbSNP
rs75842076 2730 dbSNP
rs555145653 2732 dbSNP
rs1431021788 2734 dbSNP
rs980957890 2742 dbSNP
rs1017215162 2748 dbSNP
rs1472116458 2751 dbSNP
rs1210611029 2756 dbSNP
rs541878355 2765 dbSNP
rs1458585078 2773 dbSNP
rs1293219076 2779 dbSNP
rs983790137 2785 dbSNP
rs1303755247 2788 dbSNP
rs1393217699 2789 dbSNP
rs370323933 2790 dbSNP
rs1025388381 2792 dbSNP
rs1376256145 2793 dbSNP
rs375976154 2794 dbSNP
rs759715971 2800 dbSNP
rs1449673395 2802 dbSNP
rs1322747881 2804 dbSNP
rs1245065479 2807 dbSNP
rs541939286 2808 dbSNP
rs576043219 2812 dbSNP
rs1206714384 2830 dbSNP
rs1252399865 2831 dbSNP
rs1482670246 2835 dbSNP
rs1302602416 2841 dbSNP
rs1466934806 2842 dbSNP
rs1179988767 2844 dbSNP
rs187757405 2845 dbSNP
rs1424245053 2849 dbSNP
rs897628136 2851 dbSNP
rs1018218441 2853 dbSNP
rs540261177 2858 dbSNP
rs184407631 2866 dbSNP
rs553661241 2867 dbSNP
rs950110808 2871 dbSNP
rs533836786 2874 dbSNP
rs1380401878 2876 dbSNP
rs915949635 2883 dbSNP
rs1056187011 2885 dbSNP
rs1315427369 2886 dbSNP
rs1380267456 2892 dbSNP
rs1395824832 2896 dbSNP
rs1255472131 2906 dbSNP
rs936292867 2916 dbSNP
rs1311512131 2922 dbSNP
rs138387534 2922 dbSNP
rs759989951 2923 dbSNP
rs115130502 2928 dbSNP
rs1282653319 2940 dbSNP
rs922768747 2941 dbSNP
rs1202934311 2945 dbSNP
rs1214758032 2950 dbSNP
rs1239137273 2950 dbSNP
rs939532047 2954 dbSNP
rs975836375 2955 dbSNP
rs1356516892 2960 dbSNP
rs1451522310 2964 dbSNP
rs928110611 2968 dbSNP
rs1389614813 2970 dbSNP
rs1427912291 2973 dbSNP
rs1178799813 2981 dbSNP
rs1360275754 2982 dbSNP
rs538368470 2982 dbSNP
rs948333726 2986 dbSNP
rs1364585135 2989 dbSNP
rs1436815629 2990 dbSNP
rs910126542 2990 dbSNP
rs1363740303 2991 dbSNP
rs984231644 2992 dbSNP
rs1017292968 2994 dbSNP
rs141913319 3001 dbSNP
rs1339221833 3003 dbSNP
rs569387079 3005 dbSNP
rs1466131503 3006 dbSNP
rs918339849 3008 dbSNP
rs546511567 3014 dbSNP
rs976500466 3018 dbSNP
rs1453578688 3020 dbSNP
rs552674792 3026 dbSNP
rs1193027536 3027 dbSNP
rs575940525 3032 dbSNP
rs1059408 3033 dbSNP
rs567028243 3037 dbSNP
rs1006715646 3039 dbSNP
rs1391285486 3042 dbSNP
rs78267475 3047 dbSNP
rs1159931723 3050 dbSNP
rs1021540718 3056 dbSNP
rs34478040 3056 dbSNP
rs1387480656 3062 dbSNP
rs1011329335 3069 dbSNP
rs1276074718 3075 dbSNP
rs892434156 3077 dbSNP
rs1052964374 3079 dbSNP
rs746594707 3081 dbSNP
rs1330878652 3085 dbSNP
rs1367766987 3087 dbSNP
rs1003603605 3092 dbSNP
rs192380715 3093 dbSNP
rs377058672 3100 dbSNP
rs1463690626 3103 dbSNP
rs1260791309 3105 dbSNP
rs1014378494 3117 dbSNP
rs1192726457 3122 dbSNP
rs372005458 3128 dbSNP
rs1055862818 3133 dbSNP
rs561758985 3135 dbSNP
rs1189919642 3137 dbSNP
rs1414854376 3138 dbSNP
rs904491397 3142 dbSNP
rs1048605694 3145 dbSNP
rs1158932356 3151 dbSNP
rs929644306 3157 dbSNP
rs976398193 3169 dbSNP
rs1325179895 3172 dbSNP
rs1349949981 3172 dbSNP
rs1042399061 3188 dbSNP
rs1265333389 3189 dbSNP
rs946292320 3199 dbSNP
rs1228977514 3208 dbSNP
rs1287469453 3212 dbSNP
rs1337647974 3215 dbSNP
rs1276665513 3218 dbSNP
rs1230236544 3225 dbSNP
rs772719605 3227 dbSNP
rs1290866919 3228 dbSNP
rs1321139633 3229 dbSNP
rs1219493332 3239 dbSNP
rs1254541147 3254 dbSNP
rs771673762 3259 dbSNP
rs922801189 3259 dbSNP
rs1182152378 3263 dbSNP
rs1250043161 3268 dbSNP
rs976869384 3271 dbSNP
rs1164570409 3276 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Location of target site 3'UTR
Article - Calin GA; Cimmino A; Fabbri M; Ferracin M; et al.
- Proceedings of the National Academy of Sciences of the United States of America, 2008
MicroRNAs (miRNAs) are short noncoding RNAs regulating gene expression that play roles in human diseases, including cancer. Each miRNA is predicted to regulate hundreds of transcripts, but only few have experimental validation. In chronic lymphocytic leukemia (CLL), the most common adult human leukemia, miR-15a and miR-16-1 are lost or down-regulated in the majority of cases. After our previous work indicating a tumor suppressor function of miR-15a/16-1 by targeting the BCL2 oncogene, here, we produced a high-throughput profiling of genes modulated by miR-15a/16-1 in a leukemic cell line model (MEG-01) and in primary CLL samples. By combining experimental and bioinformatics data, we identified a miR-15a/16-1-gene signature in leukemic cells. Among the components of the miR-15a/16-1 signature, we observed a statistically significant enrichment in AU-rich elements (AREs). By examining the Gene Ontology (GO) database, a significant enrichment in cancer genes (such as MCL1, BCL2, ETS1, or JUN) that directly or indirectly affect apoptosis and cell cycle was found.
LinkOut: [PMID: 18362358]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.633 5.9e-4 -0.466 1.3e-2 23 Click to see details
GSE38226 Liver fibrosis -0.643 8.3e-4 -0.436 2.4e-2 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.636 1.3e-3 0.741 9.3e-5 20 Click to see details
GSE21032 Prostate cancer 0.227 2.0e-2 0.176 5.6e-2 83 Click to see details
GSE17498 Multiple myeloma 0.255 5.6e-2 0.099 2.7e-1 40 Click to see details
GSE19350 CNS germ cell tumors 0.465 6.4e-2 0.147 3.2e-1 12 Click to see details
GSE28260 Renal cortex and medulla -0.337 1.3e-1 -0.335 1.3e-1 13 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.216 1.5e-1 -0.115 2.9e-1 25 Click to see details
GSE14794 Lymphoblastoid cells 0.097 1.8e-1 0.100 1.7e-1 90 Click to see details
GSE19536 Breast cancer 0.087 1.9e-1 0.046 3.2e-1 100 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.165 2.2e-1 0.046 4.1e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer 0.175 2.3e-1 0.198 2.0e-1 20 Click to see details
GSE32688 Pancreatic cancer 0.12 2.6e-1 0.086 3.2e-1 32 Click to see details
GSE28544 Breast cancer -0.094 3.3e-1 -0.049 4.1e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.083 3.5e-1 -0.018 4.7e-1 24 Click to see details
GSE27834 Pluripotent stem cells -0.096 3.6e-1 0.106 3.5e-1 16 Click to see details
GSE21849 B cell lymphoma -0.05 4.0e-1 0.124 2.6e-1 29 Click to see details
GSE21687 Ependynoma primary tumors -0.027 4.2e-1 0.021 4.3e-1 64 Click to see details
GSE17306 Multiple myeloma -0.027 4.3e-1 -0.011 4.7e-1 49 Click to see details
GSE19783 ER- ER- breast cancer -0.02 4.3e-1 -0.028 4.0e-1 79 Click to see details
GSE19783 ER- ER- breast cancer -0.02 4.3e-1 -0.028 4.0e-1 79 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.284 0 -0.291 0 84 Click to see details
KIRC 0.312 0 0.320 0 68 Click to see details
THCA 0.27 0.02 0.251 0.03 59 Click to see details
PAAD 0.946 0.03 0.800 0.1 4 Click to see details
STAD -0.314 0.04 -0.334 0.03 32 Click to see details
CHOL 0.563 0.06 0.567 0.06 9 Click to see details
PCPG -0.854 0.17 -1.000 0.5 3 Click to see details
KIRP 0.166 0.18 0.115 0.27 32 Click to see details
LUSC 0.143 0.2 0.185 0.13 38 Click to see details
PRAD 0.115 0.21 0.145 0.16 50 Click to see details
HNSC -0.109 0.25 -0.048 0.38 42 Click to see details
KICH 0.137 0.26 0.048 0.41 25 Click to see details
BLCA -0.127 0.31 -0.117 0.32 18 Click to see details
ESCA -0.154 0.33 -0.209 0.27 11 Click to see details
LIHC 0.051 0.36 0.084 0.28 49 Click to see details
COAD -0.139 0.37 -0.333 0.21 8 Click to see details
UCEC -0.078 0.38 -0.125 0.31 19 Click to see details
LUAD -0.093 0.39 -0.147 0.32 12 Click to see details
CESC 0.203 0.43 0.500 0.33 3 Click to see details
CESC 0.203 0.43 0.500 0.33 3 Click to see details
CESC 0.203 0.43 0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*