miRTarBase - #MIRT000886 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol OSGEPL1   
Synonyms OSGEPL, Qri7
Description O-sialoglycoprotein endopeptidase like 1
Transcript NM_022353   
Expression
Putative miRNA Targets on OSGEPL1
3'UTR of OSGEPL1
(miRNA target sites are highlighted)
>OSGEPL1|NM_022353|3'UTR
   1 TTTCTGCTGTTCAAAAAAGTCCCTAAAGAGACAGGCTCTTGCCATGTTGCCCGGGCTGGTCCTGAACTGCTGAATTCAAG
  81 TGATCCTCCCACCTTGGCCTCCAGAAGTGCTGGGATTATGGGTGTGAGCCACCATGCCTAGCCAAAATGTTTCTTAAGGT
 161 ATACATTTTGGGTCTTAGAAGACTTATACATTTGTAATATTTATTACTAAATATCTCAAAGTATTACAATAAATGTTACC
 241 ATGTGAGCTACTTTGAATCAGGCTTCTTGCACACCAATTTAAAAATGTTAACTCTTGATATATACACTAGTTATACCACT
 321 CATGTCAGTCAATAAATTTTAAGGTTTAAGTGCAGGCCTTTGTTTACAGAAATCCTAATTTTTTGAAACCATAACTCTGA
 401 CCTGACACTAAATTCCTGTAGACATGCTAAGGAAAATCTGCTTAGTATCGAGATCAAGAACTTTCATTCAAAAAGATTAT
 481 TCAGTTATGTTATTTGCATATTACCATTATTAAAAATAAAAAAATTTTTAAAAGATGAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugguaAUACACGACGAu 5'
                    | | |||||:| 
Target 5' ----------TTTCTGCTGTTc 3'
1 - 12 128.00 -8.90
2
miRNA  3' guGUUUGGUAAU-ACACGACGau 5'
            ||::|: ||:   ||:|||  
Target 5' gaCAGGCTCTTGCCATGTTGCcc 3'
30 - 52 116.00 -10.90
3
miRNA  3' guguuuGGUAAUACACGACgau 5'
                |||  | ||||||   
Target 5' tggcctCCA-GAAGTGCTGgga 3'
95 - 115 111.00 -10.52
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31565088 12 COSMIC
COSN18717166 125 COSMIC
COSN20068521 126 COSMIC
COSN16635482 276 COSMIC
COSN8557041 444 COSMIC
COSN8557040 461 COSMIC
COSN6160140 462 COSMIC
COSN28065568 625 COSMIC
COSN26456060 1050 COSMIC
COSN22359662 1270 COSMIC
COSN32165913 1770 COSMIC
COSN6160139 2036 COSMIC
COSN224435 2052 COSMIC
COSN27899039 2302 COSMIC
COSN16952412 2311 COSMIC
COSN29938490 2941 COSMIC
COSN22360663 2998 COSMIC
COSN25743832 3196 COSMIC
COSN29699007 3513 COSMIC
COSN5804830 3522 COSMIC
COSN6160138 3614 COSMIC
COSN9299518 3643 COSMIC
COSN20097515 3817 COSMIC
COSN9299517 3845 COSMIC
COSN22040414 3856 COSMIC
COSN30563695 3899 COSMIC
COSN13958580 3906 COSMIC
COSN30156365 3908 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1418917905 6 dbSNP
rs1374829272 7 dbSNP
rs1377905129 9 dbSNP
rs760426018 14 dbSNP
rs1160636022 15 dbSNP
rs760802636 19 dbSNP
rs772976638 22 dbSNP
rs550786340 23 dbSNP
rs1266030185 29 dbSNP
rs752649105 34 dbSNP
rs1348543447 51 dbSNP
rs945628694 65 dbSNP
rs1301614734 68 dbSNP
rs1313585766 73 dbSNP
rs1262579107 75 dbSNP
rs1254879402 77 dbSNP
rs1488302880 83 dbSNP
rs1240324011 85 dbSNP
rs1265893596 90 dbSNP
rs1487517878 106 dbSNP
rs1340431610 108 dbSNP
rs1186277300 117 dbSNP
rs529091230 120 dbSNP
rs1454896199 124 dbSNP
rs1001483476 125 dbSNP
rs114137937 126 dbSNP
rs1225078 127 dbSNP
rs5837165 127 dbSNP
rs987246868 127 dbSNP
rs1491349909 128 dbSNP
rs67364820 128 dbSNP
rs200697986 129 dbSNP
rs759606779 129 dbSNP
rs1382071414 130 dbSNP
rs1159820121 134 dbSNP
rs769710566 148 dbSNP
rs905763932 157 dbSNP
rs1045603694 161 dbSNP
rs1217134995 165 dbSNP
rs1302184004 166 dbSNP
rs1353799948 166 dbSNP
rs369721407 168 dbSNP
rs1241610876 170 dbSNP
rs1288854220 175 dbSNP
rs13416709 193 dbSNP
rs528506281 200 dbSNP
rs1215571875 202 dbSNP
rs564473519 210 dbSNP
rs377176231 212 dbSNP
rs1161651455 220 dbSNP
rs1189700995 232 dbSNP
rs1446218213 233 dbSNP
rs921379569 235 dbSNP
rs1440464934 246 dbSNP
rs974169135 250 dbSNP
rs1188097574 263 dbSNP
rs74940016 264 dbSNP
rs1015846071 267 dbSNP
rs1004098877 272 dbSNP
rs1351433892 273 dbSNP
rs1433944975 275 dbSNP
rs920294778 285 dbSNP
rs974798153 288 dbSNP
rs563810216 293 dbSNP
rs1205755965 299 dbSNP
rs1355788792 301 dbSNP
rs971754139 309 dbSNP
rs1448435540 313 dbSNP
rs1306414566 321 dbSNP
rs752549604 324 dbSNP
rs1360534242 331 dbSNP
rs1012559946 334 dbSNP
rs894215370 339 dbSNP
rs911459645 340 dbSNP
rs372759472 342 dbSNP
rs781603490 349 dbSNP
rs148176267 350 dbSNP
rs1458361719 380 dbSNP
rs1020383089 393 dbSNP
rs1010297770 398 dbSNP
rs957667820 400 dbSNP
rs1469653984 407 dbSNP
rs999918629 415 dbSNP
rs7422176 416 dbSNP
rs903978852 417 dbSNP
rs1042987095 426 dbSNP
rs1033043236 436 dbSNP
rs1001934378 437 dbSNP
rs912830935 437 dbSNP
rs945647473 437 dbSNP
rs74512005 438 dbSNP
rs555046601 440 dbSNP
rs1046068185 456 dbSNP
rs1448052190 460 dbSNP
rs1426484031 461 dbSNP
rs770078599 462 dbSNP
rs921285107 464 dbSNP
rs974114556 465 dbSNP
rs777937196 468 dbSNP
rs183559823 478 dbSNP
rs886292267 483 dbSNP
rs1271061743 493 dbSNP
rs1474326171 494 dbSNP
rs1047576951 495 dbSNP
rs1194238843 510 dbSNP
rs1451105927 513 dbSNP
rs1266871530 518 dbSNP
rs983060071 523 dbSNP
rs748555133 524 dbSNP
rs1478643469 530 dbSNP
rs920328269 532 dbSNP
rs971320155 538 dbSNP
rs1490663373 540 dbSNP
rs1414609079 541 dbSNP
rs1038735308 545 dbSNP
rs539898749 548 dbSNP
rs1361462560 551 dbSNP
rs1293172979 552 dbSNP
rs1341525034 562 dbSNP
rs943031141 572 dbSNP
rs1012797119 573 dbSNP
rs192229363 586 dbSNP
rs911529111 591 dbSNP
rs1213149524 594 dbSNP
rs377696134 595 dbSNP
rs1280799268 596 dbSNP
rs1484702909 611 dbSNP
rs1210084716 613 dbSNP
rs1271560898 617 dbSNP
rs934223281 618 dbSNP
rs1372190111 619 dbSNP
rs999897297 619 dbSNP
rs557707367 622 dbSNP
rs539047346 627 dbSNP
rs1478141021 631 dbSNP
rs779454665 635 dbSNP
rs988926326 637 dbSNP
rs1422486794 649 dbSNP
rs1433484565 650 dbSNP
rs902973090 658 dbSNP
rs1042543908 667 dbSNP
rs957513034 668 dbSNP
rs754846782 670 dbSNP
rs1225077 671 dbSNP
rs1407987150 673 dbSNP
rs891308517 675 dbSNP
rs1233644045 678 dbSNP
rs375900194 680 dbSNP
rs556973988 687 dbSNP
rs1286735975 706 dbSNP
rs1355729333 720 dbSNP
rs187604764 724 dbSNP
rs1168641267 730 dbSNP
rs980176080 732 dbSNP
rs371515740 740 dbSNP
rs1051325200 743 dbSNP
rs1427230111 746 dbSNP
rs1451929972 749 dbSNP
rs970474946 769 dbSNP
rs1200557551 781 dbSNP
rs1201725814 798 dbSNP
rs1480828493 800 dbSNP
rs183361329 801 dbSNP
rs1203111662 805 dbSNP
rs1158715351 819 dbSNP
rs1381516611 824 dbSNP
rs1014203429 825 dbSNP
rs932892343 833 dbSNP
rs1439918338 837 dbSNP
rs899799804 841 dbSNP
rs1038413491 847 dbSNP
rs751486980 852 dbSNP
rs550596887 853 dbSNP
rs141993408 858 dbSNP
rs1026184004 862 dbSNP
rs1379151476 868 dbSNP
rs547134167 872 dbSNP
rs78648816 874 dbSNP
rs145998600 877 dbSNP
rs189531059 879 dbSNP
rs1224790929 885 dbSNP
rs1356800811 888 dbSNP
rs1211396709 910 dbSNP
rs898958194 911 dbSNP
rs1467725748 913 dbSNP
rs373251661 915 dbSNP
rs749932447 922 dbSNP
rs1345656102 938 dbSNP
rs373480129 939 dbSNP
rs565005398 942 dbSNP
rs917105421 943 dbSNP
rs1439938689 948 dbSNP
rs1356003124 950 dbSNP
rs1329320565 954 dbSNP
rs543701474 955 dbSNP
rs943106213 957 dbSNP
rs767212539 966 dbSNP
rs185115004 981 dbSNP
rs1402556269 996 dbSNP
rs1389688276 1012 dbSNP
rs1470338461 1018 dbSNP
rs1032639821 1021 dbSNP
rs1411417632 1021 dbSNP
rs978423501 1021 dbSNP
rs77937023 1022 dbSNP
rs1175928761 1023 dbSNP
rs967143427 1024 dbSNP
rs1291183048 1032 dbSNP
rs1198918269 1033 dbSNP
rs1333819545 1033 dbSNP
rs1051362047 1039 dbSNP
rs934273813 1045 dbSNP
rs1008667264 1048 dbSNP
rs913479274 1050 dbSNP
rs1250489845 1057 dbSNP
rs1424883822 1061 dbSNP
rs552571967 1065 dbSNP
rs1190640989 1066 dbSNP
rs1416190266 1067 dbSNP
rs1187242155 1069 dbSNP
rs1475048034 1079 dbSNP
rs56363939 1079 dbSNP
rs1461529731 1080 dbSNP
rs1029844603 1103 dbSNP
rs181265481 1108 dbSNP
rs756844028 1117 dbSNP
rs1323539058 1124 dbSNP
rs926113070 1125 dbSNP
rs1038360189 1127 dbSNP
rs1416564558 1135 dbSNP
rs1310952114 1140 dbSNP
rs773454240 1147 dbSNP
rs114022445 1150 dbSNP
rs1218953274 1156 dbSNP
rs147845515 1158 dbSNP
rs1305371896 1164 dbSNP
rs542069704 1166 dbSNP
rs970148557 1172 dbSNP
rs1024340255 1173 dbSNP
rs1256099814 1174 dbSNP
rs763755646 1179 dbSNP
rs191365709 1186 dbSNP
rs1026236310 1205 dbSNP
rs1255957260 1208 dbSNP
rs994728197 1211 dbSNP
rs1485584836 1216 dbSNP
rs1194835025 1226 dbSNP
rs1047565250 1230 dbSNP
rs575633197 1252 dbSNP
rs1426933958 1257 dbSNP
rs1338944782 1269 dbSNP
rs1225076 1270 dbSNP
rs549669554 1270 dbSNP
rs1453666624 1272 dbSNP
rs1344630357 1276 dbSNP
rs1436586674 1276 dbSNP
rs200565757 1288 dbSNP
rs11307480 1289 dbSNP
rs1290390127 1289 dbSNP
rs1301459101 1289 dbSNP
rs1359547198 1289 dbSNP
rs56390924 1289 dbSNP
rs869136048 1289 dbSNP
rs1402563635 1290 dbSNP
rs1206395646 1291 dbSNP
rs1231427094 1291 dbSNP
rs371063304 1292 dbSNP
rs1347749461 1293 dbSNP
rs1163571028 1295 dbSNP
rs1443157647 1296 dbSNP
rs1245359459 1297 dbSNP
rs377628454 1300 dbSNP
rs917045331 1302 dbSNP
rs1013443492 1306 dbSNP
rs1240973144 1307 dbSNP
rs1212999201 1308 dbSNP
rs1318252037 1309 dbSNP
rs56012553 1310 dbSNP
rs896425730 1310 dbSNP
rs1245244655 1311 dbSNP
rs1171813205 1318 dbSNP
rs1356929595 1318 dbSNP
rs1224853139 1334 dbSNP
rs1293817310 1334 dbSNP
rs1302030019 1334 dbSNP
rs1315516982 1334 dbSNP
rs1328234197 1334 dbSNP
rs1372724949 1334 dbSNP
rs1376928581 1334 dbSNP
rs1438124921 1334 dbSNP
rs1451396088 1334 dbSNP
rs1452714423 1334 dbSNP
rs397987026 1334 dbSNP
rs757098359 1334 dbSNP
rs111977190 1335 dbSNP
rs1396283259 1335 dbSNP
rs1316914612 1342 dbSNP
rs1246930914 1343 dbSNP
rs1443667760 1345 dbSNP
rs899008613 1346 dbSNP
rs186872665 1347 dbSNP
rs1432957646 1349 dbSNP
rs1007747075 1350 dbSNP
rs890192786 1354 dbSNP
rs1337359406 1359 dbSNP
rs1345930119 1361 dbSNP
rs1051411932 1373 dbSNP
rs991323868 1377 dbSNP
rs1303003874 1378 dbSNP
rs555796012 1383 dbSNP
rs1387414787 1384 dbSNP
rs1182323795 1385 dbSNP
rs762965967 1392 dbSNP
rs557559533 1400 dbSNP
rs199554278 1401 dbSNP
rs775335586 1407 dbSNP
rs936242390 1408 dbSNP
rs1163775150 1409 dbSNP
rs545830859 1410 dbSNP
rs926137303 1419 dbSNP
rs1411218751 1438 dbSNP
rs575084108 1439 dbSNP
rs1353366127 1440 dbSNP
rs948848263 1440 dbSNP
rs925902503 1442 dbSNP
rs978716805 1444 dbSNP
rs967425707 1450 dbSNP
rs1486560277 1452 dbSNP
rs557304092 1465 dbSNP
rs535715829 1485 dbSNP
rs992871621 1488 dbSNP
rs1340285238 1491 dbSNP
rs546062411 1492 dbSNP
rs1270993685 1501 dbSNP
rs1437271718 1502 dbSNP
rs112409298 1505 dbSNP
rs919232760 1505 dbSNP
rs973748526 1515 dbSNP
rs1211509782 1517 dbSNP
rs553234636 1522 dbSNP
rs1029833044 1531 dbSNP
rs1263505308 1533 dbSNP
rs1246406119 1535 dbSNP
rs1418174572 1536 dbSNP
rs1414485619 1539 dbSNP
rs181855740 1551 dbSNP
rs1293695428 1555 dbSNP
rs1377797990 1560 dbSNP
rs1216553221 1561 dbSNP
rs1312632797 1574 dbSNP
rs1327338311 1590 dbSNP
rs1268568131 1592 dbSNP
rs1362680572 1594 dbSNP
rs1235096209 1603 dbSNP
rs1282753856 1609 dbSNP
rs1282467833 1611 dbSNP
rs900070885 1613 dbSNP
rs114745029 1623 dbSNP
rs1448449479 1624 dbSNP
rs1190596450 1631 dbSNP
rs1241145979 1641 dbSNP
rs1367969518 1643 dbSNP
rs1194931278 1650 dbSNP
rs1454389081 1650 dbSNP
rs1397488492 1655 dbSNP
rs887067862 1670 dbSNP
rs1173512985 1671 dbSNP
rs954501675 1681 dbSNP
rs1047063674 1683 dbSNP
rs1014745216 1695 dbSNP
rs1326067656 1701 dbSNP
rs1461786162 1711 dbSNP
rs1441786867 1719 dbSNP
rs1305689923 1726 dbSNP
rs1353193023 1735 dbSNP
rs1368824907 1740 dbSNP
rs1030041175 1754 dbSNP
rs1261180869 1760 dbSNP
rs1167801450 1761 dbSNP
rs1203159951 1765 dbSNP
rs1283171666 1777 dbSNP
rs1468627616 1779 dbSNP
rs1215130109 1784 dbSNP
rs1429947317 1802 dbSNP
rs1009238299 1803 dbSNP
rs1423667575 1804 dbSNP
rs367939738 1805 dbSNP
rs1198024425 1823 dbSNP
rs1479197114 1833 dbSNP
rs1453195308 1835 dbSNP
rs189122431 1840 dbSNP
rs892148925 1844 dbSNP
rs1053436957 1847 dbSNP
rs771285297 1854 dbSNP
rs1471398063 1855 dbSNP
rs1480148321 1859 dbSNP
rs1000883596 1868 dbSNP
rs904765630 1872 dbSNP
rs572625236 1877 dbSNP
rs1462185034 1878 dbSNP
rs1055542313 1890 dbSNP
rs1328095221 1910 dbSNP
rs948915328 1916 dbSNP
rs1440246115 1935 dbSNP
rs1307703278 1936 dbSNP
rs1337435072 1937 dbSNP
rs374117476 1946 dbSNP
rs1057250527 1947 dbSNP
rs929353251 1952 dbSNP
rs919284688 1956 dbSNP
rs1004513868 1962 dbSNP
rs973418615 1977 dbSNP
rs1221740476 1981 dbSNP
rs1234750361 1987 dbSNP
rs1270815369 1990 dbSNP
rs13423162 2009 dbSNP
rs1225075 2013 dbSNP
rs945993234 2014 dbSNP
rs1284480983 2017 dbSNP
rs548486023 2018 dbSNP
rs1411696095 2020 dbSNP
rs1475707258 2024 dbSNP
rs1167447182 2033 dbSNP
rs569381885 2034 dbSNP
rs1391328758 2035 dbSNP
rs912882979 2036 dbSNP
rs1398672123 2042 dbSNP
rs1389640169 2047 dbSNP
rs772373236 2052 dbSNP
rs987193184 2065 dbSNP
rs954426097 2069 dbSNP
rs1234887502 2079 dbSNP
rs1371561709 2084 dbSNP
rs954553740 2092 dbSNP
rs1300293501 2094 dbSNP
rs1227579042 2103 dbSNP
rs1252575937 2112 dbSNP
rs1030096791 2122 dbSNP
rs1194600743 2125 dbSNP
rs530300146 2129 dbSNP
rs1251711634 2134 dbSNP
rs1486242682 2135 dbSNP
rs1190478996 2148 dbSNP
rs1255737501 2151 dbSNP
rs748515552 2154 dbSNP
rs974502940 2174 dbSNP
rs1009293998 2181 dbSNP
rs1400540517 2188 dbSNP
rs956443247 2189 dbSNP
rs1374865921 2190 dbSNP
rs559596061 2192 dbSNP
rs547618379 2193 dbSNP
rs1167944788 2195 dbSNP
rs1017115534 2202 dbSNP
rs1416431323 2209 dbSNP
rs904815494 2214 dbSNP
rs1199412847 2222 dbSNP
rs1382465384 2231 dbSNP
rs1297203490 2239 dbSNP
rs951693726 2249 dbSNP
rs1026049630 2260 dbSNP
rs1274605457 2263 dbSNP
rs184786060 2272 dbSNP
rs1213589470 2275 dbSNP
rs895835607 2280 dbSNP
rs74379118 2284 dbSNP
rs1187339228 2288 dbSNP
rs181957043 2291 dbSNP
rs1042929581 2293 dbSNP
rs1458085503 2305 dbSNP
rs1436527636 2310 dbSNP
rs1262738623 2311 dbSNP
rs535872028 2313 dbSNP
rs1325679999 2323 dbSNP
rs4666783 2324 dbSNP
rs1290336546 2332 dbSNP
rs1359391629 2335 dbSNP
rs1433779901 2342 dbSNP
rs1051853270 2343 dbSNP
rs1238905295 2353 dbSNP
rs1372492473 2369 dbSNP
rs1237152221 2379 dbSNP
rs1301799840 2380 dbSNP
rs546562005 2389 dbSNP
rs1216946477 2397 dbSNP
rs1309841595 2404 dbSNP
rs1392316343 2409 dbSNP
rs1485001957 2416 dbSNP
rs1208290779 2420 dbSNP
rs541827481 2427 dbSNP
rs1382586622 2428 dbSNP
rs897903687 2434 dbSNP
rs1191731829 2435 dbSNP
rs932942939 2436 dbSNP
rs780613703 2441 dbSNP
rs942045221 2446 dbSNP
rs1450027943 2448 dbSNP
rs1407591593 2449 dbSNP
rs188262546 2450 dbSNP
rs756934155 2452 dbSNP
rs375146733 2462 dbSNP
rs553291820 2463 dbSNP
rs138842451 2467 dbSNP
rs566824369 2470 dbSNP
rs1292364893 2475 dbSNP
rs1452030063 2480 dbSNP
rs1224737648 2482 dbSNP
rs368341063 2482 dbSNP
rs1161277181 2485 dbSNP
rs1309635852 2500 dbSNP
rs1327476708 2511 dbSNP
rs923136259 2512 dbSNP
rs1228021488 2525 dbSNP
rs1273983705 2535 dbSNP
rs763776408 2540 dbSNP
rs528774724 2544 dbSNP
rs1246102250 2546 dbSNP
rs1032092634 2549 dbSNP
rs576919927 2560 dbSNP
rs145060727 2565 dbSNP
rs969093113 2569 dbSNP
rs1023696968 2574 dbSNP
rs1165274505 2579 dbSNP
rs1419570667 2585 dbSNP
rs910030493 2589 dbSNP
rs1322284337 2592 dbSNP
rs537117542 2596 dbSNP
rs1462860433 2600 dbSNP
rs11685425 2601 dbSNP
rs548206729 2603 dbSNP
rs1035896542 2614 dbSNP
rs1338948137 2618 dbSNP
rs1349031624 2619 dbSNP
rs1409596968 2623 dbSNP
rs1294178146 2634 dbSNP
rs1484944370 2642 dbSNP
rs1226772783 2643 dbSNP
rs993666293 2649 dbSNP
rs140975685 2650 dbSNP
rs1037799823 2660 dbSNP
rs566078247 2666 dbSNP
rs77760059 2669 dbSNP
rs765282151 2672 dbSNP
rs959993484 2674 dbSNP
rs1249507206 2678 dbSNP
rs1034322502 2688 dbSNP
rs1359159212 2691 dbSNP
rs1001565889 2707 dbSNP
rs1259244824 2717 dbSNP
rs942081431 2718 dbSNP
rs1474035377 2729 dbSNP
rs1162240237 2734 dbSNP
rs759482913 2736 dbSNP
rs1419619320 2741 dbSNP
rs1411098538 2746 dbSNP
rs1173237345 2747 dbSNP
rs889144925 2748 dbSNP
rs1429569117 2751 dbSNP
rs1313892479 2755 dbSNP
rs1050372431 2757 dbSNP
rs933271986 2758 dbSNP
rs1021857705 2770 dbSNP
rs764127760 2786 dbSNP
rs1362815802 2795 dbSNP
rs1455787652 2806 dbSNP
rs923188598 2816 dbSNP
rs1382142573 2818 dbSNP
rs1341347729 2824 dbSNP
rs1290553215 2833 dbSNP
rs1282242672 2842 dbSNP
rs547637195 2845 dbSNP
rs891634549 2856 dbSNP
rs532749097 2867 dbSNP
rs565300478 2868 dbSNP
rs1184234957 2871 dbSNP
rs1384352158 2875 dbSNP
rs552270156 2882 dbSNP
rs1174739365 2884 dbSNP
rs1377663170 2886 dbSNP
rs900133074 2886 dbSNP
rs933224892 2886 dbSNP
rs1345983679 2887 dbSNP
rs138047437 2891 dbSNP
rs1369215902 2898 dbSNP
rs1192757146 2900 dbSNP
rs556093203 2901 dbSNP
rs1402991039 2904 dbSNP
rs1234938620 2920 dbSNP
rs1305463063 2921 dbSNP
rs1264021948 2925 dbSNP
rs1342682981 2927 dbSNP
rs1199657934 2929 dbSNP
rs563354043 2932 dbSNP
rs150358179 2935 dbSNP
rs1290257991 2936 dbSNP
rs1206391975 2938 dbSNP
rs1246886120 2951 dbSNP
rs752835556 2960 dbSNP
rs960317088 2963 dbSNP
rs1440006 2965 dbSNP
rs868160056 2968 dbSNP
rs747478575 2969 dbSNP
rs1039906549 2974 dbSNP
rs1898560 2977 dbSNP
rs1172339766 2979 dbSNP
rs772335352 2989 dbSNP
rs1402695626 2992 dbSNP
rs1324157710 2994 dbSNP
rs1279593562 2995 dbSNP
rs1898559 2996 dbSNP
rs1006334234 3010 dbSNP
rs1327922702 3019 dbSNP
rs889189870 3023 dbSNP
rs748520759 3032 dbSNP
rs1232379736 3046 dbSNP
rs1279954144 3062 dbSNP
rs1352489351 3072 dbSNP
rs1226200005 3075 dbSNP
rs774639119 3080 dbSNP
rs1468583120 3088 dbSNP
rs1426248746 3089 dbSNP
rs980096526 3093 dbSNP
rs969194283 3095 dbSNP
rs1450420670 3096 dbSNP
rs576985255 3101 dbSNP
rs184543291 3112 dbSNP
rs1050423635 3120 dbSNP
rs1157292706 3121 dbSNP
rs1411503784 3122 dbSNP
rs1462071055 3127 dbSNP
rs1165094641 3140 dbSNP
rs1388619835 3142 dbSNP
rs1474578963 3147 dbSNP
rs559045542 3150 dbSNP
rs1021682101 3154 dbSNP
rs140386984 3157 dbSNP
rs1010754875 3159 dbSNP
rs1337368006 3160 dbSNP
rs1407759006 3161 dbSNP
rs1287364709 3165 dbSNP
rs1480163981 3165 dbSNP
rs1234696560 3169 dbSNP
rs1263206086 3170 dbSNP
rs1354961588 3170 dbSNP
rs891586638 3171 dbSNP
rs1251855972 3175 dbSNP
rs1484279264 3175 dbSNP
rs1180433249 3178 dbSNP
rs1475676095 3181 dbSNP
rs1189796932 3183 dbSNP
rs1030175792 3184 dbSNP
rs576164140 3187 dbSNP
rs997472231 3189 dbSNP
rs1267313449 3196 dbSNP
rs554633875 3210 dbSNP
rs1452543826 3216 dbSNP
rs1377542265 3217 dbSNP
rs1333300929 3218 dbSNP
rs1427631730 3219 dbSNP
rs1337082575 3220 dbSNP
rs1307209754 3240 dbSNP
rs1310067156 3240 dbSNP
rs1355815150 3240 dbSNP
rs1416251307 3240 dbSNP
rs201291121 3240 dbSNP
rs560791152 3240 dbSNP
rs5837164 3240 dbSNP
rs1349121736 3241 dbSNP
rs1259622767 3242 dbSNP
rs1218656207 3247 dbSNP
rs1344329738 3248 dbSNP
rs1281297431 3253 dbSNP
rs1438601001 3254 dbSNP
rs1423358512 3285 dbSNP
rs1193959772 3289 dbSNP
rs1392044696 3296 dbSNP
rs2254270 3324 dbSNP
rs1167817047 3334 dbSNP
rs1319646369 3335 dbSNP
rs1467379003 3338 dbSNP
rs1327983207 3341 dbSNP
rs1300787071 3344 dbSNP
rs565695044 3355 dbSNP
rs1382346857 3360 dbSNP
rs554462490 3363 dbSNP
rs1362312511 3368 dbSNP
rs538934576 3375 dbSNP
rs887460748 3386 dbSNP
rs1349132096 3399 dbSNP
rs1047436467 3400 dbSNP
rs1254531838 3401 dbSNP
rs925162990 3421 dbSNP
rs1202209493 3425 dbSNP
rs1249989709 3433 dbSNP
rs571886419 3434 dbSNP
rs1232631496 3440 dbSNP
rs1187916790 3450 dbSNP
rs550139077 3452 dbSNP
rs1434731994 3453 dbSNP
rs766117445 3463 dbSNP
rs938919583 3467 dbSNP
rs1453999594 3470 dbSNP
rs947864493 3474 dbSNP
rs927577357 3475 dbSNP
rs1385876461 3480 dbSNP
rs916331091 3481 dbSNP
rs1433704158 3484 dbSNP
rs1320517651 3488 dbSNP
rs1368886254 3494 dbSNP
rs991869917 3500 dbSNP
rs1221384576 3502 dbSNP
rs1299678777 3513 dbSNP
rs1240051777 3521 dbSNP
rs1311911727 3521 dbSNP
rs1239552372 3526 dbSNP
rs1327246217 3529 dbSNP
rs1253601507 3543 dbSNP
rs980333505 3543 dbSNP
rs1489437312 3546 dbSNP
rs1189329728 3552 dbSNP
rs192874086 3568 dbSNP
rs918230009 3585 dbSNP
rs1161009962 3592 dbSNP
rs1409267571 3595 dbSNP
rs1456291100 3596 dbSNP
rs1322204407 3599 dbSNP
rs972329973 3617 dbSNP
rs988875711 3620 dbSNP
rs1367420166 3623 dbSNP
rs962593492 3628 dbSNP
rs749755016 3643 dbSNP
rs780701992 3645 dbSNP
rs188120524 3651 dbSNP
rs953531403 3655 dbSNP
rs1360271976 3669 dbSNP
rs1017511110 3675 dbSNP
rs1323516280 3682 dbSNP
rs1219351820 3691 dbSNP
rs184951092 3695 dbSNP
rs1480858873 3700 dbSNP
rs529726012 3704 dbSNP
rs1378841716 3710 dbSNP
rs1249281351 3712 dbSNP
rs1029041674 3729 dbSNP
rs1472076656 3731 dbSNP
rs559359043 3746 dbSNP
rs993258313 3755 dbSNP
rs997527554 3758 dbSNP
rs896249210 3759 dbSNP
rs1057216770 3760 dbSNP
rs1349782581 3788 dbSNP
rs1046196 3796 dbSNP
rs1310265627 3797 dbSNP
rs1052366953 3807 dbSNP
rs1409456688 3810 dbSNP
rs1284986373 3818 dbSNP
rs1381517414 3819 dbSNP
rs1226648283 3823 dbSNP
rs1403969181 3826 dbSNP
rs80306810 3830 dbSNP
rs201037870 3831 dbSNP
rs367695717 3831 dbSNP
rs903762694 3831 dbSNP
rs2254167 3845 dbSNP
rs914568360 3848 dbSNP
rs1210460345 3868 dbSNP
rs1238844266 3870 dbSNP
rs1471548643 3888 dbSNP
rs2254166 3890 dbSNP
rs1450673413 3892 dbSNP
rs916386631 3893 dbSNP
rs771654513 3904 dbSNP
rs747608806 3905 dbSNP
rs575784777 3906 dbSNP
rs923376587 3906 dbSNP
rs770219038 3910 dbSNP
rs746312263 3911 dbSNP
rs1217425576 3915 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Location of target site 3'UTR
Article - Calin GA; Cimmino A; Fabbri M; Ferracin M; et al.
- Proceedings of the National Academy of Sciences of the United States of America, 2008
MicroRNAs (miRNAs) are short noncoding RNAs regulating gene expression that play roles in human diseases, including cancer. Each miRNA is predicted to regulate hundreds of transcripts, but only few have experimental validation. In chronic lymphocytic leukemia (CLL), the most common adult human leukemia, miR-15a and miR-16-1 are lost or down-regulated in the majority of cases. After our previous work indicating a tumor suppressor function of miR-15a/16-1 by targeting the BCL2 oncogene, here, we produced a high-throughput profiling of genes modulated by miR-15a/16-1 in a leukemic cell line model (MEG-01) and in primary CLL samples. By combining experimental and bioinformatics data, we identified a miR-15a/16-1-gene signature in leukemic cells. Among the components of the miR-15a/16-1 signature, we observed a statistically significant enrichment in AU-rich elements (AREs). By examining the Gene Ontology (GO) database, a significant enrichment in cancer genes (such as MCL1, BCL2, ETS1, or JUN) that directly or indirectly affect apoptosis and cell cycle was found.
LinkOut: [PMID: 18362358]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*