miRTarBase - #MIRT000831 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CEP63   
Synonyms SCKL6
Description centrosomal protein 63
Transcript NM_001042383   
Other Transcripts NM_001042384 , NM_001042400 , NM_025180   
Expression
Putative miRNA Targets on CEP63
3'UTR of CEP63
(miRNA target sites are highlighted)
>CEP63|NM_001042383|3'UTR
   1 CCTCTTAAAAAAATCACAATCTTGGAAATAAAAATAAACACCAAAGAGTTACTGTCATCTGAAGTAGCAGCTCTTTAAAA
  81 ACATGAAGAGATAAAATTATAAAAATGATACATCTAAAGCAGTGGTGAAGAAAGCTGAAAAACTGATACTTTTGATAGGC
 161 ATTTTCTCTGCACTGGTTTGTTTAAAGGACTTCTTCCAGCAATAAGTTGAAAGAATAAACCACTTTGCTAGACTTTTTTC
 241 TCATACGAATATTTATTATCATAAAGTGATACTTACCTTGCTGACTTAAATGTGAATAGCTATGTACTAATTGAAATAAG
 321 GATTTTATGATACATGTTGAAAATAAAGTAACTGCAGGAACTTTCTTTAGGGGAAATGTGTAGAAGCATGGATTTAGGGG
 401 TCAAACATACCTGGATCGATAGACTGGTTTTGCCACTTACCAGCCAACGGGGCTTGTTATTTACTGGGCTGGTAGCCCCT
 481 CCTAGCCAAGGGGCTGGTAGTGTGTAAAGTCAGGCTGGTAGTGAATAAGGGGGGGGTGTGCTAAAGAACCTTATCAAGCA
 561 GTCCTCTCTTGCTCAACACTCATGCAGAGGAGAGAGGCAGGGAGGGCAAGGGACTGGCTGTCATGCACGGTGCCCATGGA
 641 ATATCCATTGGAAATAAATGTTCATCGTCTGCACTGCTGAGGACAAGTTTAGATGGGAGACAAAGATCTGGATGTTGATG
 721 TGCCGCAGGCATTTGAAACGATGGGAGTTGATAAGATCCACCAGGGAGGCTGTGGAGAGAGAGAGGAGCAGGAGGCTGGG
 801 TTTGGGGCCCTGAAAGATGCCAGCATCTGAGGATCACAGGAAATAGATCTAGCAAAGGAACTAGAATGTGCAGTTACAGA
 881 TGAGAAAGGTCAGTGTAGTGTACTTGCCAGCTCAAGGGTGTGGCCTCTGTGAACCCTCTTTCTGTAGTGGATCTTTCCCA
 961 TCAGCGTAAAACATCCTGTTATTTCCCCTTTTTAAATAAAACCTCAGTTTTTTTTAATGCCTCTCTTTTACTGCTCTGTA
1041 TGTTTGCTTCCCTTCACCCAAACACTTCTGGAAAGAGTTGTCTGCAGTGACTCTTTCCAGTTCCTCACCCCGCCCCACCG
1121 TAGTTCTCTTCCTAACCCTCTCCAACACCACTTCCATCCCCAGACTGCTTTCTTGCTCTTGAGTTCACCAGTGACCTAAT
1201 CAGTGTCTGAGCATCATTCAGCACAGTTGGACTCTCTCTTGGCTTCTGTGACCTGGAACTTCTGGTTTCCTCTCTACCTC
1281 ATCCTCCACTCCATCTCATGGCTTTTCCTCTTCTAACCTCTAAGTCAGAGGGCCCCCTAGAGCTCTGTCATGGGTTTTCT
1361 CCCTCAGCATTCTCTTCCCTAGAAGTTTCCATTCCATTCTCAAGCTCTTAATACCACCTATAGGCCAGTGACCCTTACAT
1441 TTATTACTAATCTTGACCTCTCCCCAGAGCTGCTGTCTTAGATACCTAGCTGCTTATGCGATGTCTTCACTTGGATATCT
1521 GACAAACATCTTGTTTCCAAGAGAGAACTCTTTATTCTCCCTCTTGCTAAGATTCCATATCAGGACATAGCATTATGTTT
1601 GCCAGTTCCTAGGAGTTACTTATAATTCCTTCCTTACCCACATCCGCATATCCAGTCATTTGGGAGGTCCTGTCATTTCT
1681 TCCCCCAGAATCTTATCTCAGACCCAACCGTTTCCCTCCTGCACTTCTACCACCTGATCCAGACTACTTCTCTCTCACCC
1761 TGATTCTGGCAGTAGCCTCCTAACTGATAGTACTCACACCAGTAATTCAGGGAGCTTCTGGAGTTATCCTTTAGAAATGT
1841 AAATGAAACAGTGTCACCACTGCTTCCCTTCAGACTCTTCCAAGGCTTCTCTTTTTTTTTTTATTGAGACAGAGTCTCAC
1921 TCTGTCGCCCAAGCTGCAGTACAGTGGCAGGATCTCGGCTCTCTGCAACCTCCACCTCCCGGGCTCAAGTGATTCTCCTG
2001 CCTTAGCTTCCCGAGTAGCTGGGATTACAGGCGCATGCCACCAGGCCCAGCTAATTTTTGTATTTTTAGTAGGAACAGGG
2081 TTTCACCATGTTGGTCAGGCTGATCTCGAACTCCTGACCTCAAGTGATCCACCCGCCTGAGCTTCCCAAAGTGCTGGGTT
2161 ATAAGCGTGAGCCACTGCACCCAGCCCCAAGGCTTCTTACTGCACTCAGAATAAAATCCAAATGAATTAGTATAGCCTAC
2241 AGAGTGTCAATAATCTGGGCCTAATCACCCATTGCATCATCCTTTACTGTGCTCCACCCATGCTGGCGTCCTTTCTGTTT
2321 ATTGAGTGCAGCAAGCTTTAACCTGTTCGGGTCTTTCATTTGCAGTTTACCCTGAATATTCCCTTTCTCTTACCTCACCT
2401 TTGATTGGCGTTTTCCCCCTTGCAGACCTGCACTCTGGCATCCTCTCCTGAGCAAGCCTTCTTTGATTGCTGCCTCCCAA
2481 ACCTGTTTCTCCCCATTTCTCTAGCTCATTGGCCTGTGTTACTTGCTTCATAGTGCTCACTACTATCTGAAATCATTTCA
2561 TTACTTGATTTATGTTTGTACTGTCTATTTCTGTCTTTAGAATTAAAACTCCTTGAGGGCAAGGACTTTGCTTCTCTGGT
2641 TCATGGTGGGATCCTCATCACCCAGCACAAGCCCAACACTTAGGAGAGGCTCAGCTAGTTTGAACCAATGGAAAATGCCA
2721 TTCCTGAGGTGCACCACATCGTTTCTTTTGTGTTGGTGTGCATGCTGTCCTTCAGTTTGTCTCCTCTTCCCACACCCTGT
2801 CATGTGCTCCTAAAACTCCCCCTTTACTTGGCTACTTTATCTGGCTTGGCAAAGCTTTCCCATATCCCCTGACCCATGTC
2881 AGGGAACGTTTCTCCTCATTGCTGTCATGGCACCCTGTGTGTGGCTCTGACCAGACTTTGCTATCCGCTTTGATTTCTGT
2961 CTTTCAGGGGCTAAGTCCTGCCTACATCCTCAGTCAGCATGCTGCCTAACACATAACAGATCCTAAGCAAATATTGGGTG
3041 GATGAAAATCACTACCATTCAAGGCTTCATTGTATTTATCAGTAAAACTGAAATAATATCTAATGGGGTCGAGAAGATTT
3121 ACTGAAAATATATATTTGAAAGGGCTTTGCAGTTTTAAGTACTGTACCTATGTGCATTGCTGTTACATTCAGGAGATTTC
3201 TGAGTTTTAGACAGTCCCAAGCTTCAGCTTAAAATCTGTAGACTGCAGCCCGTTTCTGAAACGTTTGTACTACGTGTTGA
3281 CTAGGAGGAACAATGACAGACTCTGTAGTCACCGGAAATACTTAAGGAATCATGAGGTACTATGTATTTCCTTAAATTAT
3361 ACTGTTTTTTAAAGCTGAAGTATCTAATAGTTAATGGGTTGTCCAAATTTGTCAGAACATTTGACTGTAATTTAATGTCT
3441 CACCATTTTTCAAAAAGATATATTAATACCAAATATTAAAATGTGTCAAGACT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUA-AUAC--ACGACGau 5'
            |||:|| | | ||  ||||||  
Target 5' agCAAGCCTTCTTTGATTGCTGCct 3'
2451 - 2475 142.00 -14.20
2
miRNA  3' guGUUUGG--UAAUACACGACGAu 5'
            || |||  :| ||||||| || 
Target 5' ccCACACCCTGTCATGTGCTCCTa 3'
2789 - 2812 138.00 -15.50
3
miRNA  3' guguuUGGUAAUAC---ACGACGAu 5'
               |||  |:||   |||||:| 
Target 5' actgtACCTATGTGCATTGCTGTTa 3'
3161 - 3185 137.00 -13.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30132702 2 COSMIC
COSN29852610 11 COSMIC
COSN20057430 14 COSMIC
COSN30132782 20 COSMIC
COSN30179320 22 COSMIC
COSN1914983 48 COSMIC
COSN30514937 53 COSMIC
COSN30169339 197 COSMIC
COSN31557366 248 COSMIC
COSN31594359 253 COSMIC
COSN31582490 424 COSMIC
COSN31962154 450 COSMIC
COSN5037401 539 COSMIC
COSN27548587 559 COSMIC
COSN21914700 756 COSMIC
COSN24909766 1051 COSMIC
COSN27018549 1147 COSMIC
COSN21332011 1373 COSMIC
COSN16802870 1591 COSMIC
COSN20300410 1605 COSMIC
COSN14504768 1700 COSMIC
COSN5520866 2377 COSMIC
COSN1268023 2942 COSMIC
COSN7621243 3061 COSMIC
COSN16186743 3091 COSMIC
COSN15918650 3111 COSMIC
COSN31962155 3459 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1444909482 2 dbSNP
rs1194962600 5 dbSNP
rs1182996335 7 dbSNP
rs368088012 7 dbSNP
rs6777283 19 dbSNP
rs764091070 20 dbSNP
rs754022728 21 dbSNP
rs1435280424 22 dbSNP
rs757492452 24 dbSNP
rs779412334 26 dbSNP
rs760066950 34 dbSNP
rs1322414631 35 dbSNP
rs1380714638 38 dbSNP
rs1320589039 42 dbSNP
rs746286860 43 dbSNP
rs966283419 44 dbSNP
rs758946353 48 dbSNP
rs370033036 50 dbSNP
rs998177052 58 dbSNP
rs79115291 59 dbSNP
rs181941673 66 dbSNP
rs1305994190 76 dbSNP
rs1453359589 93 dbSNP
rs1384900885 101 dbSNP
rs1334794109 108 dbSNP
rs1451932459 111 dbSNP
rs966670354 112 dbSNP
rs572704761 113 dbSNP
rs1474472121 114 dbSNP
rs886562946 122 dbSNP
rs942109791 123 dbSNP
rs1164539304 124 dbSNP
rs1446976290 129 dbSNP
rs1241824637 140 dbSNP
rs757262806 142 dbSNP
rs1441307517 144 dbSNP
rs749089380 146 dbSNP
rs1261768257 149 dbSNP
rs1206552072 157 dbSNP
rs1452568471 159 dbSNP
rs111683110 162 dbSNP
rs1246433404 163 dbSNP
rs138355549 167 dbSNP
rs1245386543 171 dbSNP
rs915726789 172 dbSNP
rs1320310418 179 dbSNP
rs1380755689 184 dbSNP
rs1292662428 191 dbSNP
rs1035908321 192 dbSNP
rs1353469333 194 dbSNP
rs770310607 202 dbSNP
rs774122484 203 dbSNP
rs760858627 212 dbSNP
rs563603999 215 dbSNP
rs1383969906 220 dbSNP
rs1163546304 234 dbSNP
rs1476000757 234 dbSNP
rs1164830531 237 dbSNP
rs574920736 242 dbSNP
rs1293646415 245 dbSNP
rs966884482 247 dbSNP
rs928932801 250 dbSNP
rs1490769922 257 dbSNP
rs1289269920 262 dbSNP
rs1221682478 272 dbSNP
rs979189647 273 dbSNP
rs73221369 277 dbSNP
rs1225323652 282 dbSNP
rs749608955 287 dbSNP
rs1205787058 297 dbSNP
rs964557550 303 dbSNP
rs562265402 305 dbSNP
rs868235382 308 dbSNP
rs1364126995 312 dbSNP
rs902003390 325 dbSNP
rs1411021279 335 dbSNP
rs923190126 350 dbSNP
rs954641532 356 dbSNP
rs1474128028 357 dbSNP
rs1418159247 361 dbSNP
rs1199733386 369 dbSNP
rs1156405464 373 dbSNP
rs966693207 374 dbSNP
rs185984374 380 dbSNP
rs1000786257 389 dbSNP
rs1275006266 393 dbSNP
rs1194194761 396 dbSNP
rs1317410111 400 dbSNP
rs1311721361 402 dbSNP
rs1373600094 412 dbSNP
rs77920977 415 dbSNP
rs377529686 418 dbSNP
rs1338098600 419 dbSNP
rs772713702 425 dbSNP
rs941998446 434 dbSNP
rs915773998 436 dbSNP
rs1391045094 441 dbSNP
rs1470753250 443 dbSNP
rs527629114 444 dbSNP
rs547365563 448 dbSNP
rs937520093 449 dbSNP
rs1179607855 450 dbSNP
rs1241030062 450 dbSNP
rs1279667201 452 dbSNP
rs1346384146 453 dbSNP
rs1457222255 458 dbSNP
rs928963879 459 dbSNP
rs1205642974 463 dbSNP
rs1321743511 467 dbSNP
rs1278156932 470 dbSNP
rs1224725989 472 dbSNP
rs760965782 475 dbSNP
rs543790567 476 dbSNP
rs529891982 478 dbSNP
rs1238412883 494 dbSNP
rs1384090068 500 dbSNP
rs943170025 513 dbSNP
rs1039182764 514 dbSNP
rs1491416105 528 dbSNP
rs1400881632 529 dbSNP
rs140568394 529 dbSNP
rs34972057 529 dbSNP
rs998062695 531 dbSNP
rs549971647 532 dbSNP
rs1172509729 534 dbSNP
rs1392667479 536 dbSNP
rs140864576 542 dbSNP
rs373694817 544 dbSNP
rs1042473107 549 dbSNP
rs902187752 551 dbSNP
rs770524579 558 dbSNP
rs1448895657 564 dbSNP
rs1282599738 565 dbSNP
rs376739195 567 dbSNP
rs1317748225 568 dbSNP
rs1299650813 569 dbSNP
rs1012354595 571 dbSNP
rs9809619 572 dbSNP
rs964422726 573 dbSNP
rs996044157 575 dbSNP
rs1431022722 576 dbSNP
rs565928653 577 dbSNP
rs1030152750 580 dbSNP
rs954818255 585 dbSNP
rs971269482 593 dbSNP
rs1418842305 604 dbSNP
rs981650165 614 dbSNP
rs983400950 616 dbSNP
rs1442647100 617 dbSNP
rs144478273 618 dbSNP
rs1187111057 620 dbSNP
rs374924400 620 dbSNP
rs200230959 622 dbSNP
rs764358159 624 dbSNP
rs554943541 629 dbSNP
rs191651751 630 dbSNP
rs1220925323 634 dbSNP
rs1280017904 636 dbSNP
rs984700922 637 dbSNP
rs1214635665 638 dbSNP
rs1363699887 640 dbSNP
rs1275880139 642 dbSNP
rs943013217 647 dbSNP
rs1365985867 649 dbSNP
rs547830510 657 dbSNP
rs543625573 659 dbSNP
rs973345219 660 dbSNP
rs1456332423 661 dbSNP
rs974539794 665 dbSNP
rs557091256 667 dbSNP
rs922978352 668 dbSNP
rs933505271 673 dbSNP
rs1193248925 677 dbSNP
rs927417471 685 dbSNP
rs1480855431 694 dbSNP
rs1042570475 695 dbSNP
rs575735101 698 dbSNP
rs148776403 699 dbSNP
rs1252384995 700 dbSNP
rs1204656027 701 dbSNP
rs936953863 712 dbSNP
rs1255547629 714 dbSNP
rs1053943609 719 dbSNP
rs374405460 725 dbSNP
rs564935327 726 dbSNP
rs946176013 727 dbSNP
rs1366879518 728 dbSNP
rs1298645805 729 dbSNP
rs895166306 732 dbSNP
rs1041988996 739 dbSNP
rs542452428 740 dbSNP
rs1169978899 745 dbSNP
rs527274777 754 dbSNP
rs1470465720 764 dbSNP
rs762644962 766 dbSNP
rs1431701097 771 dbSNP
rs1174460416 772 dbSNP
rs1432935481 775 dbSNP
rs1053440439 777 dbSNP
rs1179485622 788 dbSNP
rs900291761 789 dbSNP
rs1235832396 792 dbSNP
rs906571782 797 dbSNP
rs995914880 801 dbSNP
rs1264591857 806 dbSNP
rs1026188660 808 dbSNP
rs1030467306 823 dbSNP
rs1443255707 825 dbSNP
rs1307376480 827 dbSNP
rs1393076995 831 dbSNP
rs1275480617 832 dbSNP
rs954586525 833 dbSNP
rs1330835508 838 dbSNP
rs541344955 847 dbSNP
rs950520532 848 dbSNP
rs1213272879 862 dbSNP
rs1298202686 869 dbSNP
rs1005086442 874 dbSNP
rs115007032 875 dbSNP
rs1161649302 878 dbSNP
rs1438458130 883 dbSNP
rs1380208980 892 dbSNP
rs963258852 900 dbSNP
rs763998399 912 dbSNP
rs529979923 914 dbSNP
rs1244398282 915 dbSNP
rs1016167194 918 dbSNP
rs964415439 924 dbSNP
rs1034293135 929 dbSNP
rs1261163754 930 dbSNP
rs1240977378 945 dbSNP
rs958808705 950 dbSNP
rs974773433 951 dbSNP
rs1188126053 954 dbSNP
rs1332210500 955 dbSNP
rs1395675573 960 dbSNP
rs1385939126 964 dbSNP
rs550006208 965 dbSNP
rs112564630 966 dbSNP
rs917296467 967 dbSNP
rs1360488895 974 dbSNP
rs1474788816 982 dbSNP
rs1162496971 988 dbSNP
rs977797570 994 dbSNP
rs946238584 1003 dbSNP
rs1446917919 1008 dbSNP
rs977958026 1013 dbSNP
rs1369704931 1015 dbSNP
rs924135203 1016 dbSNP
rs1218571791 1026 dbSNP
rs1422943206 1026 dbSNP
rs936817012 1026 dbSNP
rs926258617 1041 dbSNP
rs1284986723 1046 dbSNP
rs532696773 1059 dbSNP
rs1053977790 1060 dbSNP
rs183216092 1064 dbSNP
rs1463173744 1065 dbSNP
rs1244142044 1068 dbSNP
rs1327294092 1074 dbSNP
rs1297951291 1078 dbSNP
rs1324304680 1080 dbSNP
rs895354259 1081 dbSNP
rs751701862 1083 dbSNP
rs1344623224 1084 dbSNP
rs1427184916 1090 dbSNP
rs1429246229 1092 dbSNP
rs757505881 1097 dbSNP
rs773921503 1098 dbSNP
rs147506940 1104 dbSNP
rs1456941815 1107 dbSNP
rs931356801 1108 dbSNP
rs1373113043 1110 dbSNP
rs533470706 1111 dbSNP
rs534732308 1112 dbSNP
rs994284021 1113 dbSNP
rs900183677 1114 dbSNP
rs931613009 1120 dbSNP
rs1209356758 1139 dbSNP
rs1340184862 1140 dbSNP
rs1282964009 1141 dbSNP
rs1444844430 1152 dbSNP
rs13060247 1155 dbSNP
rs1217044661 1158 dbSNP
rs1006031426 1161 dbSNP
rs1284397088 1162 dbSNP
rs1407127745 1166 dbSNP
rs1263872062 1167 dbSNP
rs890169483 1169 dbSNP
rs1329903856 1181 dbSNP
rs756550219 1191 dbSNP
rs780522070 1194 dbSNP
rs140238056 1195 dbSNP
rs576881116 1204 dbSNP
rs557179061 1217 dbSNP
rs1396613335 1225 dbSNP
rs1172111733 1228 dbSNP
rs779555922 1232 dbSNP
rs1422452634 1237 dbSNP
rs1016182969 1238 dbSNP
rs1185570061 1245 dbSNP
rs1419698811 1270 dbSNP
rs1473904708 1281 dbSNP
rs1163984666 1292 dbSNP
rs965023408 1294 dbSNP
rs1438263513 1299 dbSNP
rs887230625 1304 dbSNP
rs1240180386 1309 dbSNP
rs1196816701 1313 dbSNP
rs1317577290 1314 dbSNP
rs1407526298 1319 dbSNP
rs1221114515 1324 dbSNP
rs996099338 1325 dbSNP
rs1015170361 1335 dbSNP
rs1274572749 1337 dbSNP
rs1240394784 1339 dbSNP
rs1160510694 1344 dbSNP
rs112084137 1350 dbSNP
rs994697645 1355 dbSNP
rs1443909158 1360 dbSNP
rs1399144128 1362 dbSNP
rs1337014584 1373 dbSNP
rs1415770010 1389 dbSNP
rs188098650 1400 dbSNP
rs1171708403 1412 dbSNP
rs977828799 1415 dbSNP
rs749846417 1417 dbSNP
rs958715987 1419 dbSNP
rs1176900745 1422 dbSNP
rs923663595 1438 dbSNP
rs1357696916 1439 dbSNP
rs993196190 1440 dbSNP
rs191012344 1443 dbSNP
rs989568343 1445 dbSNP
rs1278446247 1453 dbSNP
rs1206074640 1460 dbSNP
rs967857660 1465 dbSNP
rs768867909 1467 dbSNP
rs1278647866 1470 dbSNP
rs1348068025 1473 dbSNP
rs1375542471 1476 dbSNP
rs55901778 1486 dbSNP
rs1449775263 1494 dbSNP
rs746593057 1500 dbSNP
rs145659407 1501 dbSNP
rs114734743 1512 dbSNP
rs372803996 1516 dbSNP
rs927980177 1520 dbSNP
rs560898035 1521 dbSNP
rs1180807930 1530 dbSNP
rs776213497 1536 dbSNP
rs1232573298 1554 dbSNP
rs1217005800 1556 dbSNP
rs1468769698 1562 dbSNP
rs564146308 1564 dbSNP
rs1216533834 1571 dbSNP
rs1005633880 1573 dbSNP
rs1290050050 1576 dbSNP
rs1229519640 1579 dbSNP
rs1037971686 1582 dbSNP
rs931644090 1585 dbSNP
rs1400182086 1590 dbSNP
rs1051859858 1603 dbSNP
rs182334673 1604 dbSNP
rs186686920 1605 dbSNP
rs532325443 1606 dbSNP
rs999111990 1614 dbSNP
rs1328559571 1624 dbSNP
rs116144070 1635 dbSNP
rs899014708 1646 dbSNP
rs1443861997 1647 dbSNP
rs1193386406 1649 dbSNP
rs1490671224 1655 dbSNP
rs957822525 1665 dbSNP
rs994604403 1667 dbSNP
rs1309369830 1670 dbSNP
rs1319433688 1671 dbSNP
rs1369521448 1671 dbSNP
rs559607867 1675 dbSNP
rs894362605 1676 dbSNP
rs1282459648 1682 dbSNP
rs1276136153 1686 dbSNP
rs1014289820 1688 dbSNP
rs1399140601 1692 dbSNP
rs1024724634 1697 dbSNP
rs1295251960 1709 dbSNP
rs1195053123 1710 dbSNP
rs769488078 1711 dbSNP
rs1171386572 1719 dbSNP
rs916764124 1723 dbSNP
rs1421735651 1729 dbSNP
rs532748384 1730 dbSNP
rs928211006 1731 dbSNP
rs1189999775 1736 dbSNP
rs1488402375 1740 dbSNP
rs377335095 1743 dbSNP
rs548294772 1746 dbSNP
rs909873830 1747 dbSNP
rs1238877066 1748 dbSNP
rs568110453 1750 dbSNP
rs537387119 1751 dbSNP
rs1039770851 1752 dbSNP
rs1303062209 1755 dbSNP
rs900350338 1758 dbSNP
rs955811966 1773 dbSNP
rs931804566 1777 dbSNP
rs148828317 1780 dbSNP
rs369492997 1780 dbSNP
rs1167719318 1782 dbSNP
rs1449052923 1786 dbSNP
rs1394710031 1788 dbSNP
rs1330963505 1789 dbSNP
rs890333278 1794 dbSNP
rs1466866251 1796 dbSNP
rs868788490 1798 dbSNP
rs1379736552 1800 dbSNP
rs999395783 1806 dbSNP
rs1331701771 1807 dbSNP
rs1178757070 1809 dbSNP
rs1441035128 1821 dbSNP
rs1393262969 1828 dbSNP
rs1197640488 1844 dbSNP
rs987180104 1845 dbSNP
rs762988474 1852 dbSNP
rs763759723 1855 dbSNP
rs550845402 1859 dbSNP
rs539805171 1861 dbSNP
rs1331642232 1868 dbSNP
rs1309927947 1870 dbSNP
rs1242171837 1872 dbSNP
rs751396472 1876 dbSNP
rs752162466 1890 dbSNP
rs1308545320 1892 dbSNP
rs879754262 1892 dbSNP
rs1301509561 1898 dbSNP
rs920304041 1899 dbSNP
rs111705103 1903 dbSNP
rs9834981 1903 dbSNP
rs1268216384 1904 dbSNP
rs1341135827 1909 dbSNP
rs1438319479 1911 dbSNP
rs750698542 1915 dbSNP
rs1199037242 1920 dbSNP
rs1035181908 1922 dbSNP
rs756161961 1923 dbSNP
rs1179711790 1924 dbSNP
rs1055544011 1927 dbSNP
rs1351414472 1933 dbSNP
rs1285474114 1934 dbSNP
rs1468176066 1935 dbSNP
rs539665537 1942 dbSNP
rs909906329 1943 dbSNP
rs894434952 1948 dbSNP
rs1342531097 1949 dbSNP
rs1310882968 1955 dbSNP
rs1269489914 1957 dbSNP
rs1452705720 1958 dbSNP
rs367751314 1960 dbSNP
rs1045759093 1973 dbSNP
rs1360432650 1974 dbSNP
rs1371842825 1981 dbSNP
rs572052877 1996 dbSNP
rs1457940558 2004 dbSNP
rs1171806068 2008 dbSNP
rs998827551 2011 dbSNP
rs1369645039 2013 dbSNP
rs529104060 2014 dbSNP
rs957435402 2015 dbSNP
rs997058615 2029 dbSNP
rs13065773 2030 dbSNP
rs1487298037 2031 dbSNP
rs1260923355 2033 dbSNP
rs955680146 2034 dbSNP
rs376562261 2036 dbSNP
rs1316222594 2052 dbSNP
rs987470633 2064 dbSNP
rs931810033 2070 dbSNP
rs1244333422 2080 dbSNP
rs1051644394 2086 dbSNP
rs755530865 2088 dbSNP
rs962016210 2090 dbSNP
rs971669794 2093 dbSNP
rs149803826 2108 dbSNP
rs1340491625 2109 dbSNP
rs1324815989 2112 dbSNP
rs779088671 2119 dbSNP
rs893493331 2126 dbSNP
rs748525324 2135 dbSNP
rs1460653216 2136 dbSNP
rs1423873244 2138 dbSNP
rs543770728 2150 dbSNP
rs1476737739 2153 dbSNP
rs758898788 2167 dbSNP
rs568948129 2168 dbSNP
rs369370654 2170 dbSNP
rs1265436402 2172 dbSNP
rs949891608 2175 dbSNP
rs1046063436 2183 dbSNP
rs183887716 2187 dbSNP
rs1003693907 2192 dbSNP
rs1035213059 2193 dbSNP
rs545689997 2199 dbSNP
rs371885800 2201 dbSNP
rs777264347 2208 dbSNP
rs999296363 2209 dbSNP
rs780980219 2221 dbSNP
rs951505959 2233 dbSNP
rs893250380 2238 dbSNP
rs996923006 2249 dbSNP
rs1236159936 2254 dbSNP
rs192310170 2256 dbSNP
rs1028385188 2267 dbSNP
rs1194889546 2270 dbSNP
rs1017168103 2272 dbSNP
rs1439485055 2277 dbSNP
rs1400347061 2283 dbSNP
rs891305405 2290 dbSNP
rs1008354580 2294 dbSNP
rs1332980004 2297 dbSNP
rs1463680227 2301 dbSNP
rs1395509001 2305 dbSNP
rs1172938207 2308 dbSNP
rs184768924 2309 dbSNP
rs975400074 2311 dbSNP
rs1193131808 2316 dbSNP
rs921261289 2319 dbSNP
rs934125240 2329 dbSNP
rs1166392169 2333 dbSNP
rs1016266805 2335 dbSNP
rs749283491 2344 dbSNP
rs1343546377 2346 dbSNP
rs961641059 2349 dbSNP
rs542300112 2350 dbSNP
rs1377008793 2351 dbSNP
rs1052317663 2358 dbSNP
rs745566578 2363 dbSNP
rs1027257892 2365 dbSNP
rs951827296 2366 dbSNP
rs1399742218 2369 dbSNP
rs757168994 2370 dbSNP
rs1172959753 2375 dbSNP
rs62271505 2380 dbSNP
rs1382322991 2389 dbSNP
rs1176844128 2401 dbSNP
rs369501980 2406 dbSNP
rs949932613 2410 dbSNP
rs981291392 2411 dbSNP
rs868341478 2419 dbSNP
rs9815894 2420 dbSNP
rs1322531588 2424 dbSNP
rs1238474622 2428 dbSNP
rs74823407 2429 dbSNP
rs570821916 2438 dbSNP
rs932613591 2439 dbSNP
rs768771945 2441 dbSNP
rs1056200901 2454 dbSNP
rs145774367 2458 dbSNP
rs1362356787 2460 dbSNP
rs1156977908 2461 dbSNP
rs570930414 2465 dbSNP
rs891175842 2474 dbSNP
rs188515586 2481 dbSNP
rs761595836 2482 dbSNP
rs1256485007 2487 dbSNP
rs1165239649 2499 dbSNP
rs1418105167 2503 dbSNP
rs1390334821 2519 dbSNP
rs1179071085 2527 dbSNP
rs1464211657 2533 dbSNP
rs1017200584 2538 dbSNP
rs1489582698 2541 dbSNP
rs545496161 2553 dbSNP
rs1420234226 2560 dbSNP
rs997500240 2567 dbSNP
rs115859859 2572 dbSNP
rs1373544449 2582 dbSNP
rs554686265 2583 dbSNP
rs1027164543 2584 dbSNP
rs951718045 2585 dbSNP
rs568135152 2586 dbSNP
rs1023171638 2588 dbSNP
rs1390993583 2594 dbSNP
rs971169557 2595 dbSNP
rs1342102637 2599 dbSNP
rs537059604 2600 dbSNP
rs956548364 2607 dbSNP
rs987898443 2613 dbSNP
rs915059386 2619 dbSNP
rs946682024 2620 dbSNP
rs1325600660 2627 dbSNP
rs1403868753 2627 dbSNP
rs1379127068 2635 dbSNP
rs1240962462 2638 dbSNP
rs1280316389 2640 dbSNP
rs981707567 2643 dbSNP
rs1171875675 2644 dbSNP
rs1479024884 2660 dbSNP
rs1421872156 2662 dbSNP
rs1186457454 2663 dbSNP
rs1489053891 2679 dbSNP
rs1045364968 2680 dbSNP
rs1223101353 2684 dbSNP
rs1310938244 2709 dbSNP
rs1466890101 2719 dbSNP
rs924458062 2728 dbSNP
rs770054737 2733 dbSNP
rs773389461 2735 dbSNP
rs539858445 2736 dbSNP
rs1256901849 2741 dbSNP
rs556957332 2746 dbSNP
rs1293096043 2749 dbSNP
rs1480112920 2764 dbSNP
rs1368196535 2765 dbSNP
rs1196290392 2766 dbSNP
rs148950396 2768 dbSNP
rs914450097 2773 dbSNP
rs1438759761 2775 dbSNP
rs1393778169 2781 dbSNP
rs1439833962 2783 dbSNP
rs1056233348 2793 dbSNP
rs886817623 2795 dbSNP
rs932645132 2798 dbSNP
rs192966878 2799 dbSNP
rs1170175324 2800 dbSNP
rs62271506 2803 dbSNP
rs1176552889 2804 dbSNP
rs1038582961 2805 dbSNP
rs1461677101 2811 dbSNP
rs763593633 2818 dbSNP
rs1329640413 2820 dbSNP
rs1251775549 2822 dbSNP
rs1402715649 2827 dbSNP
rs572978552 2835 dbSNP
rs772538220 2836 dbSNP
rs1203526707 2838 dbSNP
rs541985623 2841 dbSNP
rs1037633907 2842 dbSNP
rs1370356478 2845 dbSNP
rs1397128465 2846 dbSNP
rs561866738 2849 dbSNP
rs1449362293 2851 dbSNP
rs530875491 2861 dbSNP
rs1008151114 2863 dbSNP
rs1298007553 2867 dbSNP
rs74396267 2875 dbSNP
rs1361214270 2887 dbSNP
rs1307348580 2889 dbSNP
rs1434573860 2894 dbSNP
rs956166667 2895 dbSNP
rs1217168409 2898 dbSNP
rs1178697230 2904 dbSNP
rs1441214885 2907 dbSNP
rs990178431 2916 dbSNP
rs1315376158 2918 dbSNP
rs1176225368 2924 dbSNP
rs1483466964 2925 dbSNP
rs372676710 2932 dbSNP
rs144118306 2934 dbSNP
rs1257481241 2939 dbSNP
rs184800293 2940 dbSNP
rs1457910479 2944 dbSNP
rs755371524 2947 dbSNP
rs766953418 2948 dbSNP
rs1244424240 2956 dbSNP
rs1306588767 2960 dbSNP
rs1396768010 2962 dbSNP
rs1381809726 2966 dbSNP
rs895394754 2970 dbSNP
rs968261196 2972 dbSNP
rs1418707305 2976 dbSNP
rs1361706311 2978 dbSNP
rs1158764694 2981 dbSNP
rs1454918999 2983 dbSNP
rs1012576620 2985 dbSNP
rs533497460 3005 dbSNP
rs1423965194 3006 dbSNP
rs746247753 3009 dbSNP
rs1259432196 3012 dbSNP
rs1185512000 3018 dbSNP
rs1172530982 3019 dbSNP
rs867592629 3023 dbSNP
rs971584214 3035 dbSNP
rs189762678 3038 dbSNP
rs1325312947 3044 dbSNP
rs1218643107 3049 dbSNP
rs1348127842 3060 dbSNP
rs939001001 3082 dbSNP
rs181313675 3087 dbSNP
rs908199064 3090 dbSNP
rs765768691 3092 dbSNP
rs1233018038 3099 dbSNP
rs1341474313 3100 dbSNP
rs1361840549 3103 dbSNP
rs955857773 3104 dbSNP
rs989946170 3111 dbSNP
rs374756360 3112 dbSNP
rs529515036 3120 dbSNP
rs1382142463 3131 dbSNP
rs183620456 3132 dbSNP
rs1419533631 3145 dbSNP
rs985886978 3146 dbSNP
rs753314432 3158 dbSNP
rs568170315 3160 dbSNP
rs1323070809 3162 dbSNP
rs944007305 3164 dbSNP
rs1221648542 3167 dbSNP
rs758814489 3171 dbSNP
rs77186956 3172 dbSNP
rs1031670119 3177 dbSNP
rs918637996 3185 dbSNP
rs1195621887 3187 dbSNP
rs1213244934 3187 dbSNP
rs1319047479 3191 dbSNP
rs1263555122 3208 dbSNP
rs1280414917 3208 dbSNP
rs931515972 3213 dbSNP
rs891777361 3217 dbSNP
rs1011632671 3218 dbSNP
rs557042772 3221 dbSNP
rs1395972029 3232 dbSNP
rs1323498211 3234 dbSNP
rs1022097625 3253 dbSNP
rs1400853318 3257 dbSNP
rs141116914 3263 dbSNP
rs1474416100 3264 dbSNP
rs1372394562 3274 dbSNP
rs980973726 3275 dbSNP
rs1033515094 3277 dbSNP
rs1012488632 3280 dbSNP
rs1458379286 3289 dbSNP
rs539384432 3294 dbSNP
rs908231914 3301 dbSNP
rs939645457 3302 dbSNP
rs906888141 3304 dbSNP
rs973863801 3312 dbSNP
rs553210516 3314 dbSNP
rs1031430602 3315 dbSNP
rs1439784326 3324 dbSNP
rs1377159377 3326 dbSNP
rs1330694423 3341 dbSNP
rs955764722 3343 dbSNP
rs1011453342 3344 dbSNP
rs1021448790 3364 dbSNP
rs1380864322 3365 dbSNP
rs953971336 3374 dbSNP
rs1228440204 3376 dbSNP
rs891288459 3382 dbSNP
rs1436433929 3383 dbSNP
rs1282898151 3385 dbSNP
rs1351431789 3386 dbSNP
rs573024821 3391 dbSNP
rs985406990 3395 dbSNP
rs912444458 3405 dbSNP
rs1440601492 3408 dbSNP
rs1053274734 3419 dbSNP
rs965409106 3425 dbSNP
rs1179863071 3426 dbSNP
rs188371664 3428 dbSNP
rs1257222892 3433 dbSNP
rs1213730175 3440 dbSNP
rs555100057 3442 dbSNP
rs1011496723 3444 dbSNP
rs144840909 3453 dbSNP
rs1185111655 3459 dbSNP
rs1277638299 3463 dbSNP
rs1021713198 3467 dbSNP
rs1350710038 3473 dbSNP
rs1280946906 3476 dbSNP
rs905981472 3482 dbSNP
rs918711623 3483 dbSNP
rs1473875201 3486 dbSNP
rs1001617885 3487 dbSNP
rs1033959033 3491 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Location of target site 3'UTR
Article - Calin GA; Cimmino A; Fabbri M; Ferracin M; et al.
- Proceedings of the National Academy of Sciences of the United States of America, 2008
MicroRNAs (miRNAs) are short noncoding RNAs regulating gene expression that play roles in human diseases, including cancer. Each miRNA is predicted to regulate hundreds of transcripts, but only few have experimental validation. In chronic lymphocytic leukemia (CLL), the most common adult human leukemia, miR-15a and miR-16-1 are lost or down-regulated in the majority of cases. After our previous work indicating a tumor suppressor function of miR-15a/16-1 by targeting the BCL2 oncogene, here, we produced a high-throughput profiling of genes modulated by miR-15a/16-1 in a leukemic cell line model (MEG-01) and in primary CLL samples. By combining experimental and bioinformatics data, we identified a miR-15a/16-1-gene signature in leukemic cells. Among the components of the miR-15a/16-1 signature, we observed a statistically significant enrichment in AU-rich elements (AREs). By examining the Gene Ontology (GO) database, a significant enrichment in cancer genes (such as MCL1, BCL2, ETS1, or JUN) that directly or indirectly affect apoptosis and cell cycle was found.
LinkOut: [PMID: 18362358]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*