miRTarBase - #MIRT000815
-
| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-15a |
| Genomic Coordinates | chr13: 50049119 - 50049201 |
| Synonyms | MIRN15A, hsa-mir-15a, miRNA15A, MIR15A |
| Description | Homo sapiens miR-15a stem-loop |
| Comment | Reference . |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |
|---|---|
| Mature miRNA | hsa-miR-15a-5p |
| Sequence | 14| UAGCAGCACAUAAUGGUUUGUG |35 |
| Evidence | Experimental |
| Experiments | Cloned |
| SNPs in miRNA | |
| Putative Targets | |
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | Circulating MicroRNA Expression Profiling |
|---|
| Gene Information | |
|---|---|
| Gene Symbol | BCL2 |
| Synonyms | Bcl-2, PPP1R50 |
| Description | BCL2, apoptosis regulator |
| Transcript | NM_000633 |
| Other Transcripts | NM_000657 |
| Expression | |
| Putative miRNA Targets on BCL2 | |
| 3'UTR of BCL2 (miRNA target sites are highlighted) |
>BCL2|NM_000633|3'UTR 1 AGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGTACC 81 ATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACACAC 161 AACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATTATT 241 AAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAGCAC 321 CGCTTCGTGTGGCTCCACCTGGATGTTCTGTGCCTGTAAACATAGATTCGCTTTCCATGTTGTTGGCCGGATCACCATCT 401 GAAGAGCAGACGGATGGAAAAAGGACCTGATCATTGGGGAAGCTGGCTTTCTGGCTGCTGGAGGCTGGGGAGAAGGTGTT 481 CATTCACTTGCATTTCTTTGCCCTGGGGGCTGTGATATTAACAGAGGGAGGGTTCCTGTGGGGGGAAGTCCATGCCTCCC 561 TGGCCTGAAGAAGAGACTCTTTGCATATGACTCACATGATGCATACCTGGTGGGAGGAAAAGAGTTGGGAACTTCAGATG 641 GACCTAGTACCCACTGAGATTTCCACGCCGAAGGACAGCGATGGGAAAAATGCCCTTAAATCATAGGAAAGTATTTTTTT 721 AAGCTACCAATTGTGCCGAGAAAAGCATTTTAGCAATTTATACAATATCATCCAGTACCTTAAGCCCTGATTGTGTATAT 801 TCATATATTTTGGATACGCACCCCCCAACTCCCAATACTGGCTCTGTCTGAGTAAGAAACAGAATCCTCTGGAACTTGAG 881 GAAGTGAACATTTCGGTGACTTCCGCATCAGGAAGGCTAGAGTTACCCAGAGCATCAGGCCGCCACAAGTGCCTGCTTTT 961 AGGAGACCGAAGTCCGCAGAACCTGCCTGTGTCCCAGCTTGGAGGCCTGGTCCTGGAACTGAGCCGGGGCCCTCACTGGC 1041 CTCCTCCAGGGATGATCAACAGGGCAGTGTGGTCTCCGAATGTCTGGAAGCTGATGGAGCTCAGAATTCCACTGTCAAGA 1121 AAGAGCAGTAGAGGGGTGTGGCTGGGCCTGTCACCCTGGGGCCCTCCAGGTAGGCCCGTTTTCACGTGGAGCATGGGAGC 1201 CACGACCCTTCTTAAGACATGTATCACTGTAGAGGGAAGGAACAGAGGCCCTGGGCCCTTCCTATCAGAAGGACATGGTG 1281 AAGGCTGGGAACGTGAGGAGAGGCAATGGCCACGGCCCATTTTGGCTGTAGCACATGGCACGTTGGCTGTGTGGCCTTGG 1361 CCCACCTGTGAGTTTAAAGCAAGGCTTTAAATGACTTTGGAGAGGGTCACAAATCCTAAAAGAAGCATTGAAGTGAGGTG 1441 TCATGGATTAATTGACCCCTGTCTATGGAATTACATGTAAAACATTATCTTGTCACTGTAGTTTGGTTTTATTTGAAAAC 1521 CTGACAAAAAAAAAGTTCCAGGTGTGGAATATGGGGGTTATCTGTACATCCTGGGGCATTAAAAAAAAAATCAATGGTGG 1601 GGAACTATAAAGAAGTAACAAAAGAAGTGACATCTTCAGCAAATAAACTAGGAAATTTTTTTTTCTTCCAGTTTAGAATC 1681 AGCCTTGAAACATTGATGGAATAACTCTGTGGCATTATTGCATTATATACCATTTATCTGTATTAACTTTGGAATGTACT 1761 CTGTTCAATGTTTAATGCTGTGGTTGATATTTCGAAAGCTGCTTTAAAAAAATACATGCATCTCAGCGTTTTTTTGTTTT 1841 TAATTGTATTTAGTTATGGCCTATACACTATTTGTGAGCAAAGGTGATCGTTTTCTGTTTGAGATTTTTATCTCTTGATT 1921 CTTCAAAAGCATTCTGAGAAGGTGAGATAAGCCCTGAGTCTCAGCTACCTAAGAAAAACCTGGATGTCACTGGCCACTGA 2001 GGAGCTTTGTTTCAACCAAGTCATGTGCATTTCCACGTCAACAGAATTGTTTATTGTGACAGTTATATCTGTTGTCCCTT 2081 TGACCTTGTTTCTTGAAGGTTTCCTCGTCCCTGGGCAATTCCGCATTTAATTCATGGTATTCAGGATTACATGCATGTTT 2161 GGTTAAACCCATGAGATTCATTCAGTTAAAAATCCAGATGGCAAATGACCAGCAGATTCAAATCTATGGTGGTTTGACCT 2241 TTAGAGAGTTGCTTTACGTGGCCTGTTTCAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTTCTC 2321 ATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGAAAGCAGGAAACCTGTGGTATGAAGC 2401 CAGACCTCCCCGGCGGGCCTCAGGGAACAGAATGATCAGACCTTTGAATGATTCTAATTTTTAAGCAAAATATTATTTTA 2481 TGAAAGGTTTACATTGTCAAAGTGATGAATATGGAATATCCAATCCTGTGCTGCTATCCTGCCAAAATCATTTTAATGGA 2561 GTCAGTTTGCAGTATGCTCCACGTGGTAAGATCCTCCAAGCTGCTTTAGAAGTAACAATGAAGAACGTGGACGTTTTTAA 2641 TATAAAGCCTGTTTTGTCTTTTGTTGTTGTTCAAACGGGATTCACAGAGTATTTGAAAAATGTATATATATTAAGAGGTC 2721 ACGGGGGCTAATTGCTGGCTGGCTGCCTTTTGCTGTGGGGTTTTGTTACCTGGTTTTAATAACAGTAAATGTGCCCAGCC 2801 TCTTGGCCCCAGAACTGTACAGTATTGTGGCTGCACTTGCTCTAAGAGTAGTTGATGTTGCATTTTCCTTATTGTTAAAA 2881 ACATGTTAGAAGCAATGAATGTATATAAAAGCCTCAACTAGTCATTTTTTTCTCCTCTTCTTTTTTTTCATTATATCTAA 2961 TTATTTTGCAGTTGGGCAACAGAGAACCATCCCTATTTTGTATTGAAGAGGGATTCACATCTGCATCTTAACTGCTCTTT 3041 ATGAATGAAAAAACAGTCCTCTGTATGTACTCCTCTTTACACTGGCCAGGGTCAGAGTTAAATAGAGTATATGCACTTTC 3121 CAAATTGGGGACAAGGGCTCTAAAAAAAGCCCCAAAAGGAGAAGAACATCTGAGAACCTCCTCGGCCCTCCCAGTCCCTC 3201 GCTGCACAAATACTCCGCAAGAGAGGCCAGAATGACAGCTGACAGGGTCTATGGCCATCGGGTCGTCTCCGAAGATTTGG 3281 CAGGGGCAGAAAACTCTGGCAGGCTTAAGATTTGGAATAAAGTCACAGAATTAAGGAAGCACCTCAATTTAGTTCAAACA 3361 AGACGCCAACATTCTCTCCACAGCTCACTTACCTCTCTGTGTTCAGATGTGGCCTTCCATTTATATGTGATCTTTGTTTT 3441 ATTAGTAAATGCTTATCATCTAAAGATGTAGCTCTGGCCCAGTGGGAAAAATTAGGAAGTGATTATAAATCGAGAGGAGT 3521 TATAATAATCAAGATTAAATGTAAATAATCAGGGCAATCCCAACACATGTCTAGCTTTCACCTCCAGGATCTATTGAGTG 3601 AACAGAATTGCAAATAGTCTCTATTTGTAATTGAACTTATCCTAAAACAAATAGTTTATAAATGTGAACTTAAACTCTAA 3681 TTAATTCCAACTGTACTTTTAAGGCAGTGGCTGTTTTTAGACTTTCTTATCACTTATAGTTAGTAATGTACACCTACTCT 3761 ATCAGAGAAAAACAGGAAAGGCTCGAAATACAAGCCATTCTAAGGAAATTAGGGAGTCAGTTGAAATTCTATTCTGATCT 3841 TATTCTGTGGTGTCTTTTGCAGCCCAGACAAATGTGGTTACACACTTTTTAAGAAATACAATTCTACATTGTCAAGCTTA 3921 TGAAGGTTCCAATCAGATCTTTATTGTTATTCAATTTGGATCTTTCAGGGATTTTTTTTTTAAATTATTATGGGACAAAG 4001 GACATTTGTTGGAGGGGTGGGAGGGAGGAAGAATTTTTAAATGTAAAACATTCCCAAGTTTGGATCAGGGAGTTGGAAGT 4081 TTTCAGAATAACCAGAACTAAGGGTATGAAGGACCTGTATTGGGGTCGATGTGATGCCTCTGCGAAGAACCTTGTGTGAC 4161 AAATGAGAAACATTTTGAAGTTTGTGGTACGACCTTTAGATTCCAGAGACATCAGCATGGCTCAAAGTGCAGCTCCGTTT 4241 GGCAGTGCAATGGTATAAATTTCAAGCTGGATATGTCTAATGGGTATTTAAACAATAAATGTGCAGTTTTAACTAACAGG 4321 ATATTTAATGACAACCTTCTGGTTGGTAGGGACATCTGTTTCTAAATGTTTATTATGTACAATACAGAAAAAAATTTTAT 4401 AAAATTAAGCAATGTGAAACTGAATTGGAGAGTGATAATACAAGTCCTTTAGTCTTACCCAGTGAATCATTCTGTTCCAT 4481 GTCTTTGGACAACCATGACCTTGGACAATCATGAAATATGCATCTCACTGGATGCAAAGAAAATCAGATGGAGCATGAAT 4561 GGTACTGTACCGGTTCATCTGGACTGCCCCAGAAAAATAACTTCAAGCAAACATCCTATCAACAACAAGGTTGTTCTGCA 4641 TACCAAGCTGAGCACAGAAGATGGGAACACTGGTGGAGGATGGAAAGGCTCGCTCAATCAAGAAAATTCTGAGACTATTA 4721 ATAAATAAGACTGTAGTGTAGATACTGAGTAAATCCATGCACCTAAACCTTTTGGAAAATCTGCCGTGGGCCCTCCAGAT 4801 AGCTCATTTCATTAAGTTTTTCCCTCCAAGGTAGAATTTGCAAGAGTGACAGTGGATTGCATTTCTTTTGGGGAAGCTTT 4881 CTTTTGGTGGTTTTGTTTATTATACCTTCTTAAGTTTTCAACCAAGGTTTGCTTTTGTTTTGAGTTACTGGGGTTATTTT 4961 TGTTTTAAATAAAAATAAGTGTACAATAAGTGTTTTTGTATTGAAAGCTTTTGTTATCAAGATTTTCATACTTTTACCTT 5041 CCATGGCTCTTTTTAAGATTGATACTTTTAAGAGGTGGCTGATATTCTGCAACACTGTACACATAAAAAATACGGTAAGG 5121 ATACTTTACATGGTTAAGGTAAAGTAAGTCTCCAGTTGGCCACCATTAGCTATAATGGCACTTTGTTTGTGTTGTTGGAA 5201 AAAGTCACATTGCCATTAAACTTTCCTTGTCTGTCTAGTTAATATTGTGAAGAAAAATAAAGTACAGTGTGAGATACTG Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
DRVs in gene 3'UTRs |
| SNPs in gene 3'UTRs | |
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | CLL patient samples |
| Location of target site | 3'UTR |
| Original Description (Extracted from the article) |
...
BCL2 Is a Target of Posttranscriptional Repression by miR-15 and miR-16.//both mutants completely abolish the interaction between miR-15a and miR-16-1 and the 3'UTR of BCL2 (Fig. 2C).//These data indicate that both miRNAs directly interact with the 3'UTR of BCL2.
... - Cimmino A; Calin GA; Fabbri M; Iorio MV; et al., 2005, Proceedings of the National Academy of Sciences of the United States of America. |
| Article |
- Cimmino A; Calin GA; Fabbri M; Iorio MV; et al. - Proceedings of the National Academy of Sciences of the United States of America, 2005
Chronic lymphocytic leukemia (CLL) is the most common human leukemia and is characterized by predominantly nondividing malignant B cells overexpressing the antiapoptotic B cell lymphoma 2 (Bcl2) protein. miR-15a and miR-16-1 are deleted or down-regulated in the majority of CLLs. Here, we demonstrate that miR-15a and miR-16-1 expression is inversely correlated to Bcl2 expression in CLL and that both microRNAs negatively regulate Bcl2 at a posttranscriptional level. BCL2 repression by these microRNAs induces apoptopsis in a leukemic cell line model. Therefore, miR-15 and miR-16 are natural antisense Bcl2 interactors that could be used for therapy of Bcl2-overexpressing tumors.
LinkOut: [PMID: 16166262]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HL60 , NB41A3 |
| Disease | 596.0; |
| Location of target site | 3'UTR |
| Tools used in this research | microRNA.org , miRanda , PicTar |
| Original Description (Extracted from the article) |
...
"we report the miRNA gene expression pro茂卢聛le of an APL cell line (NB4) upon granulocytic differentiation with ATRA. The results were also con茂卢聛rmed in HL-60 cells
... - Garzon R; Pichiorri F; Palumbo T; Visentini et al., 2007, Oncogene. |
| Article |
- Garzon R; Pichiorri F; Palumbo T; Visentini et al. - Oncogene, 2007
MicroRNAs (miRNAs) are small non-coding RNAs of 19-25 nucleotides that are involved in the regulation of critical cell processes such as apoptosis, cell proliferation and differentiation. However, little is known about the role of miRNAs in granulopoiesis. Here, we report the expression of miRNAs in acute promyelocytic leukemia patients and cell lines during all-trans-retinoic acid (ATRA) treatment by using a miRNA microarrays platform and quantitative real time-polymerase chain reaction (qRT-PCR). We found upregulation of miR-15a, miR-15b, miR-16-1, let-7a-3, let-7c, let-7d, miR-223, miR-342 and miR-107, whereas miR-181b was downregulated. Among the upregulated miRNAs, miR-107 is predicted to target NFI-A, a gene that has been involved in a regulatory loop involving miR-223 and C/EBPa during granulocytic differentiation. Indeed, we have confirmed that miR-107 targets NF1-A. To get insights about ATRA regulation of miRNAs, we searched for ATRA-modulated transcription factors binding sites in the upstream genomic region of the let-7a-3/let-7b cluster and identified several putative nuclear factor-kappa B (NF-kappaB) consensus elements. The use of reporter gene assays, chromatin immunoprecipitation and site-directed mutagenesis revealed that one proximal NF-kappaB binding site is essential for the transactivation of the let-7a-3/let-7b cluster. Finally, we show that ATRA downregulation of RAS and Bcl2 correlate with the activation of known miRNA regulators of those proteins, let-7a and miR-15a/miR-16-1, respectively.
LinkOut: [PMID: 17260024]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Article |
- Calin GA; Pekarsky Y; Croce CM - Best practice & research. Clinical haematology, 2007
New findings support the view that chronic lymphocytic leukemia (CLL) is a genetic disease in which the main alterations occur in a new class of genes named microRNAs (miRNAs). Cases with good prognostic features typically are characterized by miRNA down-regulation of genes miR-15a and miR-16-1, located at 13q14.3. Both microRNAs negatively regulate BCL2 at a post-transcriptional level. On the other hand, in CLL cases that use unmutated immunoglobulin heavy-chain variable-region genes (IgV(H)) or have high-level expression of the 70-kD zeta-associated protein (ZAP-70) have high levels of TCL1 due to low-level expression of miR-29 and miR-181, which directly target this oncogene. Conceivably, these miRNAs might be used to target BCL2 or TCL1 for therapy of this disease.
LinkOut: [PMID: 17707831]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Article |
- Cho WC - Molecular cancer, 2007
microRNAs (miRNAs) are evolutionarily conserved, endogenous, small, noncoding RNA molecules of about 22 nucleotides in length that function as posttranscriptional gene regulators. They are deemed to play a crucial role in the initiation and progression of human cancer, and those with a role in cancer are designated as oncogenic miRNAs (oncomiRs). For example, miR-15 and miR-16 induce apoptosis by targeting Bcl2. miRNAs from the miR-17-92 cluster modulate tumor formation and function as oncogenes by influencing the translation of E2F1 mRNA. miR-21 modulates gemcitabine-induced apoptosis by phosphatase and tensin homolog deleted on chromosome 10-dependent activation of PI 3-kinase signaling. miR-34a acts as a suppressor of neuroblastoma tumorigenesis by targeting the mRNA encoding E2F3 and reducing E2F3 protein levels. The chromosomal translocations associating with human tumors disrupt the repression of High mobility group A2 by let-7 miRNA. In addition, the oncomiRs expression profiling of human malignancies has also identified a number of diagnostic and prognostic cancer signatures. This article introduces the roles of oncomiRs in neoplasm development, progression, diagnosis, prognostication, as well as their mechanism of actions on target mRNAs and the functional outcomes of their actions on mRNAs. The paper ends with a brief perspective to the future of oncomiRs.
LinkOut: [PMID: 17894887]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Location of target site | 3'UTR |
| Original Description (Extracted from the article) |
...
changed
... - Calin GA; Cimmino A; Fabbri M; Ferracin M; et al., 2008, Proceedings of the National Academy of Sciences of the United States of America. |
| Article |
- Calin GA; Cimmino A; Fabbri M; Ferracin M; et al. - Proceedings of the National Academy of Sciences of the United States of America, 2008
MicroRNAs (miRNAs) are short noncoding RNAs regulating gene expression that play roles in human diseases, including cancer. Each miRNA is predicted to regulate hundreds of transcripts, but only few have experimental validation. In chronic lymphocytic leukemia (CLL), the most common adult human leukemia, miR-15a and miR-16-1 are lost or down-regulated in the majority of cases. After our previous work indicating a tumor suppressor function of miR-15a/16-1 by targeting the BCL2 oncogene, here, we produced a high-throughput profiling of genes modulated by miR-15a/16-1 in a leukemic cell line model (MEG-01) and in primary CLL samples. By combining experimental and bioinformatics data, we identified a miR-15a/16-1-gene signature in leukemic cells. Among the components of the miR-15a/16-1 signature, we observed a statistically significant enrichment in AU-rich elements (AREs). By examining the Gene Ontology (GO) database, a significant enrichment in cancer genes (such as MCL1, BCL2, ETS1, or JUN) that directly or indirectly affect apoptosis and cell cycle was found.
LinkOut: [PMID: 18362358]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Article |
- Xia L; Zhang D; Du R; Pan Y; Zhao L; Sun S; et al. - International journal of cancer, 2008
microRNAs are endogenous small noncoding RNAs that regulate gene expression negatively at posttranscriptional level. This latest addition to the complex gene regulatory circuitry revolutionizes our way to understanding physiological and pathological processes in the human body. Here we investigated the possible role of microRNAs in the development of multidrug resistance (MDR) in gastric cancer cells. microRNA expression profiling revealed a limited set of microRNAs with altered expression in multidrug- resistant gastric cancer cell line SGC7901/VCR compared to its parental SGC7901 cell line. Among the downregulated microRNAs are miR-15b and miR-16, members of miR-15/16 family, whose expression was further validated by qRT-PCR. In vitro drug sensitivity assay demonstrated that overexpression of miR-15b or miR-16 sensitized SGC7901/VCR cells to anticancer drugs whereas inhibition of them using antisense oligonucleotides conferred SGC7901 cells MDR. The downregulation of miR-15b and miR-16 in SGC7901/VCR cells was concurrent with the upregulation of Bcl-2 protein. Enforced mir-15b or miR-16 expression reduced Bcl-2 protein level and the luciferase activity of a BCL2 3' untranslated region-based reporter construct in SGC7901/VCR cells, suggesting that BCL2 is a direct target of miR-15b and miR-16. Moreover, overexpression of miR-15b or miR-16 could sensitize SGC7901/VCR cells to VCR-induced apoptosis. Taken together, our findings suggest that miR-15b and miR-16 could play a role in the development of MDR in gastric cancer cells at least in part by modulation of apoptosis via targeting BCL2.
LinkOut: [PMID: 18449891]
|
| Experimental Support 7 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Article |
- Bonci D; Coppola V; Musumeci M; Addario A; et al. - Nature medicine, 2008
MicroRNAs (miRNAs) are noncoding small RNAs that repress protein translation by targeting specific messenger RNAs. miR-15a and miR-16-1 act as putative tumor suppressors by targeting the oncogene BCL2. These miRNAs form a cluster at the chromosomal region 13q14, which is frequently deleted in cancer. Here, we report that the miR-15a and miR-16-1 cluster targets CCND1 (encoding cyclin D1) and WNT3A, which promotes several tumorigenic features such as survival, proliferation and invasion. In cancer cells of advanced prostate tumors, the miR-15a and miR-16 level is significantly decreased, whereas the expression of BCL2, CCND1 and WNT3A is inversely upregulated. Delivery of antagomirs specific for miR-15a and miR-16 to normal mouse prostate results in marked hyperplasia, and knockdown of miR-15a and miR-16 promotes survival, proliferation and invasiveness of untransformed prostate cells, which become tumorigenic in immunodeficient NOD-SCID mice. Conversely, reconstitution of miR-15a and miR-16-1 expression results in growth arrest, apoptosis and marked regression of prostate tumor xenografts. Altogether, we propose that miR-15a and miR-16 act as tumor suppressor genes in prostate cancer through the control of cell survival, proliferation and invasion. These findings have therapeutic implications and may be exploited for future treatment of prostate cancer.
LinkOut: [PMID: 18931683]
|
| Experimental Support 8 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | FASTH |
| Original Description (Extracted from the article) |
...
"Assessed by p-value
... - Ragan C; Cloonan N; Grimmond SM; Zuker M; Ragan MA, 2009, PloS one. |
| Article |
- Ragan C; Cloonan N; Grimmond SM; Zuker M; Ragan MA - PloS one, 2009
Transcriptional regulation by microRNAs (miRNAs) involves complementary base-pairing at target sites on mRNAs, yielding complex secondary structures. Here we introduce an efficient computational approach and software (FASTH) for genome-scale prediction of miRNA target sites based on minimizing the free energy of duplex structure. We apply our approach to identify miRNA target sites in the human and mouse transcriptomes. Our results show that short sequence motifs in the 5' end of miRNAs frequently match mRNAs perfectly, not only at validated target sites but additionally at many other, energetically favourable sites. High-quality matching regions are abundant and occur at similar frequencies in all mRNA regions, not only the 3'UTR. About one-third of potential miRNA target sites are reassigned to different mRNA regions, or gained or lost altogether, among different transcript isoforms from the same gene. Many potential miRNA target sites predicted in human are not found in mouse, and vice-versa, but among those that do occur in orthologous human and mouse mRNAs most are situated in corresponding mRNA regions, i.e. these sites are themselves orthologous. Using a luciferase assay in HEK293 cells, we validate four of six predicted miRNA-mRNA interactions, with the mRNA level reduced by an average of 73%. We demonstrate that a thermodynamically based computational approach to prediction of miRNA binding sites on mRNAs can be scaled to analyse complete mammalian transcriptome datasets. These results confirm and extend the scope of miRNA-mediated species- and transcript-specific regulation in different cell types, tissues and developmental conditions.
LinkOut: [PMID: 19478946]
|
| Experimental Support 9 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | OV-202 |
| Original Description (Extracted from the article) |
...
MiR-15a and miR-16 also target Bcl-2 in ovarian cancer cell lines.
... - Bhattacharya R; Nicoloso M; Arvizo R; Wang et al., 2009, Cancer research. |
| Article |
- Bhattacharya R; Nicoloso M; Arvizo R; Wang et al. - Cancer research, 2009
Oncogenic activation of Bmi-1 is found in a wide variety of epithelial malignancies including ovarian cancer, yet a specific mechanism for overexpression of Bmi-1 has not been determined. Thus, realizing the immense pathologic significance of Bmi-1 in cancer, we wanted to investigate if microRNA (miRNA) aberrations played a role in the regulation of Bmi-1 in ovarian cancer. In this report, we identify two miRNAs, miR-15a and miR-16, that are underexpressed in ovarian cell lines and in primary ovarian tissues. We show that these miRNAs directly target the Bmi-1 3' untranslated region and significantly correlate with Bmi-1 protein levels in ovarian cancer patients and cell lines. Furthermore, Bmi-1 protein levels are downregulated in response to miR-15a or miR-16 expression and lead to significant reduction in ovarian cancer cell proliferation and clonal growth. These findings suggest the development of therapeutic strategies by restoring miR-15a and miR-16 expression in ovarian cancer and in other cancers that involve upregulation of Bmi-1.
LinkOut: [PMID: 19903841]
|
| Experimental Support 10 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF-7 , MDA-MB-231 |
| Disease | breast carcinoma |
| Location of target site | 3'UTR |
| Original Description (Extracted from the article) |
...
These results further implicate the BCL-2 targeting miR-15a/16 as important regulators of BCL-2 expression and tamoxifen response and suggest that oncogene suppression of miR-15a and/or miR-16 may represent an important mechanism of tamoxifen resistance.
... - Cittelly DM; Das PM; Salvo VA; Fonseca JP; et al., 2010, Carcinogenesis. |
| Article |
- Cittelly DM; Das PM; Salvo VA; Fonseca JP; et al. - Carcinogenesis, 2010
Tamoxifen is the most commonly prescribed therapy for patients with estrogen receptor (ER)alpha-positive breast tumors. Tumor resistance to tamoxifen remains a serious clinical problem especially in patients with tumors that also overexpress human epidermal growth factor receptor 2 (HER2). Current preclinical models of HER2 overexpression fail to recapitulate the clinical spectrum of endocrine resistance associated with HER2/ER-positive tumors. Here, we show that ectopic expression of a clinically important oncogenic isoform of HER2, HER2Delta16, which is expressed in >30% of ER-positive breast tumors, promotes tamoxifen resistance and estrogen independence of MCF-7 xenografts. MCF-7/HER2Delta16 cells evade tamoxifen through upregulation of BCL-2, whereas mediated suppression of BCL-2 expression or treatment of MCF-7/HER2Delta16 cells with the BCL-2 family pharmacological inhibitor ABT-737 restores tamoxifen sensitivity. Tamoxifen-resistant MCF-7/HER2Delta16 cells upregulate BCL-2 protein levels in response to suppressed ERalpha signaling mediated by estrogen withdrawal, tamoxifen treatment or fulvestrant treatment. In addition, HER2Delta16 expression results in suppression of BCL-2-targeting microRNAs miR-15a and miR-16. Reintroduction of miR-15a/16 reduced tamoxifen-induced BCL-2 expression and sensitized MCF-7/HER2Delta16 to tamoxifen. Conversely, inhibition of miR-15a/16 in tamoxifen-sensitive cells activated BCL-2 expression and promoted tamoxifen resistance. Our results suggest that HER2Delta16 expression promotes endocrine-resistant HER2/ERalpha-positive breast tumors and in contrast to wild-type HER2, preclinical models of HER2Delta16 overexpression recapitulate multiple phenotypes of endocrine-resistant human breast tumors. The mechanism of HER2Delta16 therapeutic evasion, involving tamoxifen-induced upregulation of BCL-2 and suppression of miR-15a/16, provides a template for unique therapeutic interventions combining tamoxifen with modulation of microRNAs and/or ABT-737-mediated BCL-2 inhibition and apoptosis.
LinkOut: [PMID: 20876285]
|
| Experimental Support 11 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Article |
- Klein U; Dalla-Favera R - Seminars in cancer biology, 2010
Chronic lymphocytic leukemia (CLL), an incurable disease of the elderly, stands out as unique among the malignancies derived from mature B lymphocytes. The histology, immunophenotype, immunoglobulin variable region (IgV) gene somatic hypermutation status, and the pattern of genetic alterations of the tumor cells are markedly distinct from that of any other B-cell tumor. Most notably, CLL cases can have somatically mutated as well as unmutated IgV genes which largely correlate with a favorable and unfavorable clinical prognosis, respectively. Moreover, recent evidence suggests that 6% of the normal elderly population develops a monoclonal B-cell lymphocytosis (MBL) that appears as the precursor to CLL in 1-2% of cases. Over the last decade, global gene expression profile analysis was instrumental in defining CLL as a malignancy originating from the oncogenic transformation of a common cellular precursor that resembles an antigen-experienced B cell. These findings were complemented by the realization that all CLL, independent of their IgV gene somatic mutation status, express B-cell receptors (BCRs) that show evidence of antigen-experience. Indeed, the BCRs of CLL cases among different individuals can be similar to the extent that one was able to define subsets of stereotyped receptors based on the homology in the antigen-binding regions. Together, these observations strongly support the notion that antigen plays a critical role in CLL pathogenesis. This role is complemented by genetic alterations that, analogous to most cancer types, represent the initiating pathogenetic event. In fact, CLL cases display recurrent genetic aberrations including trisomy 12 and monoallelic or biallelic deletion/inactivation of chromosomal regions 17p, 11q and 13q14. However, virtually all CLL cases lack balanced reciprocal chromosomal translocations, the genetic hallmark of germinal center (GC)-derived lymphomas. The most frequent genetic aberration in CLL, deletion of chromosomal region 13q14, was recently shown to have a specific role in CLL pathogenesis. This region encodes a tumor suppressor locus comprising a microRNA cluster embedded in a long sterile RNA gene, whose deletion in the mouse leads to lymphoproliferative syndromes recapitulating the human CLL-associated spectrum, including MBL, CLL and B-cell non-Hodgkin lymphoma (B-NHL). This review will focus on the cellular origin of CLL, its relationship to the mechanisms of generating CLL-associated genetic lesions and on the role of the 13q14 deletion in CLL pathogenesis as emerging from the analysis of a newly generated mouse model.
LinkOut: [PMID: 21029776]
|
| Experimental Support 12 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Jiyoye |
| Tools used in this research | TargetScan |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2.
... - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal. |
| Article |
- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al. - The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
|
| Experimental Support 13 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 , tamoxifen-resistant MCF7 |
| Disease | 596.0 |
| Location of target site | 3'UTR |
| Tools used in this research | previous_study |
| Original Description (Extracted from the article) |
...
"Transfection with mimics of miR-15a and miR-16 reduced Bcl-2 and cyclin E1 protein expression in MCF7-Re cells (Figure 2B)
... - Chu J; Zhu Y; Liu Y; Sun L; Lv X; Wu Y; Hu et al., 2015, Oncotarget. |
| Article |
- Chu J; Zhu Y; Liu Y; Sun L; Lv X; Wu Y; Hu et al. - Oncotarget, 2015
About 50-70% of breast cancers are estrogen receptor alpha (ERalpha) positive and most of them are sensitive to endocrine therapy including tamoxifen. However, one third of these patients will eventually develop resistance and relapse. We found that the expression of miR-15a and miR-16 were significantly decreased in tamoxifen resistant ER positive breast cancer cell lines. Exogenous expression of miR-15a/16 mimics re-sensitized resistant cells to tamoxifen by inhibiting Cyclin E1 and B cell lymphoma-2 (Bcl-2) to induce cell growth arrest and apoptosis respectively. Further, we identified that a repressive member of E2F family, E2F7, was responsible for the suppression of miR-15a/16 cluster by competing with E2F1 for E2F binding site at the promoter of their host gene DLEU2. Moreover, high expression of E2F7 is correlated with high risk of relapse and poor prognosis in breast cancer patients receiving tamoxifen treatment. Together, our results suggest that overexpression of E2F7 represses miR-15a/16 and then increases Cyclin E1 and Bcl-2 that result in tamoxifen resistance. E2F7 may be a valuable prognostic marker and a therapeutic target of tamoxifen resistance in breast cancer.
LinkOut: [PMID: 26397135]
|
| MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
Transcription factor regulation Circular RNA sponge
Transcription factor regulation Circular RNA sponge
694 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT000280 | BMI1 | BMI1 proto-oncogene, polycomb ring finger |  |
|
|
|
|
5 | 3 | |||
| MIRT000282 | WNT3A | Wnt family member 3A | |
|
|
3 | 2 | |||||
| MIRT000283 | MYB | MYB proto-oncogene, transcription factor | |
|
|
|
|
5 | 3 | |||
| MIRT000284 | CDC25A | cell division cycle 25A | |
|
|
|
4 | 4 | ||||
| MIRT000285 | CCND2 | cyclin D2 | |
|
|
|
4 | 7 | ||||
| MIRT000804 | RAB9B | RAB9B, member RAS oncogene family | |
1 | 1 | |||||||
| MIRT000806 | ACTR1A | ARP1 actin related protein 1 homolog A | |
1 | 1 | |||||||
| MIRT000808 | TPI1 | triosephosphate isomerase 1 | |
1 | 1 | |||||||
| MIRT000810 | PDCD4 | programmed cell death 4 | |
|
|
3 | 2 | |||||
| MIRT000812 | RAB21 | RAB21, member RAS oncogene family | |
|
2 | 1 | ||||||
| MIRT000815 | BCL2 | BCL2, apoptosis regulator | |
|
|
|
|
|
6 | 13 | ||
| MIRT000817 | WT1 | Wilms tumor 1 | |
|
2 | 1 | ||||||
| MIRT000819 | ASXL2 | additional sex combs like 2, transcriptional regulator | |
|
2 | 1 | ||||||
| MIRT000823 | TMEM251 | transmembrane protein 251 | |
|
2 | 1 | ||||||
| MIRT000825 | CARD8 | caspase recruitment domain family member 8 | |
|
2 | 1 | ||||||
| MIRT000827 | CDC14B | cell division cycle 14B | |
|
2 | 1 | ||||||
| MIRT000829 | CENPJ | centromere protein J | |
|
2 | 1 | ||||||
| MIRT000831 | CEP63 | centrosomal protein 63 | |
|
2 | 1 | ||||||
| MIRT000833 | CREBL2 | cAMP responsive element binding protein like 2 | |
|
|
|
4 | 5 | ||||
| MIRT000835 | ECHDC1 | ethylmalonyl-CoA decarboxylase 1 | |
|
2 | 1 | ||||||
| MIRT000847 | GOLGA5 | golgin A5 | |
|
2 | 1 | ||||||
| MIRT000849 | GOLPH3L | golgi phosphoprotein 3 like | |
|
2 | 1 | ||||||
| MIRT000851 | GTF2H1 | general transcription factor IIH subunit 1 | |
|
2 | 1 | ||||||
| MIRT000853 | H3F3B | H3 histone family member 3B | |
|
2 | 1 | ||||||
| MIRT000855 | HACE1 | HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 | |
|
2 | 1 | ||||||
| MIRT000857 | HDHD2 | haloacid dehalogenase like hydrolase domain containing 2 | |
|
2 | 1 | ||||||
| MIRT000859 | HERC6 | HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 | |
|
2 | 1 | ||||||
| MIRT000863 | HRSP12 | reactive intermediate imine deaminase A homolog | |
|
2 | 1 | ||||||
| MIRT000865 | HSDL2 | hydroxysteroid dehydrogenase like 2 | |
|
2 | 1 | ||||||
| MIRT000866 | HSPA1A | heat shock protein family A (Hsp70) member 1A | |
|
2 | 1 | ||||||
| MIRT000868 | JUN | Jun proto-oncogene, AP-1 transcription factor subunit | |
|
2 | 1 | ||||||
| MIRT000878 | MCL1 | MCL1, BCL2 family apoptosis regulator | |
|
2 | 1 | ||||||
| MIRT000880 | MSH2 | mutS homolog 2 | |
|
2 | 1 | ||||||
| MIRT000884 | OMA1 | OMA1 zinc metallopeptidase | |
|
2 | 1 | ||||||
| MIRT000886 | OSGEPL1 | O-sialoglycoprotein endopeptidase like 1 | |
|
2 | 1 | ||||||
| MIRT000888 | PDCD6IP | programmed cell death 6 interacting protein | |
|
2 | 1 | ||||||
| MIRT000890 | PHKB | phosphorylase kinase regulatory subunit beta | |
|
2 | 1 | ||||||
| MIRT000892 | PMS1 | PMS1 homolog 1, mismatch repair system component | |
|
2 | 1 | ||||||
| MIRT000894 | PNN | pinin, desmosome associated protein | |
|
2 | 1 | ||||||
| MIRT000896 | PRIM1 | DNA primase subunit 1 | |
|
2 | 1 | ||||||
| MIRT000898 | RAD51C | RAD51 paralog C | |
|
2 | 1 | ||||||
| MIRT000900 | RHOT1 | ras homolog family member T1 | |
|
2 | 1 | ||||||
| MIRT000902 | RNASEL | ribonuclease L | |
|
2 | 1 | ||||||
| MIRT000906 | SLC35A1 | solute carrier family 35 member A1 | |
|
2 | 1 | ||||||
| MIRT000908 | SLC35B3 | solute carrier family 35 member B3 | |
|
2 | 1 | ||||||
| MIRT000910 | TIA1 | TIA1 cytotoxic granule associated RNA binding protein | |
|
2 | 1 | ||||||
| MIRT000914 | UGDH | UDP-glucose 6-dehydrogenase | |
|
2 | 1 | ||||||
| MIRT000916 | UGP2 | UDP-glucose pyrophosphorylase 2 | |
|
2 | 1 | ||||||
| MIRT000922 | ZNF559 | zinc finger protein 559 | |
|
2 | 1 | ||||||
| MIRT001227 | CCND1 | cyclin D1 | |
|
|
|
|
|
6 | 8 | ||
| MIRT001228 | CCNE1 | cyclin E1 | |
|
|
|
|
|
|
7 | 10 | |
| MIRT001802 | BACE1 | beta-secretase 1 | |
|
2 | 1 | ||||||
| MIRT002946 | DMTF1 | cyclin D binding myb like transcription factor 1 | |
|
|
|
4 | 4 | ||||
| MIRT003330 | RPS6 | ribosomal protein S6 | 0 | 1 | ||||||||
| MIRT003333 | BRCA1 | BRCA1, DNA repair associated | |
|
2 | 2 | ||||||
| MIRT003334 | AKT3 | AKT serine/threonine kinase 3 | |
|
|
3 | 6 | |||||
| MIRT003872 | WIPF1 | WAS/WASL interacting protein family member 1 | |
|
2 | 1 | ||||||
| MIRT003873 | VPS45 | vacuolar protein sorting 45 homolog | |
|
2 | 1 | ||||||
| MIRT003874 | HSP90B1 | heat shock protein 90 beta family member 1 | |
|
2 | 1 | ||||||
| MIRT003875 | SKAP2 | src kinase associated phosphoprotein 2 | |
|
|
3 | 1 | |||||
| MIRT003876 | NT5DC1 | 5'-nucleotidase domain containing 1 | |
|
2 | 1 | ||||||
| MIRT003877 | FAM69A | family with sequence similarity 69 member A | |
|
2 | 1 | ||||||
| MIRT003878 | C2orf74 | chromosome 2 open reading frame 74 | |
1 | 1 | |||||||
| MIRT003879 | FAM122C | family with sequence similarity 122C | |
|
2 | 1 | ||||||
| MIRT003880 | PWWP2A | PWWP domain containing 2A | |
|
2 | 1 | ||||||
| MIRT003881 | C17orf80 | chromosome 17 open reading frame 80 | |
|
2 | 1 | ||||||
| MIRT003882 | CCDC111 | primase and DNA directed polymerase | |
|
2 | 1 | ||||||
| MIRT003883 | C2orf43 | lipid droplet associated hydrolase | |
|
2 | 1 | ||||||
| MIRT003884 | C4orf27 | histone PARylation factor 1 | |
|
2 | 1 | ||||||
| MIRT003885 | NIPAL2 | NIPA like domain containing 2 | |
|
2 | 1 | ||||||
| MIRT003886 | TRMT13 | tRNA methyltransferase 13 homolog | |
|
2 | 1 | ||||||
| MIRT003887 | ANAPC16 | anaphase promoting complex subunit 16 | |
|
2 | 1 | ||||||
| MIRT003888 | CADM1 | cell adhesion molecule 1 | |
|
|
3 | 1 | |||||
| MIRT003891 | TMEM184B | transmembrane protein 184B | |
|
2 | 1 | ||||||
| MIRT003899 | APP | amyloid beta precursor protein | |
|
|
|
4 | 3 | ||||
| MIRT004046 | UCP2 | uncoupling protein 2 | |
|
|
3 | 1 | |||||
| MIRT004275 | VEGFA | vascular endothelial growth factor A | |
|
|
|
|
|
|
7 | 17 | |
| MIRT004680 | TSPYL2 | TSPY like 2 | |
|
2 | 1 | ||||||
| MIRT004829 | NFKB1 | nuclear factor kappa B subunit 1 | |
|
|
3 | 1 | |||||
| MIRT005552 | CHUK | conserved helix-loop-helix ubiquitous kinase | |
|
|
|
4 | 1 | ||||
| MIRT005763 | TP53 | tumor protein p53 | |
1 | 1 | |||||||
| MIRT006027 | FGF7 | fibroblast growth factor 7 | |
|
2 | 1 | ||||||
| MIRT006176 | CLCN3 | chloride voltage-gated channel 3 | |
|
|
|
4 | 1 | ||||
| MIRT006177 | CRKL | CRK like proto-oncogene, adaptor protein | |
|
|
|
|
|
6 | 3 | ||
| MIRT006181 | MN1 | MN1 proto-oncogene, transcriptional regulator | |
|
|
|
4 | 1 | ||||
| MIRT006658 | Ccnd1 | cyclin D1 | |
|
2 | 2 | ||||||
| MIRT006801 | HMGA1 | high mobility group AT-hook 1 | |
|
|
|
4 | 2 | ||||
| MIRT006805 | HMGA2 | high mobility group AT-hook 2 | |
|
|
3 | 1 | |||||
| MIRT006913 | IFNG | interferon gamma | |
|
2 | 1 | ||||||
| MIRT006998 | PURA | purine rich element binding protein A | |
|
2 | 2 | ||||||
| MIRT007090 | RECK | reversion inducing cysteine rich protein with kazal motifs | |
|
|
|
4 | 3 | ||||
| MIRT032077 | DLK1 | delta like non-canonical Notch ligand 1 | |
|
2 | 1 | ||||||
| MIRT051311 | PLA2G2D | phospholipase A2 group IID | |
1 | 1 | |||||||
| MIRT051312 | ACVR1B | activin A receptor type 1B | |
1 | 1 | |||||||
| MIRT051313 | IKBKG | inhibitor of nuclear factor kappa B kinase subunit gamma | |
1 | 1 | |||||||
| MIRT051314 | GCLM | glutamate-cysteine ligase modifier subunit | |
1 | 1 | |||||||
| MIRT051315 | PCF11 | PCF11 cleavage and polyadenylation factor subunit | |
1 | 1 | |||||||
| MIRT051316 | HIST1H2BK | histone cluster 1 H2B family member k | |
1 | 1 | |||||||
| MIRT051317 | ODC1 | ornithine decarboxylase 1 | |
1 | 1 | |||||||
| MIRT051318 | CALD1 | caldesmon 1 | |
1 | 1 | |||||||
| MIRT051319 | RPP30 | ribonuclease P/MRP subunit p30 | |
1 | 1 | |||||||
| MIRT051320 | ASNSD1 | asparagine synthetase domain containing 1 | |
1 | 1 | |||||||
| MIRT051321 | CCNYL1 | cyclin Y like 1 | |
1 | 1 | |||||||
| MIRT051322 | RGPD5 | RANBP2-like and GRIP domain containing 5 | |
1 | 1 | |||||||
| MIRT051323 | PREB | prolactin regulatory element binding | |
1 | 1 | |||||||
| MIRT051324 | PDHX | pyruvate dehydrogenase complex component X | |
1 | 1 | |||||||
| MIRT051325 | SNX6 | sorting nexin 6 | |
1 | 1 | |||||||
| MIRT051326 | CNN3 | calponin 3 | |
1 | 1 | |||||||
| MIRT051327 | KIF1A | kinesin family member 1A | |
1 | 1 | |||||||
| MIRT051328 | NAB1 | NGFI-A binding protein 1 | |
1 | 1 | |||||||
| MIRT051329 | CCT6B | chaperonin containing TCP1 subunit 6B | |
1 | 1 | |||||||
| MIRT051330 | CHD4 | chromodomain helicase DNA binding protein 4 | |
1 | 1 | |||||||
| MIRT051331 | CLCC1 | chloride channel CLIC like 1 | |
1 | 1 | |||||||
| MIRT051332 | GDI2 | GDP dissociation inhibitor 2 | |
1 | 1 | |||||||
| MIRT051333 | BRWD1 | bromodomain and WD repeat domain containing 1 | |
1 | 1 | |||||||
| MIRT051334 | MAPK6 | mitogen-activated protein kinase 6 | |
1 | 1 | |||||||
| MIRT051335 | PSMC4 | proteasome 26S subunit, ATPase 4 | |
1 | 1 | |||||||
| MIRT051336 | ATF2 | activating transcription factor 2 | |
1 | 1 | |||||||
| MIRT051337 | ATP6AP1 | ATPase H+ transporting accessory protein 1 | |
1 | 1 | |||||||
| MIRT051338 | FBXO3 | F-box protein 3 | |
1 | 1 | |||||||
| MIRT051339 | PRDX3 | peroxiredoxin 3 | |
1 | 1 | |||||||
| MIRT051340 | CABIN1 | calcineurin binding protein 1 | |
1 | 1 | |||||||
| MIRT051341 | FASN | fatty acid synthase | |
|
2 | 5 | ||||||
| MIRT051342 | SEC63 | SEC63 homolog, protein translocation regulator | |
1 | 1 | |||||||
| MIRT051343 | PTAR1 | protein prenyltransferase alpha subunit repeat containing 1 | |
1 | 1 | |||||||
| MIRT051344 | DSTYK | dual serine/threonine and tyrosine protein kinase | |
1 | 1 | |||||||
| MIRT051345 | FOXO1 | forkhead box O1 | |
|
|
|
4 | 2 | ||||
| MIRT051346 | TMEM214 | transmembrane protein 214 | |
1 | 1 | |||||||
| MIRT051347 | TRIM28 | tripartite motif containing 28 | |
1 | 1 | |||||||
| MIRT051348 | NOP2 | NOP2 nucleolar protein | |
1 | 1 | |||||||
| MIRT051349 | MYBL1 | MYB proto-oncogene like 1 | |
1 | 1 | |||||||
| MIRT051350 | TTC1 | tetratricopeptide repeat domain 1 | |
1 | 1 | |||||||
| MIRT051351 | BTRC | beta-transducin repeat containing E3 ubiquitin protein ligase | |
1 | 2 | |||||||
| MIRT052930 | REPIN1 | replication initiator 1 | |
|
2 | 1 | ||||||
| MIRT053079 | KLF4 | Kruppel like factor 4 | |
|
2 | 1 | ||||||
| MIRT054283 | YAP1 | Yes associated protein 1 | |
|
|
3 | 1 | |||||
| MIRT054424 | CARM1 | coactivator associated arginine methyltransferase 1 | |
|
|
3 | 1 | |||||
| MIRT054895 | SOX5 | SRY-box 5 | |
|
2 | 1 | ||||||
| MIRT055421 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | |
|
2 | 11 | ||||||