miRTarBase - #MIRT000815 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BCL2   
Synonyms Bcl-2, PPP1R50
Description BCL2, apoptosis regulator
Transcript NM_000633   
Other Transcripts NM_000657   
Expression
Putative miRNA Targets on BCL2
3'UTR of BCL2
(miRNA target sites are highlighted)		 
>BCL2|NM_000633|3'UTR
   1 AGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGTACC
  81 ATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACACAC
 161 AACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATTATT
 241 AAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAGCAC
 321 CGCTTCGTGTGGCTCCACCTGGATGTTCTGTGCCTGTAAACATAGATTCGCTTTCCATGTTGTTGGCCGGATCACCATCT
 401 GAAGAGCAGACGGATGGAAAAAGGACCTGATCATTGGGGAAGCTGGCTTTCTGGCTGCTGGAGGCTGGGGAGAAGGTGTT
 481 CATTCACTTGCATTTCTTTGCCCTGGGGGCTGTGATATTAACAGAGGGAGGGTTCCTGTGGGGGGAAGTCCATGCCTCCC
 561 TGGCCTGAAGAAGAGACTCTTTGCATATGACTCACATGATGCATACCTGGTGGGAGGAAAAGAGTTGGGAACTTCAGATG
 641 GACCTAGTACCCACTGAGATTTCCACGCCGAAGGACAGCGATGGGAAAAATGCCCTTAAATCATAGGAAAGTATTTTTTT
 721 AAGCTACCAATTGTGCCGAGAAAAGCATTTTAGCAATTTATACAATATCATCCAGTACCTTAAGCCCTGATTGTGTATAT
 801 TCATATATTTTGGATACGCACCCCCCAACTCCCAATACTGGCTCTGTCTGAGTAAGAAACAGAATCCTCTGGAACTTGAG
 881 GAAGTGAACATTTCGGTGACTTCCGCATCAGGAAGGCTAGAGTTACCCAGAGCATCAGGCCGCCACAAGTGCCTGCTTTT
 961 AGGAGACCGAAGTCCGCAGAACCTGCCTGTGTCCCAGCTTGGAGGCCTGGTCCTGGAACTGAGCCGGGGCCCTCACTGGC
1041 CTCCTCCAGGGATGATCAACAGGGCAGTGTGGTCTCCGAATGTCTGGAAGCTGATGGAGCTCAGAATTCCACTGTCAAGA
1121 AAGAGCAGTAGAGGGGTGTGGCTGGGCCTGTCACCCTGGGGCCCTCCAGGTAGGCCCGTTTTCACGTGGAGCATGGGAGC
1201 CACGACCCTTCTTAAGACATGTATCACTGTAGAGGGAAGGAACAGAGGCCCTGGGCCCTTCCTATCAGAAGGACATGGTG
1281 AAGGCTGGGAACGTGAGGAGAGGCAATGGCCACGGCCCATTTTGGCTGTAGCACATGGCACGTTGGCTGTGTGGCCTTGG
1361 CCCACCTGTGAGTTTAAAGCAAGGCTTTAAATGACTTTGGAGAGGGTCACAAATCCTAAAAGAAGCATTGAAGTGAGGTG
1441 TCATGGATTAATTGACCCCTGTCTATGGAATTACATGTAAAACATTATCTTGTCACTGTAGTTTGGTTTTATTTGAAAAC
1521 CTGACAAAAAAAAAGTTCCAGGTGTGGAATATGGGGGTTATCTGTACATCCTGGGGCATTAAAAAAAAAATCAATGGTGG
1601 GGAACTATAAAGAAGTAACAAAAGAAGTGACATCTTCAGCAAATAAACTAGGAAATTTTTTTTTCTTCCAGTTTAGAATC
1681 AGCCTTGAAACATTGATGGAATAACTCTGTGGCATTATTGCATTATATACCATTTATCTGTATTAACTTTGGAATGTACT
1761 CTGTTCAATGTTTAATGCTGTGGTTGATATTTCGAAAGCTGCTTTAAAAAAATACATGCATCTCAGCGTTTTTTTGTTTT
1841 TAATTGTATTTAGTTATGGCCTATACACTATTTGTGAGCAAAGGTGATCGTTTTCTGTTTGAGATTTTTATCTCTTGATT
1921 CTTCAAAAGCATTCTGAGAAGGTGAGATAAGCCCTGAGTCTCAGCTACCTAAGAAAAACCTGGATGTCACTGGCCACTGA
2001 GGAGCTTTGTTTCAACCAAGTCATGTGCATTTCCACGTCAACAGAATTGTTTATTGTGACAGTTATATCTGTTGTCCCTT
2081 TGACCTTGTTTCTTGAAGGTTTCCTCGTCCCTGGGCAATTCCGCATTTAATTCATGGTATTCAGGATTACATGCATGTTT
2161 GGTTAAACCCATGAGATTCATTCAGTTAAAAATCCAGATGGCAAATGACCAGCAGATTCAAATCTATGGTGGTTTGACCT
2241 TTAGAGAGTTGCTTTACGTGGCCTGTTTCAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTTCTC
2321 ATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGAAAGCAGGAAACCTGTGGTATGAAGC
2401 CAGACCTCCCCGGCGGGCCTCAGGGAACAGAATGATCAGACCTTTGAATGATTCTAATTTTTAAGCAAAATATTATTTTA
2481 TGAAAGGTTTACATTGTCAAAGTGATGAATATGGAATATCCAATCCTGTGCTGCTATCCTGCCAAAATCATTTTAATGGA
2561 GTCAGTTTGCAGTATGCTCCACGTGGTAAGATCCTCCAAGCTGCTTTAGAAGTAACAATGAAGAACGTGGACGTTTTTAA
2641 TATAAAGCCTGTTTTGTCTTTTGTTGTTGTTCAAACGGGATTCACAGAGTATTTGAAAAATGTATATATATTAAGAGGTC
2721 ACGGGGGCTAATTGCTGGCTGGCTGCCTTTTGCTGTGGGGTTTTGTTACCTGGTTTTAATAACAGTAAATGTGCCCAGCC
2801 TCTTGGCCCCAGAACTGTACAGTATTGTGGCTGCACTTGCTCTAAGAGTAGTTGATGTTGCATTTTCCTTATTGTTAAAA
2881 ACATGTTAGAAGCAATGAATGTATATAAAAGCCTCAACTAGTCATTTTTTTCTCCTCTTCTTTTTTTTCATTATATCTAA
2961 TTATTTTGCAGTTGGGCAACAGAGAACCATCCCTATTTTGTATTGAAGAGGGATTCACATCTGCATCTTAACTGCTCTTT
3041 ATGAATGAAAAAACAGTCCTCTGTATGTACTCCTCTTTACACTGGCCAGGGTCAGAGTTAAATAGAGTATATGCACTTTC
3121 CAAATTGGGGACAAGGGCTCTAAAAAAAGCCCCAAAAGGAGAAGAACATCTGAGAACCTCCTCGGCCCTCCCAGTCCCTC
3201 GCTGCACAAATACTCCGCAAGAGAGGCCAGAATGACAGCTGACAGGGTCTATGGCCATCGGGTCGTCTCCGAAGATTTGG
3281 CAGGGGCAGAAAACTCTGGCAGGCTTAAGATTTGGAATAAAGTCACAGAATTAAGGAAGCACCTCAATTTAGTTCAAACA
3361 AGACGCCAACATTCTCTCCACAGCTCACTTACCTCTCTGTGTTCAGATGTGGCCTTCCATTTATATGTGATCTTTGTTTT
3441 ATTAGTAAATGCTTATCATCTAAAGATGTAGCTCTGGCCCAGTGGGAAAAATTAGGAAGTGATTATAAATCGAGAGGAGT
3521 TATAATAATCAAGATTAAATGTAAATAATCAGGGCAATCCCAACACATGTCTAGCTTTCACCTCCAGGATCTATTGAGTG
3601 AACAGAATTGCAAATAGTCTCTATTTGTAATTGAACTTATCCTAAAACAAATAGTTTATAAATGTGAACTTAAACTCTAA
3681 TTAATTCCAACTGTACTTTTAAGGCAGTGGCTGTTTTTAGACTTTCTTATCACTTATAGTTAGTAATGTACACCTACTCT
3761 ATCAGAGAAAAACAGGAAAGGCTCGAAATACAAGCCATTCTAAGGAAATTAGGGAGTCAGTTGAAATTCTATTCTGATCT
3841 TATTCTGTGGTGTCTTTTGCAGCCCAGACAAATGTGGTTACACACTTTTTAAGAAATACAATTCTACATTGTCAAGCTTA
3921 TGAAGGTTCCAATCAGATCTTTATTGTTATTCAATTTGGATCTTTCAGGGATTTTTTTTTTAAATTATTATGGGACAAAG
4001 GACATTTGTTGGAGGGGTGGGAGGGAGGAAGAATTTTTAAATGTAAAACATTCCCAAGTTTGGATCAGGGAGTTGGAAGT
4081 TTTCAGAATAACCAGAACTAAGGGTATGAAGGACCTGTATTGGGGTCGATGTGATGCCTCTGCGAAGAACCTTGTGTGAC
4161 AAATGAGAAACATTTTGAAGTTTGTGGTACGACCTTTAGATTCCAGAGACATCAGCATGGCTCAAAGTGCAGCTCCGTTT
4241 GGCAGTGCAATGGTATAAATTTCAAGCTGGATATGTCTAATGGGTATTTAAACAATAAATGTGCAGTTTTAACTAACAGG
4321 ATATTTAATGACAACCTTCTGGTTGGTAGGGACATCTGTTTCTAAATGTTTATTATGTACAATACAGAAAAAAATTTTAT
4401 AAAATTAAGCAATGTGAAACTGAATTGGAGAGTGATAATACAAGTCCTTTAGTCTTACCCAGTGAATCATTCTGTTCCAT
4481 GTCTTTGGACAACCATGACCTTGGACAATCATGAAATATGCATCTCACTGGATGCAAAGAAAATCAGATGGAGCATGAAT
4561 GGTACTGTACCGGTTCATCTGGACTGCCCCAGAAAAATAACTTCAAGCAAACATCCTATCAACAACAAGGTTGTTCTGCA
4641 TACCAAGCTGAGCACAGAAGATGGGAACACTGGTGGAGGATGGAAAGGCTCGCTCAATCAAGAAAATTCTGAGACTATTA
4721 ATAAATAAGACTGTAGTGTAGATACTGAGTAAATCCATGCACCTAAACCTTTTGGAAAATCTGCCGTGGGCCCTCCAGAT
4801 AGCTCATTTCATTAAGTTTTTCCCTCCAAGGTAGAATTTGCAAGAGTGACAGTGGATTGCATTTCTTTTGGGGAAGCTTT
4881 CTTTTGGTGGTTTTGTTTATTATACCTTCTTAAGTTTTCAACCAAGGTTTGCTTTTGTTTTGAGTTACTGGGGTTATTTT
4961 TGTTTTAAATAAAAATAAGTGTACAATAAGTGTTTTTGTATTGAAAGCTTTTGTTATCAAGATTTTCATACTTTTACCTT
5041 CCATGGCTCTTTTTAAGATTGATACTTTTAAGAGGTGGCTGATATTCTGCAACACTGTACACATAAAAAATACGGTAAGG
5121 ATACTTTACATGGTTAAGGTAAAGTAAGTCTCCAGTTGGCCACCATTAGCTATAATGGCACTTTGTTTGTGTTGTTGGAA
5201 AAAGTCACATTGCCATTAAACTTTCCTTGTCTGTCTAGTTAATATTGTGAAGAAAAATAAAGTACAGTGTGAGATACTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1 
miRNA  3' guguUUGG-UAAUACACGACGAu 5'
              | || ||  ||||||||| 
Target 5' gaatATCCAATCCTGTGCTGCTa 3'
 		2514 - 2536 158.00 -16.80
2 
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||  :::|| ||||:||:| 
Target 5' ggCACTTTGTT-TGTGTTGTTg 3'
 		5177 - 5197 127.00 -12.16
3 
miRNA  3' guGUUUGGUA-AUACACGACGAu 5'
            :|||| ||  |||||| |:| 
Target 5' ttTAAACAATAAATGTGCAGTTt 3'
 		4287 - 4309 124.00 -9.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30468262 5 COSMIC
COSN31506170 22 COSMIC
COSN20062508 37 COSMIC
COSN30110192 37 COSMIC
COSN26967765 68 COSMIC
COSN1208192 83 COSMIC
COSN30169174 107 COSMIC
COSN30118945 121 COSMIC
COSN25586063 146 COSMIC
COSN31582267 146 COSMIC
COSN31564764 150 COSMIC
COSN31576430 186 COSMIC
COSN31573534 189 COSMIC
COSN31529691 289 COSMIC
COSN26566486 318 COSMIC
COSN21727405 429 COSMIC
COSN25054833 517 COSMIC
COSN25247299 616 COSMIC
COSN31481313 698 COSMIC
COSN29105664 704 COSMIC
COSN25061581 708 COSMIC
COSN26599443 716 COSMIC
COSN25063186 747 COSMIC
COSN31597346 772 COSMIC
COSN21517763 850 COSMIC
COSN14945443 867 COSMIC
COSN25061580 1238 COSMIC
COSN25059924 1292 COSMIC
COSN5224758 1414 COSMIC
COSN25059923 1448 COSMIC
COSN4774797 1483 COSMIC
COSN20115123 1581 COSMIC
COSN27615904 1590 COSMIC
COSN25569814 1777 COSMIC
COSN31542579 1840 COSMIC
COSN7365459 1901 COSMIC
COSN7365458 1902 COSMIC
COSN26316468 1903 COSMIC
COSN23197766 1916 COSMIC
COSN28201051 2127 COSMIC
COSN8604701 2252 COSMIC
COSN31577151 2363 COSMIC
COSN24306375 2531 COSMIC
COSN32065687 2802 COSMIC
COSN20869441 3621 COSMIC
COSN28994081 3664 COSMIC
COSN30169653 3710 COSMIC
COSN17183333 3796 COSMIC
COSN26556630 3930 COSMIC
COSN31595446 3938 COSMIC
COSN20115120 3971 COSMIC
COSN17864841 3981 COSMIC
COSN31521641 3999 COSMIC
COSN7365457 4127 COSMIC
COSN26243341 4440 COSMIC
rs4987852 1937 GWAS
rs4987855 2309 GWAS
rs4987856 2364 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs373385925 2 dbSNP
rs1381670139 3 dbSNP
rs769872480 5 dbSNP
rs1448412683 9 dbSNP
rs1400329346 10 dbSNP
rs759865650 13 dbSNP
rs1400010646 16 dbSNP
rs375217502 17 dbSNP
rs1334530627 19 dbSNP
rs200716283 22 dbSNP
rs1163693631 26 dbSNP
rs1342113637 28 dbSNP
rs1472325609 30 dbSNP
rs1428201627 31 dbSNP
rs1383672400 36 dbSNP
rs1317915073 42 dbSNP
rs371826692 44 dbSNP
rs778714573 46 dbSNP
rs768697984 48 dbSNP
rs1260494273 64 dbSNP
rs1343461180 73 dbSNP
rs1038422952 82 dbSNP
rs948886783 87 dbSNP
rs1162516604 94 dbSNP
rs1191698677 95 dbSNP
rs1262785594 121 dbSNP
rs1478163125 130 dbSNP
rs1172885850 135 dbSNP
rs941460427 137 dbSNP
rs537472384 139 dbSNP
rs1465482177 140 dbSNP
rs1173148729 142 dbSNP
rs1417636805 142 dbSNP
rs916115604 142 dbSNP
rs1412986398 150 dbSNP
rs190262124 150 dbSNP
rs1340765227 154 dbSNP
rs1401511330 159 dbSNP
rs1298515242 160 dbSNP
rs140093696 162 dbSNP
rs934008233 162 dbSNP
rs1347531703 165 dbSNP
rs1214941169 166 dbSNP
rs1417427563 166 dbSNP
rs922517028 169 dbSNP
rs1196206761 170 dbSNP
rs558855674 186 dbSNP
rs538519659 187 dbSNP
rs989847612 189 dbSNP
rs560105440 190 dbSNP
rs1437536876 212 dbSNP
rs747788648 215 dbSNP
rs1360973022 218 dbSNP
rs955836194 221 dbSNP
rs1210984459 223 dbSNP
rs957144139 227 dbSNP
rs1291485561 237 dbSNP
rs924249444 238 dbSNP
rs1389311010 240 dbSNP
rs1302530105 242 dbSNP
rs568132412 242 dbSNP
rs1268400633 245 dbSNP
rs925799311 251 dbSNP
rs1237816146 253 dbSNP
rs779804119 254 dbSNP
rs1238663499 256 dbSNP
rs4987842 258 dbSNP
rs1308987296 264 dbSNP
rs754709154 267 dbSNP
rs1218999883 268 dbSNP
rs546351646 272 dbSNP
rs1263906851 278 dbSNP
rs955427970 284 dbSNP
rs1210532211 290 dbSNP
rs543205988 300 dbSNP
rs996798772 301 dbSNP
rs745804189 303 dbSNP
rs567047705 305 dbSNP
rs4987843 317 dbSNP
rs1441323361 321 dbSNP
rs1162217425 322 dbSNP
rs757162378 323 dbSNP
rs185016407 324 dbSNP
rs571116372 326 dbSNP
rs1397584496 327 dbSNP
rs1445199719 332 dbSNP
rs1331275570 335 dbSNP
rs1378025908 338 dbSNP
rs1225863207 346 dbSNP
rs1310785625 349 dbSNP
rs552053320 352 dbSNP
rs753911659 360 dbSNP
rs764118446 362 dbSNP
rs1048159219 363 dbSNP
rs116616724 365 dbSNP
rs907237583 369 dbSNP
rs1238714786 370 dbSNP
rs1458891129 373 dbSNP
rs1158262214 374 dbSNP
rs1255267320 382 dbSNP
rs1424027240 388 dbSNP
rs559912455 389 dbSNP
rs1420763378 400 dbSNP
rs1379515017 406 dbSNP
rs1176859932 407 dbSNP
rs367947421 411 dbSNP
rs1401690271 412 dbSNP
rs916063139 414 dbSNP
rs1378983308 421 dbSNP
rs1480674183 426 dbSNP
rs1191011447 428 dbSNP
rs1295358086 431 dbSNP
rs1038545651 433 dbSNP
rs753026404 434 dbSNP
rs1309156245 436 dbSNP
rs1247769006 462 dbSNP
rs935714218 463 dbSNP
rs924386271 464 dbSNP
rs1348086328 468 dbSNP
rs867634102 469 dbSNP
rs1257339309 473 dbSNP
rs934006358 475 dbSNP
rs1189540797 480 dbSNP
rs1260632688 481 dbSNP
rs1346473233 483 dbSNP
rs543279713 490 dbSNP
rs933662235 501 dbSNP
rs1301187702 502 dbSNP
rs1412126035 506 dbSNP
rs1174641066 507 dbSNP
rs922610351 509 dbSNP
rs1466875082 510 dbSNP
rs113379949 521 dbSNP
rs1317371893 522 dbSNP
rs563822390 526 dbSNP
rs1399675769 535 dbSNP
rs1364246933 537 dbSNP
rs925765186 537 dbSNP
rs41301945 540 dbSNP
rs970325827 541 dbSNP
rs1404633261 544 dbSNP
rs963973319 545 dbSNP
rs1216971881 546 dbSNP
rs774070039 546 dbSNP
rs1243329106 548 dbSNP
rs577979796 552 dbSNP
rs377403870 566 dbSNP
rs1016747099 571 dbSNP
rs983963948 573 dbSNP
rs759914693 580 dbSNP
rs1171091577 583 dbSNP
rs4987844 585 dbSNP
rs1419318151 587 dbSNP
rs1372932314 610 dbSNP
rs1299047392 626 dbSNP
rs191858049 628 dbSNP
rs1434441426 633 dbSNP
rs1274127109 638 dbSNP
rs1368186676 641 dbSNP
rs1236455638 646 dbSNP
rs1191505924 647 dbSNP
rs1026396358 648 dbSNP
rs1306799513 655 dbSNP
rs573086110 666 dbSNP
rs3744937 667 dbSNP
rs536087403 669 dbSNP
rs4987845 670 dbSNP
rs3744936 677 dbSNP
rs1220210116 678 dbSNP
rs4987846 680 dbSNP
rs768103380 681 dbSNP
rs1196121526 684 dbSNP
rs1049796772 686 dbSNP
rs1439478284 693 dbSNP
rs746655788 704 dbSNP
rs1410468282 705 dbSNP
rs775194968 706 dbSNP
rs1403863957 707 dbSNP
rs998233273 709 dbSNP
rs1350607472 712 dbSNP
rs1342773315 715 dbSNP
rs1329240811 721 dbSNP
rs1442991654 721 dbSNP
rs901153002 722 dbSNP
rs150966214 730 dbSNP
rs1280873036 733 dbSNP
rs903381935 736 dbSNP
rs1227457541 737 dbSNP
rs1053070557 738 dbSNP
rs1041451639 757 dbSNP
rs933758225 765 dbSNP
rs922240099 770 dbSNP
rs975087290 771 dbSNP
rs1016860 784 dbSNP
rs745609712 798 dbSNP
rs1043401956 805 dbSNP
rs538259407 807 dbSNP
rs984483687 817 dbSNP
rs528074102 818 dbSNP
rs1463080003 821 dbSNP
rs1399482491 822 dbSNP
rs1430424125 823 dbSNP
rs1447483322 827 dbSNP
rs1330637700 835 dbSNP
rs4987847 837 dbSNP
rs1446764628 856 dbSNP
rs1284433402 857 dbSNP
rs1356771256 866 dbSNP
rs992553616 889 dbSNP
rs972157916 894 dbSNP
rs141174596 895 dbSNP
rs777893248 904 dbSNP
rs116117134 905 dbSNP
rs894518266 908 dbSNP
rs1254854602 914 dbSNP
rs563834758 916 dbSNP
rs954205580 918 dbSNP
rs1423094395 919 dbSNP
rs1033214159 921 dbSNP
rs1028923351 926 dbSNP
rs543902439 927 dbSNP
rs903332576 933 dbSNP
rs1272238933 934 dbSNP
rs1356953343 938 dbSNP
rs756328207 941 dbSNP
rs4987848 942 dbSNP
rs781507624 948 dbSNP
rs901249588 949 dbSNP
rs1228719441 951 dbSNP
rs1272433438 955 dbSNP
rs998806018 968 dbSNP
rs900929793 969 dbSNP
rs1039348390 971 dbSNP
rs1486757247 973 dbSNP
rs1353781246 974 dbSNP
rs755273824 975 dbSNP
rs564586762 976 dbSNP
rs541093229 985 dbSNP
rs1195194499 989 dbSNP
rs1375881636 996 dbSNP
rs1477685332 1000 dbSNP
rs1048294855 1008 dbSNP
rs1174000690 1016 dbSNP
rs1377119214 1018 dbSNP
rs1327492874 1020 dbSNP
rs929908886 1021 dbSNP
rs918406227 1023 dbSNP
rs751914066 1025 dbSNP
rs572399575 1026 dbSNP
rs552888307 1027 dbSNP
rs971422811 1043 dbSNP
rs371590615 1044 dbSNP
rs1329831136 1050 dbSNP
rs1234250027 1052 dbSNP
rs917327474 1055 dbSNP
rs1164648585 1060 dbSNP
rs1460151971 1063 dbSNP
rs1415212870 1064 dbSNP
rs2078303 1065 dbSNP
rs991566230 1068 dbSNP
rs938517810 1078 dbSNP
rs918995956 1079 dbSNP
rs144527240 1089 dbSNP
rs1206950940 1092 dbSNP
rs1265409068 1093 dbSNP
rs1450961697 1096 dbSNP
rs573504228 1104 dbSNP
rs556708975 1109 dbSNP
rs1470215391 1117 dbSNP
rs537166590 1120 dbSNP
rs1033448739 1125 dbSNP
rs908879693 1131 dbSNP
rs1179626124 1135 dbSNP
rs984361187 1136 dbSNP
rs1389465911 1139 dbSNP
rs1440745170 1145 dbSNP
rs1000427967 1147 dbSNP
rs954461117 1150 dbSNP
rs968045934 1152 dbSNP
rs1453249538 1156 dbSNP
rs1020417058 1159 dbSNP
rs998762904 1161 dbSNP
rs1212843915 1162 dbSNP
rs1317713023 1165 dbSNP
rs1241531699 1167 dbSNP
rs766695698 1172 dbSNP
rs1270276886 1175 dbSNP
rs1214175348 1177 dbSNP
rs3744935 1178 dbSNP
rs1006674645 1185 dbSNP
rs4987849 1186 dbSNP
rs1420497195 1189 dbSNP
rs1439295069 1191 dbSNP
rs1022055213 1200 dbSNP
rs1397299147 1202 dbSNP
rs750951587 1203 dbSNP
rs1564483 1204 dbSNP
rs1325738644 1205 dbSNP
rs1439197636 1213 dbSNP
rs1391224105 1220 dbSNP
rs894365166 1221 dbSNP
rs1234002624 1222 dbSNP
rs1275175517 1223 dbSNP
rs1057099024 1226 dbSNP
rs1002698675 1228 dbSNP
rs1251657237 1230 dbSNP
rs1481496783 1230 dbSNP
rs1179712793 1235 dbSNP
rs929883375 1236 dbSNP
rs897665887 1245 dbSNP
rs1475361367 1248 dbSNP
rs565671491 1249 dbSNP
rs1478690639 1252 dbSNP
rs549709463 1256 dbSNP
rs1464509877 1257 dbSNP
rs949211497 1262 dbSNP
rs941789053 1275 dbSNP
rs908854227 1278 dbSNP
rs1301265805 1279 dbSNP
rs916442671 1282 dbSNP
rs1415663497 1283 dbSNP
rs1249630837 1290 dbSNP
rs145009492 1292 dbSNP
rs369042063 1293 dbSNP
rs760985165 1297 dbSNP
rs1296249367 1301 dbSNP
rs552258175 1305 dbSNP
rs977013372 1307 dbSNP
rs187455180 1313 dbSNP
rs1212650850 1314 dbSNP
rs979178137 1317 dbSNP
rs1186402603 1319 dbSNP
rs1477211353 1319 dbSNP
rs1221024271 1324 dbSNP
rs1430859065 1328 dbSNP
rs771669959 1335 dbSNP
rs1394921437 1339 dbSNP
rs4987850 1342 dbSNP
rs1315019748 1346 dbSNP
rs1358661550 1351 dbSNP
rs1430137185 1353 dbSNP
rs969223718 1354 dbSNP
rs149940394 1355 dbSNP
rs1217472932 1356 dbSNP
rs965524918 1362 dbSNP
rs1018478976 1366 dbSNP
rs1302400088 1367 dbSNP
rs1348342736 1372 dbSNP
rs139755068 1379 dbSNP
rs888207454 1389 dbSNP
rs1232710096 1399 dbSNP
rs1367840744 1407 dbSNP
rs1283476302 1418 dbSNP
rs1021734515 1430 dbSNP
rs1321638325 1431 dbSNP
rs1431083302 1433 dbSNP
rs1487132277 1437 dbSNP
rs1050618 1445 dbSNP
rs1344249725 1448 dbSNP
rs1013319984 1453 dbSNP
rs1394793885 1453 dbSNP
rs1048027091 1456 dbSNP
rs371452924 1457 dbSNP
rs1315743463 1460 dbSNP
rs150653783 1465 dbSNP
rs896850364 1467 dbSNP
rs1046728139 1468 dbSNP
rs1002800485 1473 dbSNP
rs1434139534 1474 dbSNP
rs897634659 1475 dbSNP
rs1036216146 1495 dbSNP
rs1371408072 1497 dbSNP
rs865892001 1500 dbSNP
rs1442859273 1510 dbSNP
rs774172635 1512 dbSNP
rs1186905446 1520 dbSNP
rs894956738 1520 dbSNP
rs1485385736 1524 dbSNP
rs1240609592 1525 dbSNP
rs1224055378 1526 dbSNP
rs770687321 1526 dbSNP
rs1050223210 1530 dbSNP
rs1212290564 1534 dbSNP
rs1252948803 1535 dbSNP
rs202112192 1535 dbSNP
rs931639923 1542 dbSNP
rs1231598958 1544 dbSNP
rs1469806680 1554 dbSNP
rs1178010799 1555 dbSNP
rs937391028 1561 dbSNP
rs561700123 1562 dbSNP
rs181495000 1571 dbSNP
rs1041246375 1572 dbSNP
rs978908272 1575 dbSNP
rs1395097929 1576 dbSNP
rs1462985978 1578 dbSNP
rs180847268 1581 dbSNP
rs113207678 1582 dbSNP
rs924756874 1586 dbSNP
rs1214353705 1587 dbSNP
rs1280930023 1589 dbSNP
rs977972491 1590 dbSNP
rs1273314841 1591 dbSNP
rs5825508 1591 dbSNP
rs968942627 1593 dbSNP
rs1360252924 1594 dbSNP
rs913261079 1596 dbSNP
rs1268101184 1597 dbSNP
rs976984678 1598 dbSNP
rs4987851 1599 dbSNP
rs991625952 1601 dbSNP
rs1375596151 1611 dbSNP
rs1476138895 1621 dbSNP
rs958661889 1639 dbSNP
rs1395419571 1640 dbSNP
rs1018426756 1644 dbSNP
rs1357041923 1648 dbSNP
rs1035706854 1655 dbSNP
rs530340306 1665 dbSNP
rs961937733 1665 dbSNP
rs1235613717 1667 dbSNP
rs543280509 1677 dbSNP
rs1339088820 1683 dbSNP
rs985637226 1692 dbSNP
rs777503643 1693 dbSNP
rs1372338401 1694 dbSNP
rs1006460836 1698 dbSNP
rs1486697162 1705 dbSNP
rs1190885794 1709 dbSNP
rs1171016202 1712 dbSNP
rs1372451595 1722 dbSNP
rs1027141178 1724 dbSNP
rs550786606 1725 dbSNP
rs1475724902 1732 dbSNP
rs993958621 1735 dbSNP
rs1169425769 1753 dbSNP
rs1427724498 1755 dbSNP
rs1433657346 1756 dbSNP
rs577765262 1763 dbSNP
rs1376703882 1767 dbSNP
rs1380052921 1782 dbSNP
rs1317079620 1787 dbSNP
rs1024613027 1793 dbSNP
rs995946764 1794 dbSNP
rs1272270111 1796 dbSNP
rs1346184531 1806 dbSNP
rs1233758061 1809 dbSNP
rs1281345736 1820 dbSNP
rs901486682 1824 dbSNP
rs1417097240 1827 dbSNP
rs769867822 1828 dbSNP
rs935020143 1829 dbSNP
rs1173824603 1836 dbSNP
rs1453612305 1836 dbSNP
rs369915593 1836 dbSNP
rs777364862 1836 dbSNP
rs1256972170 1842 dbSNP
rs1208834688 1843 dbSNP
rs557610580 1846 dbSNP
rs1252431078 1848 dbSNP
rs1385117259 1856 dbSNP
rs895072980 1871 dbSNP
rs1054845389 1889 dbSNP
rs534676168 1890 dbSNP
rs374062303 1898 dbSNP
rs781454557 1910 dbSNP
rs1237230366 1912 dbSNP
rs184698169 1929 dbSNP
rs4987852 1937 dbSNP
rs1292223040 1942 dbSNP
rs1351506135 1947 dbSNP
rs1206784325 1953 dbSNP
rs1271224263 1957 dbSNP
rs1468017806 1958 dbSNP
rs1193991596 1979 dbSNP
rs937427397 1983 dbSNP
rs946176729 1991 dbSNP
rs1180656974 1995 dbSNP
rs1363802714 2005 dbSNP
rs1454922808 2007 dbSNP
rs1161940054 2017 dbSNP
rs1374811943 2020 dbSNP
rs981428539 2023 dbSNP
rs1461441372 2025 dbSNP
rs913201633 2026 dbSNP
rs976764402 2029 dbSNP
rs181211289 2036 dbSNP
rs911482264 2037 dbSNP
rs985751659 2042 dbSNP
rs1230281769 2047 dbSNP
rs1291560779 2062 dbSNP
rs1214304682 2066 dbSNP
rs1274750129 2074 dbSNP
rs570388509 2076 dbSNP
rs1461390047 2078 dbSNP
rs1194835218 2079 dbSNP
rs1250824110 2084 dbSNP
rs1352611046 2088 dbSNP
rs1185117083 2090 dbSNP
rs984728222 2094 dbSNP
rs550443719 2098 dbSNP
rs142756703 2106 dbSNP
rs139528731 2107 dbSNP
rs1461717176 2114 dbSNP
rs996304650 2117 dbSNP
rs901580110 2122 dbSNP
rs961164836 2123 dbSNP
rs547576951 2128 dbSNP
rs1473642594 2131 dbSNP
rs1354913274 2134 dbSNP
rs1233749306 2143 dbSNP
rs1251300907 2147 dbSNP
rs1305502401 2152 dbSNP
rs1226389874 2155 dbSNP
rs1177200606 2157 dbSNP
rs1483825580 2161 dbSNP
rs188797102 2162 dbSNP
rs780455853 2168 dbSNP
rs1479937104 2170 dbSNP
rs1189211986 2171 dbSNP
rs760051790 2173 dbSNP
rs1013207043 2179 dbSNP
rs959070366 2187 dbSNP
rs373487515 2193 dbSNP
rs1170187201 2194 dbSNP
rs1374048106 2201 dbSNP
rs4987853 2203 dbSNP
rs879058561 2204 dbSNP
rs1231049638 2205 dbSNP
rs1374882370 2206 dbSNP
rs1318237579 2221 dbSNP
rs548212819 2226 dbSNP
rs4987854 2232 dbSNP
rs765680013 2233 dbSNP
rs1371110553 2238 dbSNP
rs1010709112 2257 dbSNP
rs1055949709 2258 dbSNP
rs891895565 2260 dbSNP
rs937522194 2262 dbSNP
rs762334439 2269 dbSNP
rs1211580633 2272 dbSNP
rs981565942 2278 dbSNP
rs944019784 2279 dbSNP
rs1485169504 2280 dbSNP
rs940634859 2283 dbSNP
rs1451749014 2285 dbSNP
rs911253095 2287 dbSNP
rs907879911 2288 dbSNP
rs1394679630 2290 dbSNP
rs1233706373 2291 dbSNP
rs1364518385 2301 dbSNP
rs1049983985 2306 dbSNP
rs952014149 2307 dbSNP
rs1417331565 2308 dbSNP
rs4987855 2309 dbSNP
rs767060901 2314 dbSNP
rs1302467487 2315 dbSNP
rs1371276983 2318 dbSNP
rs1220657889 2323 dbSNP
rs1281450331 2333 dbSNP
rs1315815325 2335 dbSNP
rs1194757395 2336 dbSNP
rs117640948 2337 dbSNP
rs1466677003 2338 dbSNP
rs965883596 2340 dbSNP
rs1252834386 2353 dbSNP
rs1478471109 2356 dbSNP
rs776245002 2363 dbSNP
rs4987856 2364 dbSNP
rs999232187 2367 dbSNP
rs917662902 2378 dbSNP
rs1377596979 2379 dbSNP
rs991903837 2395 dbSNP
rs146379399 2411 dbSNP
rs529635154 2412 dbSNP
rs1314569801 2413 dbSNP
rs4987857 2414 dbSNP
rs1011013237 2415 dbSNP
rs1371920246 2416 dbSNP
rs1223830942 2422 dbSNP
rs142265965 2441 dbSNP
rs773083543 2442 dbSNP
rs1212430028 2448 dbSNP
rs1056484402 2450 dbSNP
rs1385956015 2468 dbSNP
rs769814545 2473 dbSNP
rs1452581897 2480 dbSNP
rs1009407487 2491 dbSNP
rs1001702552 2497 dbSNP
rs1231374881 2500 dbSNP
rs748138761 2502 dbSNP
rs907374508 2519 dbSNP
rs1182987722 2523 dbSNP
rs148341476 2528 dbSNP
rs1474153783 2529 dbSNP
rs1451752787 2533 dbSNP
rs1041145535 2537 dbSNP
rs1396947640 2538 dbSNP
rs1406897490 2555 dbSNP
rs1008337966 2562 dbSNP
rs1353527703 2563 dbSNP
rs907841841 2570 dbSNP
rs1309301346 2582 dbSNP
rs1049038131 2583 dbSNP
rs1231955592 2595 dbSNP
rs1393715660 2619 dbSNP
rs1195795142 2623 dbSNP
rs17070680 2627 dbSNP
rs1262031325 2632 dbSNP
rs1049764241 2633 dbSNP
rs1206160617 2634 dbSNP
rs1484634589 2638 dbSNP
rs1281838764 2648 dbSNP
rs1484747713 2649 dbSNP
rs1368960431 2661 dbSNP
rs563706706 2661 dbSNP
rs768917760 2667 dbSNP
rs1165933679 2672 dbSNP
rs911733706 2672 dbSNP
rs1037728552 2676 dbSNP
rs1170126980 2697 dbSNP
rs1347080589 2708 dbSNP
rs747252845 2710 dbSNP
rs1341591588 2719 dbSNP
rs780076934 2720 dbSNP
rs544015519 2722 dbSNP
rs1268732355 2723 dbSNP
rs1339148840 2743 dbSNP
rs1022493032 2745 dbSNP
rs1010563985 2746 dbSNP
rs1326761145 2747 dbSNP
rs959339487 2756 dbSNP
rs1034563245 2759 dbSNP
rs1444051229 2760 dbSNP
rs1380710704 2777 dbSNP
rs1001795760 2783 dbSNP
rs1449873745 2799 dbSNP
rs1313543295 2808 dbSNP
rs991851646 2809 dbSNP
rs1392846933 2810 dbSNP
rs1433788915 2811 dbSNP
rs907343124 2813 dbSNP
rs746174746 2816 dbSNP
rs1434118198 2819 dbSNP
rs375734256 2820 dbSNP
rs926263254 2830 dbSNP
rs1316885792 2840 dbSNP
rs374357488 2842 dbSNP
rs1436245296 2847 dbSNP
rs979129363 2855 dbSNP
rs1369044208 2856 dbSNP
rs183691931 2884 dbSNP
rs1020870225 2892 dbSNP
rs1372842884 2897 dbSNP
rs1203260490 2900 dbSNP
rs988500550 2905 dbSNP
rs965848467 2906 dbSNP
rs1049644035 2911 dbSNP
rs1190270096 2918 dbSNP
rs1250974022 2921 dbSNP
rs930658489 2923 dbSNP
rs1476628389 2928 dbSNP
rs570978368 2934 dbSNP
rs1468173696 2936 dbSNP
rs1038891909 2943 dbSNP
rs555342230 2943 dbSNP
rs1188053672 2949 dbSNP
rs1458287471 2949 dbSNP
rs1485037433 2950 dbSNP
rs1008285645 2953 dbSNP
rs1197466022 2955 dbSNP
rs1333096902 2971 dbSNP
rs1236935552 2972 dbSNP
rs889880659 2978 dbSNP
rs1028702174 2999 dbSNP
rs995516999 3009 dbSNP
rs1210531637 3014 dbSNP
rs911833759 3018 dbSNP
rs1467896566 3021 dbSNP
rs1210016956 3024 dbSNP
rs977882798 3025 dbSNP
rs1435757515 3029 dbSNP
rs780393617 3034 dbSNP
rs898523335 3035 dbSNP
rs1037273359 3036 dbSNP
rs940301317 3037 dbSNP
rs1416090593 3044 dbSNP
rs1457700964 3046 dbSNP
rs757735599 3050 dbSNP
rs1307437690 3054 dbSNP
rs1393144136 3054 dbSNP
rs989639852 3054 dbSNP
rs1351192280 3055 dbSNP
rs1056572165 3063 dbSNP
rs4987858 3064 dbSNP
rs926397543 3081 dbSNP
rs867556603 3082 dbSNP
rs1245202880 3086 dbSNP
rs1410987140 3088 dbSNP
rs1479445100 3091 dbSNP
rs1194884926 3092 dbSNP
rs979633404 3102 dbSNP
rs534110924 3108 dbSNP
rs1483767640 3111 dbSNP
rs778690174 3125 dbSNP
rs1255987534 3126 dbSNP
rs1423812720 3131 dbSNP
rs980328130 3132 dbSNP
rs971619010 3142 dbSNP
rs1419617890 3143 dbSNP
rs1371192807 3144 dbSNP
rs1024590468 3149 dbSNP
rs1005041509 3155 dbSNP
rs1378337365 3159 dbSNP
rs1396593165 3167 dbSNP
rs1314537355 3169 dbSNP
rs1305556776 3170 dbSNP
rs886644402 3171 dbSNP
rs1274937466 3177 dbSNP
rs137980414 3180 dbSNP
rs41306972 3183 dbSNP
rs965963147 3184 dbSNP
rs1018753576 3189 dbSNP
rs1258660086 3191 dbSNP
rs1183982664 3192 dbSNP
rs377487726 3198 dbSNP
rs1188387529 3200 dbSNP
rs4987859 3201 dbSNP
rs1249658505 3208 dbSNP
rs1196529933 3215 dbSNP
rs953231301 3216 dbSNP
rs1028398967 3217 dbSNP
rs1358664365 3218 dbSNP
rs1466423966 3225 dbSNP
rs1304544697 3237 dbSNP
rs569192313 3238 dbSNP
rs1332819646 3244 dbSNP
rs1281339930 3247 dbSNP
rs549811647 3250 dbSNP
rs1042325506 3251 dbSNP
rs533229451 3256 dbSNP
rs1327393664 3260 dbSNP
rs1443601843 3265 dbSNP
rs1395647504 3270 dbSNP
rs4987860 3271 dbSNP
rs915069325 3281 dbSNP
rs1451494276 3285 dbSNP
rs544557307 3286 dbSNP
rs4987861 3294 dbSNP
rs1424496926 3298 dbSNP
rs1411064718 3299 dbSNP
rs1016029514 3301 dbSNP
rs1275150492 3303 dbSNP
rs188618198 3306 dbSNP
rs1343361937 3309 dbSNP
rs896751010 3311 dbSNP
rs762697811 3312 dbSNP
rs1320913206 3325 dbSNP
rs1390571114 3328 dbSNP
rs1438212826 3338 dbSNP
rs1273904135 3342 dbSNP
rs1367930277 3343 dbSNP
rs1220427559 3346 dbSNP
rs1304311548 3347 dbSNP
rs773113174 3359 dbSNP
rs1363185850 3363 dbSNP
rs552589178 3364 dbSNP
rs1219586509 3365 dbSNP
rs1246321442 3373 dbSNP
rs146967889 3381 dbSNP
rs1192978540 3383 dbSNP
rs1409867906 3388 dbSNP
rs1472186838 3393 dbSNP
rs1253362020 3397 dbSNP
rs981757679 3406 dbSNP
rs1413843015 3408 dbSNP
rs1459660216 3412 dbSNP
rs1213375034 3422 dbSNP
rs1350108839 3423 dbSNP
rs867886043 3425 dbSNP
rs905394870 3426 dbSNP
rs541905026 3431 dbSNP
rs1024557927 3437 dbSNP
rs984110675 3445 dbSNP
rs950878696 3449 dbSNP
rs1043472752 3455 dbSNP
rs1226934291 3458 dbSNP
rs1286523423 3460 dbSNP
rs1289687384 3464 dbSNP
rs575950034 3465 dbSNP
rs1224055108 3469 dbSNP
rs1249663965 3469 dbSNP
rs1482784463 3472 dbSNP
rs556095664 3473 dbSNP
rs1224437346 3481 dbSNP
rs546195385 3485 dbSNP
rs913537459 3489 dbSNP
rs900582433 3492 dbSNP
rs141080340 3511 dbSNP
rs147777348 3512 dbSNP
rs1237108514 3520 dbSNP
rs1008852402 3525 dbSNP
rs756346453 3526 dbSNP
rs1166364992 3543 dbSNP
rs1369351947 3546 dbSNP
rs4987862 3551 dbSNP
rs1309362641 3555 dbSNP
rs185704013 3558 dbSNP
rs1042275186 3573 dbSNP
rs193151005 3577 dbSNP
rs953225297 3580 dbSNP
rs1283900547 3588 dbSNP
rs554654182 3602 dbSNP
rs893619909 3615 dbSNP
rs537903627 3621 dbSNP
rs1439083220 3626 dbSNP
rs1054011206 3628 dbSNP
rs1319834754 3633 dbSNP
rs937854244 3633 dbSNP
rs926349662 3636 dbSNP
rs200305018 3637 dbSNP
rs1186759290 3639 dbSNP
rs1237801474 3642 dbSNP
rs1473669936 3652 dbSNP
rs1186498268 3653 dbSNP
rs569181589 3663 dbSNP
rs981895053 3671 dbSNP
rs755532366 3672 dbSNP
rs370395757 3678 dbSNP
rs146086350 3684 dbSNP
rs1334109294 3685 dbSNP
rs572382935 3687 dbSNP
rs963133136 3690 dbSNP
rs1360297089 3693 dbSNP
rs748870593 3702 dbSNP
rs532390266 3710 dbSNP
rs1450593081 3712 dbSNP
rs1295945404 3713 dbSNP
rs142611734 3714 dbSNP
rs570769069 3719 dbSNP
rs374368978 3723 dbSNP
rs1364710640 3727 dbSNP
rs1229435378 3729 dbSNP
rs1015562468 3746 dbSNP
rs1004172841 3748 dbSNP
rs983691956 3757 dbSNP
rs1343004355 3760 dbSNP
rs1199761078 3765 dbSNP
rs951051974 3769 dbSNP
rs187334313 3775 dbSNP
rs4987863 3781 dbSNP
rs1192779167 3784 dbSNP
rs1449626686 3785 dbSNP
rs879486252 3814 dbSNP
rs1190143766 3816 dbSNP
rs561816906 3819 dbSNP
rs1017605403 3838 dbSNP
rs1008945978 3843 dbSNP
rs1244081755 3859 dbSNP
rs1002441198 3860 dbSNP
rs768646925 3867 dbSNP
rs541966669 3869 dbSNP
rs879014396 3871 dbSNP
rs1044294946 3881 dbSNP
rs1388376181 3884 dbSNP
rs954683009 3892 dbSNP
rs767916494 3901 dbSNP
rs183000521 3905 dbSNP
rs1446543041 3907 dbSNP
rs1283972120 3908 dbSNP
rs1213720485 3914 dbSNP
rs1267213627 3929 dbSNP
rs1349247819 3930 dbSNP
rs140875276 3950 dbSNP
rs539609896 3954 dbSNP
rs1450747257 3957 dbSNP
rs45520140 3962 dbSNP
rs1364460400 3965 dbSNP
rs77530335 3970 dbSNP
rs76721111 3971 dbSNP
rs113158648 3981 dbSNP
rs1157633853 3982 dbSNP
rs34811186 3982 dbSNP
rs372843127 3982 dbSNP
rs386387940 3982 dbSNP
rs77938688 3982 dbSNP
rs1430968243 3983 dbSNP
rs554443203 3985 dbSNP
rs1325414256 3987 dbSNP
rs1386481010 3987 dbSNP
rs905028250 3990 dbSNP
rs1295797318 3997 dbSNP
rs1407866404 4014 dbSNP
rs1046145832 4015 dbSNP
rs1329817950 4017 dbSNP
rs1229995110 4031 dbSNP
rs1263513502 4043 dbSNP
rs949128232 4044 dbSNP
rs1210063891 4049 dbSNP
rs911588676 4050 dbSNP
rs1172883708 4051 dbSNP
rs1268797046 4055 dbSNP
rs1481802085 4058 dbSNP
rs1412596796 4063 dbSNP
rs1473244850 4065 dbSNP
rs1050314650 4070 dbSNP
rs908178800 4078 dbSNP
rs554085830 4081 dbSNP
rs1187399387 4083 dbSNP
rs747006093 4086 dbSNP
rs375819800 4092 dbSNP
rs1164070466 4095 dbSNP
rs775666508 4099 dbSNP
rs920412357 4103 dbSNP
rs1427866993 4104 dbSNP
rs973653120 4105 dbSNP
rs920841951 4106 dbSNP
rs962787445 4107 dbSNP
rs973685304 4108 dbSNP
rs1190154078 4115 dbSNP
rs964816590 4120 dbSNP
rs4987864 4124 dbSNP
rs1245010466 4126 dbSNP
rs982865178 4127 dbSNP
rs1208609225 4128 dbSNP
rs960683145 4144 dbSNP
rs1274810336 4153 dbSNP
rs1274143977 4156 dbSNP
rs1483634880 4166 dbSNP
rs954777038 4190 dbSNP
rs1254448064 4191 dbSNP
rs1035009730 4208 dbSNP
rs1188727613 4221 dbSNP
rs371518171 4225 dbSNP
rs958101981 4230 dbSNP
rs970049963 4236 dbSNP
rs1022420675 4237 dbSNP
rs1301040533 4245 dbSNP
rs1002127766 4252 dbSNP
rs1396363878 4266 dbSNP
rs1316983623 4271 dbSNP
rs1275869818 4273 dbSNP
rs1011487992 4279 dbSNP
rs554717379 4290 dbSNP
rs370035615 4300 dbSNP
rs4987865 4301 dbSNP
rs1308781955 4303 dbSNP
rs1013449192 4307 dbSNP
rs886845642 4313 dbSNP
rs1483246533 4323 dbSNP
rs867942260 4351 dbSNP
rs190011740 4354 dbSNP
rs930936050 4373 dbSNP
rs1439504014 4385 dbSNP
rs1356125505 4387 dbSNP
rs1390817422 4393 dbSNP
rs898168667 4394 dbSNP
rs1170901424 4395 dbSNP
rs1466542729 4395 dbSNP
rs45489598 4395 dbSNP
rs890102918 4395 dbSNP
rs1338393436 4397 dbSNP
rs1386188454 4398 dbSNP
rs1433852593 4404 dbSNP
rs1050101160 4428 dbSNP
rs931884754 4433 dbSNP
rs1409083454 4438 dbSNP
rs1363688420 4441 dbSNP
rs539061071 4442 dbSNP
rs1167301565 4443 dbSNP
rs1355965320 4452 dbSNP
rs987589237 4458 dbSNP
rs1256856454 4459 dbSNP
rs1180692532 4461 dbSNP
rs1037664327 4472 dbSNP
rs566710209 4477 dbSNP
rs1265339355 4478 dbSNP
rs1233907141 4482 dbSNP
rs1204306091 4486 dbSNP
rs1316396257 4487 dbSNP
rs376082112 4487 dbSNP
rs1242889033 4497 dbSNP
rs547715314 4500 dbSNP
rs1234715585 4506 dbSNP
rs913970542 4507 dbSNP
rs571076818 4508 dbSNP
rs765856143 4517 dbSNP
rs45468492 4532 dbSNP
rs4987866 4537 dbSNP
rs573907712 4553 dbSNP
rs939459376 4557 dbSNP
rs1409428608 4559 dbSNP
rs1456480342 4564 dbSNP
rs1032356479 4571 dbSNP
rs980658728 4572 dbSNP
rs927932340 4574 dbSNP
rs1292367333 4577 dbSNP
rs981190892 4582 dbSNP
rs969275574 4587 dbSNP
rs1406032445 4598 dbSNP
rs749655144 4601 dbSNP
rs1327756961 4616 dbSNP
rs969451129 4620 dbSNP
rs1013423132 4623 dbSNP
rs577768081 4624 dbSNP
rs1397818696 4626 dbSNP
rs1285467928 4629 dbSNP
rs1318900203 4630 dbSNP
rs1219654601 4640 dbSNP
rs187081713 4643 dbSNP
rs1490540984 4644 dbSNP
rs1201731996 4646 dbSNP
rs1022968664 4648 dbSNP
rs989773383 4653 dbSNP
rs886949892 4660 dbSNP
rs778194812 4663 dbSNP
rs756666269 4670 dbSNP
rs1403201450 4676 dbSNP
rs1163657013 4681 dbSNP
rs1350156282 4682 dbSNP
rs556851434 4685 dbSNP
rs898133725 4691 dbSNP
rs142616439 4692 dbSNP
rs1039327910 4700 dbSNP
rs1280437861 4701 dbSNP
rs890212884 4705 dbSNP
rs1376026145 4713 dbSNP
rs1226774253 4726 dbSNP
rs1162786449 4729 dbSNP
rs1360521500 4732 dbSNP
rs762163340 4732 dbSNP
rs1224798306 4733 dbSNP
rs1272587833 4736 dbSNP
rs942400817 4737 dbSNP
rs562649519 4745 dbSNP
rs1234343870 4746 dbSNP
rs1471673676 4749 dbSNP
rs1028628899 4760 dbSNP
rs551977130 4764 dbSNP
rs1385472481 4780 dbSNP
rs1446147504 4785 dbSNP
rs4987867 4786 dbSNP
rs1369408288 4790 dbSNP
rs1429630975 4791 dbSNP
rs1330175172 4796 dbSNP
rs1356843754 4807 dbSNP
rs56041624 4808 dbSNP
rs914080210 4810 dbSNP
rs1038002758 4823 dbSNP
rs988600611 4827 dbSNP
rs1295442316 4831 dbSNP
rs1341566275 4832 dbSNP
rs936786917 4834 dbSNP
rs1274985798 4842 dbSNP
rs940645902 4843 dbSNP
rs1456748640 4852 dbSNP
rs1255282594 4853 dbSNP
rs886242395 4855 dbSNP
rs760256968 4856 dbSNP
rs980754991 4861 dbSNP
rs1056910654 4865 dbSNP
rs879142716 4866 dbSNP
rs34143126 4870 dbSNP
rs1024859536 4872 dbSNP
rs1475444466 4886 dbSNP
rs1172255857 4889 dbSNP
rs992097445 4907 dbSNP
rs765955215 4908 dbSNP
rs1336409698 4913 dbSNP
rs540538416 4914 dbSNP
rs980920920 4921 dbSNP
rs948032566 4926 dbSNP
rs148888145 4927 dbSNP
rs1318145503 4930 dbSNP
rs1364781559 4942 dbSNP
rs915275069 4943 dbSNP
rs757967145 4953 dbSNP
rs956961162 4957 dbSNP
rs1263485210 4965 dbSNP
rs1374468369 4966 dbSNP
rs1206645092 4970 dbSNP
rs1246998565 4972 dbSNP
rs1447277622 4976 dbSNP
rs898233897 4978 dbSNP
rs1441289200 4979 dbSNP
rs750160246 4986 dbSNP
rs1018015355 4990 dbSNP
rs1031136374 4991 dbSNP
rs1471141834 4997 dbSNP
rs1157486934 5001 dbSNP
rs561221675 5007 dbSNP
rs544821608 5010 dbSNP
rs1383007929 5032 dbSNP
rs1320299638 5035 dbSNP
rs765122650 5041 dbSNP
rs1345833006 5043 dbSNP
rs1051928178 5044 dbSNP
rs1347367071 5046 dbSNP
rs1226344113 5047 dbSNP
rs4987868 5049 dbSNP
rs776584611 5056 dbSNP
rs995961785 5057 dbSNP
rs1194663452 5058 dbSNP
rs559015384 5060 dbSNP
rs182433677 5072 dbSNP
rs1450510805 5073 dbSNP
rs1199560672 5074 dbSNP
rs925350723 5078 dbSNP
rs1481740475 5080 dbSNP
rs1207672801 5082 dbSNP
rs1486583162 5084 dbSNP
rs1004731322 5111 dbSNP
rs45503395 5113 dbSNP
rs886368530 5114 dbSNP
rs1160538158 5116 dbSNP
rs1388906909 5119 dbSNP
rs1424065552 5121 dbSNP
rs4987869 5128 dbSNP
rs938517862 5131 dbSNP
rs1407923525 5132 dbSNP
rs1305976003 5133 dbSNP
rs951312863 5137 dbSNP
rs1240973923 5140 dbSNP
rs905730112 5146 dbSNP
rs1282028436 5148 dbSNP
rs1351436467 5154 dbSNP
rs1282296095 5158 dbSNP
rs770721911 5165 dbSNP
rs1293340837 5167 dbSNP
rs4987870 5172 dbSNP
rs79620975 5172 dbSNP
rs535174883 5181 dbSNP
rs1250202083 5188 dbSNP
rs1299520722 5189 dbSNP
rs962560312 5191 dbSNP
rs536627558 5195 dbSNP
rs1362822407 5197 dbSNP
rs1444303846 5203 dbSNP
rs775407079 5207 dbSNP
rs865841395 5215 dbSNP
rs1053793968 5225 dbSNP
rs955010718 5229 dbSNP
rs566072775 5231 dbSNP
rs1397170165 5251 dbSNP
rs1010339280 5269 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions CLL patient samples
Location of target site 3'UTR
Original Description (Extracted from the article) ... BCL2 Is a Target of Posttranscriptional Repression by miR-15 and miR-16.//both mutants completely abolish the interaction between miR-15a and miR-16-1 and the 3'UTR of BCL2 (Fig. 2C).//These data indicate that both miRNAs directly interact with the 3'UTR of BCL2. ...

- Cimmino A; Calin GA; Fabbri M; Iorio MV; et al., 2005, Proceedings of the National Academy of Sciences of the United States of America.

Article - Cimmino A; Calin GA; Fabbri M; Iorio MV; et al.
- Proceedings of the National Academy of Sciences of the United States of America, 2005
Chronic lymphocytic leukemia (CLL) is the most common human leukemia and is characterized by predominantly nondividing malignant B cells overexpressing the antiapoptotic B cell lymphoma 2 (Bcl2) protein. miR-15a and miR-16-1 are deleted or down-regulated in the majority of CLLs. Here, we demonstrate that miR-15a and miR-16-1 expression is inversely correlated to Bcl2 expression in CLL and that both microRNAs negatively regulate Bcl2 at a posttranscriptional level. BCL2 repression by these microRNAs induces apoptopsis in a leukemic cell line model. Therefore, miR-15 and miR-16 are natural antisense Bcl2 interactors that could be used for therapy of Bcl2-overexpressing tumors.
LinkOut: [PMID: 16166262]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HL60 , NB41A3
Disease Acute promyelocytic leukemia (APL);
Location of target site 3'UTR
Tools used in this research microRNA.org , miRanda , PicTar
Original Description (Extracted from the article) ... we report the miRNA gene expression profile of an APL cell line (NB4) upon granulocytic differentiation with ATRA. The results were also confirmed in HL-60 cells, another mycloid leukemia cell line that undergoes granulocytic differentiation upon ATRA treatment and in primary APL patient samples treated in vitro with ATRA ...

- Garzon R; Pichiorri F; Palumbo T; Visentini et al., 2007, Oncogene.

Article - Garzon R; Pichiorri F; Palumbo T; Visentini et al.
- Oncogene, 2007
MicroRNAs (miRNAs) are small non-coding RNAs of 19-25 nucleotides that are involved in the regulation of critical cell processes such as apoptosis, cell proliferation and differentiation. However, little is known about the role of miRNAs in granulopoiesis. Here, we report the expression of miRNAs in acute promyelocytic leukemia patients and cell lines during all-trans-retinoic acid (ATRA) treatment by using a miRNA microarrays platform and quantitative real time-polymerase chain reaction (qRT-PCR). We found upregulation of miR-15a, miR-15b, miR-16-1, let-7a-3, let-7c, let-7d, miR-223, miR-342 and miR-107, whereas miR-181b was downregulated. Among the upregulated miRNAs, miR-107 is predicted to target NFI-A, a gene that has been involved in a regulatory loop involving miR-223 and C/EBPa during granulocytic differentiation. Indeed, we have confirmed that miR-107 targets NF1-A. To get insights about ATRA regulation of miRNAs, we searched for ATRA-modulated transcription factors binding sites in the upstream genomic region of the let-7a-3/let-7b cluster and identified several putative nuclear factor-kappa B (NF-kappaB) consensus elements. The use of reporter gene assays, chromatin immunoprecipitation and site-directed mutagenesis revealed that one proximal NF-kappaB binding site is essential for the transactivation of the let-7a-3/let-7b cluster. Finally, we show that ATRA downregulation of RAS and Bcl2 correlate with the activation of known miRNA regulators of those proteins, let-7a and miR-15a/miR-16-1, respectively.
LinkOut: [PMID: 17260024]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Article - Calin GA; Pekarsky Y; Croce CM
- Best practice & research. Clinical haematology, 2007
New findings support the view that chronic lymphocytic leukemia (CLL) is a genetic disease in which the main alterations occur in a new class of genes named microRNAs (miRNAs). Cases with good prognostic features typically are characterized by miRNA down-regulation of genes miR-15a and miR-16-1, located at 13q14.3. Both microRNAs negatively regulate BCL2 at a post-transcriptional level. On the other hand, in CLL cases that use unmutated immunoglobulin heavy-chain variable-region genes (IgV(H)) or have high-level expression of the 70-kD zeta-associated protein (ZAP-70) have high levels of TCL1 due to low-level expression of miR-29 and miR-181, which directly target this oncogene. Conceivably, these miRNAs might be used to target BCL2 or TCL1 for therapy of this disease.
LinkOut: [PMID: 17707831]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Cho WC
- Molecular cancer, 2007
microRNAs (miRNAs) are evolutionarily conserved, endogenous, small, noncoding RNA molecules of about 22 nucleotides in length that function as posttranscriptional gene regulators. They are deemed to play a crucial role in the initiation and progression of human cancer, and those with a role in cancer are designated as oncogenic miRNAs (oncomiRs). For example, miR-15 and miR-16 induce apoptosis by targeting Bcl2. miRNAs from the miR-17-92 cluster modulate tumor formation and function as oncogenes by influencing the translation of E2F1 mRNA. miR-21 modulates gemcitabine-induced apoptosis by phosphatase and tensin homolog deleted on chromosome 10-dependent activation of PI 3-kinase signaling. miR-34a acts as a suppressor of neuroblastoma tumorigenesis by targeting the mRNA encoding E2F3 and reducing E2F3 protein levels. The chromosomal translocations associating with human tumors disrupt the repression of High mobility group A2 by let-7 miRNA. In addition, the oncomiRs expression profiling of human malignancies has also identified a number of diagnostic and prognostic cancer signatures. This article introduces the roles of oncomiRs in neoplasm development, progression, diagnosis, prognostication, as well as their mechanism of actions on target mRNAs and the functional outcomes of their actions on mRNAs. The paper ends with a brief perspective to the future of oncomiRs.
LinkOut: [PMID: 17894887]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Location of target site 3'UTR
Original Description (Extracted from the article) ... changed ...

- Calin GA; Cimmino A; Fabbri M; Ferracin M; et al., 2008, Proceedings of the National Academy of Sciences of the United States of America.

Article - Calin GA; Cimmino A; Fabbri M; Ferracin M; et al.
- Proceedings of the National Academy of Sciences of the United States of America, 2008
MicroRNAs (miRNAs) are short noncoding RNAs regulating gene expression that play roles in human diseases, including cancer. Each miRNA is predicted to regulate hundreds of transcripts, but only few have experimental validation. In chronic lymphocytic leukemia (CLL), the most common adult human leukemia, miR-15a and miR-16-1 are lost or down-regulated in the majority of cases. After our previous work indicating a tumor suppressor function of miR-15a/16-1 by targeting the BCL2 oncogene, here, we produced a high-throughput profiling of genes modulated by miR-15a/16-1 in a leukemic cell line model (MEG-01) and in primary CLL samples. By combining experimental and bioinformatics data, we identified a miR-15a/16-1-gene signature in leukemic cells. Among the components of the miR-15a/16-1 signature, we observed a statistically significant enrichment in AU-rich elements (AREs). By examining the Gene Ontology (GO) database, a significant enrichment in cancer genes (such as MCL1, BCL2, ETS1, or JUN) that directly or indirectly affect apoptosis and cell cycle was found.
LinkOut: [PMID: 18362358]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Xia L; Zhang D; Du R; Pan Y; Zhao L; Sun S; et al.
- International journal of cancer, 2008
microRNAs are endogenous small noncoding RNAs that regulate gene expression negatively at posttranscriptional level. This latest addition to the complex gene regulatory circuitry revolutionizes our way to understanding physiological and pathological processes in the human body. Here we investigated the possible role of microRNAs in the development of multidrug resistance (MDR) in gastric cancer cells. microRNA expression profiling revealed a limited set of microRNAs with altered expression in multidrug- resistant gastric cancer cell line SGC7901/VCR compared to its parental SGC7901 cell line. Among the downregulated microRNAs are miR-15b and miR-16, members of miR-15/16 family, whose expression was further validated by qRT-PCR. In vitro drug sensitivity assay demonstrated that overexpression of miR-15b or miR-16 sensitized SGC7901/VCR cells to anticancer drugs whereas inhibition of them using antisense oligonucleotides conferred SGC7901 cells MDR. The downregulation of miR-15b and miR-16 in SGC7901/VCR cells was concurrent with the upregulation of Bcl-2 protein. Enforced mir-15b or miR-16 expression reduced Bcl-2 protein level and the luciferase activity of a BCL2 3' untranslated region-based reporter construct in SGC7901/VCR cells, suggesting that BCL2 is a direct target of miR-15b and miR-16. Moreover, overexpression of miR-15b or miR-16 could sensitize SGC7901/VCR cells to VCR-induced apoptosis. Taken together, our findings suggest that miR-15b and miR-16 could play a role in the development of MDR in gastric cancer cells at least in part by modulation of apoptosis via targeting BCL2.
LinkOut: [PMID: 18449891]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Bonci D; Coppola V; Musumeci M; Addario A; et al.
- Nature medicine, 2008
MicroRNAs (miRNAs) are noncoding small RNAs that repress protein translation by targeting specific messenger RNAs. miR-15a and miR-16-1 act as putative tumor suppressors by targeting the oncogene BCL2. These miRNAs form a cluster at the chromosomal region 13q14, which is frequently deleted in cancer. Here, we report that the miR-15a and miR-16-1 cluster targets CCND1 (encoding cyclin D1) and WNT3A, which promotes several tumorigenic features such as survival, proliferation and invasion. In cancer cells of advanced prostate tumors, the miR-15a and miR-16 level is significantly decreased, whereas the expression of BCL2, CCND1 and WNT3A is inversely upregulated. Delivery of antagomirs specific for miR-15a and miR-16 to normal mouse prostate results in marked hyperplasia, and knockdown of miR-15a and miR-16 promotes survival, proliferation and invasiveness of untransformed prostate cells, which become tumorigenic in immunodeficient NOD-SCID mice. Conversely, reconstitution of miR-15a and miR-16-1 expression results in growth arrest, apoptosis and marked regression of prostate tumor xenografts. Altogether, we propose that miR-15a and miR-16 act as tumor suppressor genes in prostate cancer through the control of cell survival, proliferation and invasion. These findings have therapeutic implications and may be exploited for future treatment of prostate cancer.
LinkOut: [PMID: 18931683]
Experimental Support 8 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease chronic lymphocytic leukemia
Location of target site 3'UTR
Tools used in this research FASTH
Original Description (Extracted from the article) ... Assessed by p-value, this decrease was significant for the TSPYL2 and WNT9B constructs at 10 and 50 nM, and for the BCL2 and TNFSF12 constructs at 50 nM. BCL2 mRNA has previously been validated as a target for has-miR-15a inhibition [30]. The CREBBP construct showed ,32% mean reduction at 50 nM, although this reduction is not significant as assessed by p-value.//A recent study shows that hsa-miR-15a and miR-16 induce apoptosis by targeting the BCL2 mRNA, and our results confirm this targeting for hsa-miR-15a. ...

- Ragan C; Cloonan N; Grimmond SM; Zuker M; Ragan MA, 2009, PloS one.

Article - Ragan C; Cloonan N; Grimmond SM; Zuker M; Ragan MA
- PloS one, 2009
Transcriptional regulation by microRNAs (miRNAs) involves complementary base-pairing at target sites on mRNAs, yielding complex secondary structures. Here we introduce an efficient computational approach and software (FASTH) for genome-scale prediction of miRNA target sites based on minimizing the free energy of duplex structure. We apply our approach to identify miRNA target sites in the human and mouse transcriptomes. Our results show that short sequence motifs in the 5' end of miRNAs frequently match mRNAs perfectly, not only at validated target sites but additionally at many other, energetically favourable sites. High-quality matching regions are abundant and occur at similar frequencies in all mRNA regions, not only the 3'UTR. About one-third of potential miRNA target sites are reassigned to different mRNA regions, or gained or lost altogether, among different transcript isoforms from the same gene. Many potential miRNA target sites predicted in human are not found in mouse, and vice-versa, but among those that do occur in orthologous human and mouse mRNAs most are situated in corresponding mRNA regions, i.e. these sites are themselves orthologous. Using a luciferase assay in HEK293 cells, we validate four of six predicted miRNA-mRNA interactions, with the mRNA level reduced by an average of 73%. We demonstrate that a thermodynamically based computational approach to prediction of miRNA binding sites on mRNAs can be scaled to analyse complete mammalian transcriptome datasets. These results confirm and extend the scope of miRNA-mediated species- and transcript-specific regulation in different cell types, tissues and developmental conditions.
LinkOut: [PMID: 19478946]
Experimental Support 9 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions OV-202
Original Description (Extracted from the article) ... MiR-15a and miR-16 also target Bcl-2 in ovarian cancer cell lines. ...

- Bhattacharya R; Nicoloso M; Arvizo R; Wang et al., 2009, Cancer research.

Article - Bhattacharya R; Nicoloso M; Arvizo R; Wang et al.
- Cancer research, 2009
Oncogenic activation of Bmi-1 is found in a wide variety of epithelial malignancies including ovarian cancer, yet a specific mechanism for overexpression of Bmi-1 has not been determined. Thus, realizing the immense pathologic significance of Bmi-1 in cancer, we wanted to investigate if microRNA (miRNA) aberrations played a role in the regulation of Bmi-1 in ovarian cancer. In this report, we identify two miRNAs, miR-15a and miR-16, that are underexpressed in ovarian cell lines and in primary ovarian tissues. We show that these miRNAs directly target the Bmi-1 3' untranslated region and significantly correlate with Bmi-1 protein levels in ovarian cancer patients and cell lines. Furthermore, Bmi-1 protein levels are downregulated in response to miR-15a or miR-16 expression and lead to significant reduction in ovarian cancer cell proliferation and clonal growth. These findings suggest the development of therapeutic strategies by restoring miR-15a and miR-16 expression in ovarian cancer and in other cancers that involve upregulation of Bmi-1.
LinkOut: [PMID: 19903841]
Experimental Support 10 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF-7 , MDA-MB-231
Disease breast carcinoma
Location of target site 3'UTR
Original Description (Extracted from the article) ... These results further implicate the BCL-2 targeting miR-15a/16 as important regulators of BCL-2 expression and tamoxifen response and suggest that oncogene suppression of miR-15a and/or miR-16 may represent an important mechanism of tamoxifen resistance. ...

- Cittelly DM; Das PM; Salvo VA; Fonseca JP; et al., 2010, Carcinogenesis.

Article - Cittelly DM; Das PM; Salvo VA; Fonseca JP; et al.
- Carcinogenesis, 2010
Tamoxifen is the most commonly prescribed therapy for patients with estrogen receptor (ER)alpha-positive breast tumors. Tumor resistance to tamoxifen remains a serious clinical problem especially in patients with tumors that also overexpress human epidermal growth factor receptor 2 (HER2). Current preclinical models of HER2 overexpression fail to recapitulate the clinical spectrum of endocrine resistance associated with HER2/ER-positive tumors. Here, we show that ectopic expression of a clinically important oncogenic isoform of HER2, HER2Delta16, which is expressed in >30% of ER-positive breast tumors, promotes tamoxifen resistance and estrogen independence of MCF-7 xenografts. MCF-7/HER2Delta16 cells evade tamoxifen through upregulation of BCL-2, whereas mediated suppression of BCL-2 expression or treatment of MCF-7/HER2Delta16 cells with the BCL-2 family pharmacological inhibitor ABT-737 restores tamoxifen sensitivity. Tamoxifen-resistant MCF-7/HER2Delta16 cells upregulate BCL-2 protein levels in response to suppressed ERalpha signaling mediated by estrogen withdrawal, tamoxifen treatment or fulvestrant treatment. In addition, HER2Delta16 expression results in suppression of BCL-2-targeting microRNAs miR-15a and miR-16. Reintroduction of miR-15a/16 reduced tamoxifen-induced BCL-2 expression and sensitized MCF-7/HER2Delta16 to tamoxifen. Conversely, inhibition of miR-15a/16 in tamoxifen-sensitive cells activated BCL-2 expression and promoted tamoxifen resistance. Our results suggest that HER2Delta16 expression promotes endocrine-resistant HER2/ERalpha-positive breast tumors and in contrast to wild-type HER2, preclinical models of HER2Delta16 overexpression recapitulate multiple phenotypes of endocrine-resistant human breast tumors. The mechanism of HER2Delta16 therapeutic evasion, involving tamoxifen-induced upregulation of BCL-2 and suppression of miR-15a/16, provides a template for unique therapeutic interventions combining tamoxifen with modulation of microRNAs and/or ABT-737-mediated BCL-2 inhibition and apoptosis.
LinkOut: [PMID: 20876285]
Experimental Support 11 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Klein U; Dalla-Favera R
- Seminars in cancer biology, 2010
Chronic lymphocytic leukemia (CLL), an incurable disease of the elderly, stands out as unique among the malignancies derived from mature B lymphocytes. The histology, immunophenotype, immunoglobulin variable region (IgV) gene somatic hypermutation status, and the pattern of genetic alterations of the tumor cells are markedly distinct from that of any other B-cell tumor. Most notably, CLL cases can have somatically mutated as well as unmutated IgV genes which largely correlate with a favorable and unfavorable clinical prognosis, respectively. Moreover, recent evidence suggests that 6% of the normal elderly population develops a monoclonal B-cell lymphocytosis (MBL) that appears as the precursor to CLL in 1-2% of cases. Over the last decade, global gene expression profile analysis was instrumental in defining CLL as a malignancy originating from the oncogenic transformation of a common cellular precursor that resembles an antigen-experienced B cell. These findings were complemented by the realization that all CLL, independent of their IgV gene somatic mutation status, express B-cell receptors (BCRs) that show evidence of antigen-experience. Indeed, the BCRs of CLL cases among different individuals can be similar to the extent that one was able to define subsets of stereotyped receptors based on the homology in the antigen-binding regions. Together, these observations strongly support the notion that antigen plays a critical role in CLL pathogenesis. This role is complemented by genetic alterations that, analogous to most cancer types, represent the initiating pathogenetic event. In fact, CLL cases display recurrent genetic aberrations including trisomy 12 and monoallelic or biallelic deletion/inactivation of chromosomal regions 17p, 11q and 13q14. However, virtually all CLL cases lack balanced reciprocal chromosomal translocations, the genetic hallmark of germinal center (GC)-derived lymphomas. The most frequent genetic aberration in CLL, deletion of chromosomal region 13q14, was recently shown to have a specific role in CLL pathogenesis. This region encodes a tumor suppressor locus comprising a microRNA cluster embedded in a long sterile RNA gene, whose deletion in the mouse leads to lymphoproliferative syndromes recapitulating the human CLL-associated spectrum, including MBL, CLL and B-cell non-Hodgkin lymphoma (B-NHL). This review will focus on the cellular origin of CLL, its relationship to the mechanisms of generating CLL-associated genetic lesions and on the role of the 13q14 deletion in CLL pathogenesis as emerging from the analysis of a newly generated mouse model.
LinkOut: [PMID: 21029776]
Experimental Support 12 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2