miRTarBase - #MIRT000285 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CCND2   
Synonyms KIAK0002, MPPH3
Description cyclin D2
Transcript NM_001759   
Expression
Putative miRNA Targets on CCND2
3'UTR of CCND2
(miRNA target sites are highlighted)
>CCND2|NM_001759|3'UTR
   1 GGATGCCAGTTGGGCCGAAAGAGAGAGACGCGTCCATAATCTGGTCTCTTCTTCTTTCTGGTTGTTTTTGTTCTTTGTGT
  81 TTTAGGGTGAAACTTAAAAAAAAAATTCTGCCCCCACCTAGATCATATTTAAAGATCTTTTAGAAGTGAGAGAAAAAGGT
 161 CCTACGAAAACGGAATAATAAAAAGCATTTGGTGCCTATTTGAAGTACAGCATAAGGGAATCCCTTGTATATGCGAACAG
 241 TTATTGTTTGATTATGTAAAAGTAATAGTAAAATGCTTACAGGAAAACCTGCAGAGTAGTTAGAGAATATGTATGCCTGC
 321 AATATGGGAACAAATTAGAGGAGACTTTTTTTTTTCATGTTATGAGCTAGCACATACACCCCCTTGTAGTATAATTTCAA
 401 GGAACTGTGTACGCCATTTATGGCATGATTAGATTGCAAAGCAATGAACTCAAGAAGGAATTGAAATAAGGAGGGACATG
 481 ATGGGGAAGGAGTACAAAACAATCTCTCAACATGATTGAACCATTTGGGATGGAGAAGCACCTTTGCTCTCAGCCACCTG
 561 TTACTAAGTCAGGAGTGTAGTTGGATCTCTACATTAATGTCCTCTTGCTGTCTACAGTAGCTGCTACCTAAAAAAAGATG
 641 TTTTATTTTGCCAGTTGGACACAGGTGATTGGCTCCTGGGTTTCATGTTCTGTGACATCCTGCTTCTTCTTCCAAATGCA
 721 GTTCATTGCAGACACCACCATATTGCTATCTAATGGGGAAATGTAGCTATGGGCCATAACCAAAACTCACATGAAACGGA
 801 GGCAGATGGAGACCAAGGGTGGGATCCAGAATGGAGTCTTTTCTGTTATTGTATTTAAAAGGGTAATGTGGCCTTGGCAT
 881 TTCTTCTTAGAAAAAAACTAATTTTTGGTGCTGATTGGCATGTCTGGTTCACAGTTTAGCATTGTTATAAACCATTCCAT
 961 TCGAAAAGCACTTTGAAAAATTGTTCCCGAGCGATAGATGGGATGGTTTATGCAAGTCATGCTGAATACTCCTCCCCTCT
1041 TCTCTTTTGCCCCCTCCCTTCCTGCCCCCAGTCTGGGTTACTCTTCGCTTCTGGTATCTGGCGTTCTTTGGTACACAGTT
1121 CTGGTGTTCCTACCAGGACTCAAGAGACACCCCTTCCTGCTGACATTCCCATCACAACATTCCTCAGACAAGCCTGTAAA
1201 CTAAAATCTGTTACCATTCTGATGGCACAGAAGGATCTTAATTCCCATCTCTATACTTCTCCTTTGGACATGGAAAGAAA
1281 AGTTATTGCTGGTGCAAAGATAGATGGCTGAACATCAGGGTGTGGCATTTTGTTCCCTTTTCCGTTTTTTTTTTTTTATT
1361 GTTGTTGTTAATTTTATTGCAAAGTTGTATTCAGCGTACTTGAATTTTTCTTCCTCTCCACTTCTTAGAGGCATTCAGTT
1441 AGCAAAGAGGTTGGAGCAACAACTTTTTTTTTTTTTTTTGCACAATTGTAATTGACAGGTAATGAAGCTATTTGTTAAAA
1521 TATTTGCCTTTTTAAGTAAAAAAGAAAAATCAGAACAGGGCTATTTGAAGAATTATTTTATACACAGATTCTGCCTTGTT
1601 TCATAGTATGAGGGTTGAAGACGGAAAACAATCTAAGGGTCTCTCATTTTTTTAATTTTGTTTTGTTCAGTTTGGTTTTT
1681 TTTTTTTTTTGCGCTGCTAAGAAGCTAAAGTCATCCATCCTTATTCACGTTGACAGTACCTAGCTGTAATGTTTCACAGA
1761 GTGTGCTGCTATTTTATAAACATTTTTATAATATATTATTTTACTGCTTAAATTCCAAGTCCTGAAGTAGATGGTTGAGA
1841 TATGAGTTCTTCGTACTGGAAAAGCCCTTCCGTAGTTTGTTTTCTTCTGGTAGCATATTCATGGTTGTTTTTTTTTTTCT
1921 TTTTTGGTTTTTTGGTTTTTTTTTTTTCCTCTGATCACATTCTTCAAAGACGGAGTATTCTTTACCTCAGGTTTACTGGA
2001 CAAAATCAATAACTACAAAAGGCAATGATTCACGCTTTTGTTTTCATAATACCTCACAACCGTACAGTTTCTGCTTGGGA
2081 GCCCATTCGCATGAGGAATACAGAAGCAGTGTGAGCAGGGCTGACTCCCTCTCAGGTGGAAGGCAGGGCGGTCTCACTCC
2161 CAGGGACCTTTTTGGTCATGGAGGCCATCGGGCTCCCAGTTAGACCCTGGTATCCTCATCATGATGGAAAAAATACATTG
2241 AACCAAGGGATCCTCCCTCCCCTTCAAGGCAGACGTTCAGTACAAACATTTATGCGGTAGGCTCAGATGTCGTAATTTGC
2321 ACTTAGGTACCAGGTGTCAGGAAACAGACTAAAAAGAATTCCACCAGGCTGTTTGGAGATCCTCATCTTGGAGCTTTTTC
2401 AAAAGCGGGGCTTCATCTGCAAAGGGCCCTTTCATCTTGAAGTTTTTCCCCTCCGTCTTTCCCCTCCCCTGGCATGGACA
2481 CCTTGTGTTTAGGATCATCTCTGCAGGTTTCCTAGGTCTGAATCTGCGAGTAGATGAACCTGCAGCAAGCAGCGTTTATG
2561 GTGCTTCCTTCTCCCTCCTCTGTCTCAAACTGCGCAGGCAAGCACTATGCAAGCCCAGGCCCTCTGCTGAGCGGTACTAA
2641 ACGGTCGGGTTTTCAATCACACTGAATTGGCAGGATAAGAAAAATAGGTCAGATAAGTATGGGATGATAGTTGAAGGGAG
2721 GTGAAGAGGCTGCTTCTCTACAGAGGTGAAATTCCAGATGAGTCAGTCTCTTGGGAAGTGTGTTTAGAAGGGTTCAGGAC
2801 TTTGTGAGTTAGCATGACCCTAAAATTCTAGGGGATTTCTGGTGGGACAATGGGTGGTGAATTCTGAAGTTTTGGAGAGG
2881 GAAGTGGAGCAGCCAGCAAGTAAGCTAGCCAGAGTTTTCTCAAGAGCCAGCTTTGCTCAGCACACTCTCCTGGGCCCCAA
2961 GGAGTCCCACGGAATGGGGAAAGCGGGAACCCTGGAGTTCTTGGGAATCTTGGAGCCTAAAGAGAAACCGAGGTGCAAAT
3041 TCATTTCATGGTGACTGACCCTTGAGCTTAAACAGAAGCAGCAAATGAAAGAACCGGACAAATAAGGAAGGGCACAAGCC
3121 TACCCGACTCTATTTACAGTCTGTAACTTTCCACTCTTCCTGTAGTCCCGAGGCCCCTGGGTCCTTCTAGCTTTTCTCTT
3201 TCCCATCCTTGGGGCCTTGTGTGATGATGGGTGTGGGGCTGCCGATGGGAAAGTCGGGGGTTGTTAGGCTTTTCTGCCTG
3281 CTCCTGCTTAAACACAAGAAGGAATCCTGGATTTTGCCCTCTCCTTAGCTCTTAGTCTCTTTGGTAGGAGTTTTGTTCCA
3361 GAGGAGCTCTCCCCCTTGGATTTGAACTTGCTCTTTTTGTTGTTGTTGTTCTTTCTCTTCTTTTTCTTACCTCCCACTAA
3441 AGGGGTTCCAAATTATCCTGGTCTTTTTCTACCTTGTTGTGTTTCTATCTCGTCTTTACTTCCATCTGTTTGTTTTTTTC
3521 TCCATCAGTGGGGGCCGAGTTGTTCCCCCAGCCTGCCAAATTTTGATCCTTCCCCTCTTTTGGCCAAATCCTAGGGGGAA
3601 GAAATCCTAGTATGCCAAAAATATATGCTAAGCATAATTAAACTCCATGCGGGTCCATAACAGCCAAGAAGCCTGCAGGA
3681 GAAAGCCAAGGGCAGTTCCCTCCGCAGAACACCCCATGCGTGCTGAGAGGCGAGCTCCTTGAAGAAGGGGCTGTTCTTCC
3761 AGGAGGCCTTATTTTGAACTGCCTCAGGACCCCACTGGAGAGCACAGCATGCCTTACTACTGGGTCATCCTTGGTCTATG
3841 TGCTCTGTACTGGAGGCTCTGTTCTGCCTCTTATCAGCCAGGTCAGGGGCACACATGGCTTAAGTGACAAAGCCAGAGGA
3921 GAAGACAACCCTGACAGCATCACGCTGCATCCCATTGCTAGCAGGATTGGCAACTCTTCAGACGGAGCTGCGCTTCCCTG
4001 CAGTCTAGCACCTCTAGGGCCTCTCCAGACTGTGCCCTGGGAGCTCTGGGACTGAAAGGTTAAGAACATAAGGCAGGATC
4081 AGATGACTCTCTCCAAGAGGGCAGGGGAATTTTCTCTCCATGGGCCACAGGGGACAGGGCTGGGAGAAGAAATAGACTTG
4161 CACCTTATGTCATGTAAATAATTGATTTTCTAGTTCAAGAAGATAATATTGGTAGTGTGGGAATTGGAGGTAGGAAGGGG
4241 AGGAAGTCTGAGTAAGCCAGTTGGCTTCTAAGCCAAAAGGATTCCTCTTTGTTTATCTCTGAGACAGTCCAACCTTGAGA
4321 ATAGCTTTAAAAGGGAAATTAATGCTGAGATGATAAAGTCCCCTTAAGCCAACAAACCCTCTGTAGCTATAGAATGAGTG
4401 CAGGTTTCTATTGGTGTGGACTCAGAGCAATTTACAAGAGCTGTTCATGCAGCCATCCATTTGTGCAAAATAGGGTAAGA
4481 AGATTCAAGAGGATATTTATTACTTCCTCATACCACATGGCTTTTGATGATTCTGGATTCTAAACAACCCAGAATGGTCA
4561 TTTCAGGCACAACGATACTACATTCGTGTGTGTCTGCTTTTAAACTTGGCTGGGCTATCAGACCCTATTCTCGGCTCAGG
4641 TTTTGAGAAGCCATCAGCAAATGTGTACGTGCATGCTGTAGCTGCAGCCTGCATCCCTTCGCCTGCAGCCTACTTTGGGG
4721 AAATAAAGTGCCTTACTGACTGTAGCCATTACAGTATCCAATGTCTTTTGACAGGTGCCTGTCCTTGAAAAACAAAGTTT
4801 CTATTTTTATTTTTAATTGGTTTAGTTCTTAACTGCTGGCCAACTCTTACATCCCCAGCAAATCATCGGGCCATTGGATT
4881 TTTTCCATTATGTTCATCACCCTTATATCATGTACCTCAGATCTCTCTCTCTCTCCTCTCTCTCAGTTATGTAGTTTCTT
4961 GTCTTGGACTTTTTTTTTTCTTTTCTTTTTCTTTTTTTTTTTGCTTTAAAACAAGTGTGATGCCATATCAAGTCCATGTT
5041 ATTCTCTCACAGTGTACTCTATAAGAGGTGTGGGTGTCTGTTTGGTCAGGATGTTAGAAAGTGCTGATAAGTAGCATGAT
5121 CAGTGTATGCGAAAAGGTTTTTAGGAAGTATGGCAAAAATGTTGTATTGGCTATGATGGTGACATGATATAGTCAGCTGC
5201 CTTTTAAGAGGTCTTATCTGTTCAGTGTTAAGTGATTTAAAAAAATAATAACCTGTTTTCTGACTAGTTTAAAGATGGAT
5281 TTGAAAATGGTTTTGAATGCAATTAGGTTATGCTATTTGGACAATAAACTCACCTTGACCTAAATTAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugGUAAUACACGACGAu 5'
                 ||  :||||||||| 
Target 5' tgtttcaCAGAGTGTGCTGCTa 3'
1750 - 1771 155.00 -19.80
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||||:| | | || |||| 
Target 5' aaaAAACTAATTTTTGGTGCTg 3'
892 - 913 135.00 -10.20
3
miRNA  3' guGUUUGGUAAUACACG-ACGAu 5'
            ||||:   || |||| |||| 
Target 5' agCAAATGTGTACGTGCATGCTg 3'
4656 - 4678 132.00 -12.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30168848 10 COSMIC
COSN31500620 12 COSMIC
COSN26969661 17 COSMIC
COSN32053010 18 COSMIC
COSN32057229 30 COSMIC
COSN2374893 31 COSMIC
COSN31597983 32 COSMIC
COSN26439950 33 COSMIC
COSN15666680 36 COSMIC
COSN18736484 70 COSMIC
COSN30158846 90 COSMIC
COSN31611265 106 COSMIC
COSN5944130 127 COSMIC
COSN31528544 138 COSMIC
COSN31572178 168 COSMIC
COSN16634342 172 COSMIC
COSN14631860 173 COSMIC
COSN31546075 235 COSMIC
COSN8540200 264 COSMIC
COSN31567448 273 COSMIC
COSN30176336 295 COSMIC
COSN24304316 307 COSMIC
COSN16707344 412 COSMIC
COSN9560818 435 COSMIC
COSN31609309 523 COSMIC
COSN8586184 529 COSMIC
COSN31529359 538 COSMIC
COSN26577434 547 COSMIC
COSN31577123 637 COSMIC
COSN32135386 691 COSMIC
COSN31571870 865 COSMIC
COSN19430573 869 COSMIC
COSN31577113 882 COSMIC
COSN30169740 1048 COSMIC
COSN31556491 1059 COSMIC
COSN31548012 1205 COSMIC
COSN31486519 1236 COSMIC
COSN22443772 1238 COSMIC
COSN21758142 1242 COSMIC
COSN20109089 1358 COSMIC
COSN27219661 1358 COSMIC
COSN23932231 1359 COSMIC
COSN31583872 1362 COSMIC
COSN8586185 1388 COSMIC
COSN31537011 1397 COSMIC
COSN15660713 1403 COSMIC
COSN31575152 1416 COSMIC
COSN30158133 1455 COSMIC
COSN31528063 1455 COSMIC
COSN20109093 1480 COSMIC
COSN27229112 1480 COSMIC
COSN31523253 1511 COSMIC
COSN31565165 1554 COSMIC
COSN31487367 1592 COSMIC
COSN31529937 1592 COSMIC
COSN9750202 1624 COSMIC
COSN31608752 1634 COSMIC
COSN31545811 1647 COSMIC
COSN26304963 1665 COSMIC
COSN28667784 1666 COSMIC
COSN20109094 1691 COSMIC
COSN20109095 1691 COSMIC
COSN31606948 1718 COSMIC
COSN5834345 1776 COSMIC
COSN31521955 1832 COSMIC
COSN31607873 1845 COSMIC
COSN31514934 1872 COSMIC
COSN31585762 1873 COSMIC
COSN26677978 1876 COSMIC
COSN27566405 1910 COSMIC
COSN29398863 1927 COSMIC
COSN28685907 2261 COSMIC
COSN20092478 2321 COSMIC
COSN5322928 2668 COSMIC
COSN9750204 3139 COSMIC
COSN9560831 3258 COSMIC
COSN21112404 3335 COSMIC
COSN5716463 3445 COSMIC
COSN22129158 3492 COSMIC
COSN20092479 3493 COSMIC
COSN22129159 3493 COSMIC
COSN26634986 3509 COSMIC
COSN31527450 3578 COSMIC
COSN31578792 3651 COSMIC
COSN19656168 3705 COSMIC
COSN22144126 3806 COSMIC
COSN31960737 3891 COSMIC
COSN25394617 4121 COSMIC
COSN25398982 4123 COSMIC
COSN8586187 4139 COSMIC
COSN31568026 4200 COSMIC
COSN27684047 4234 COSMIC
COSN22396164 4311 COSMIC
COSN1573871 4365 COSMIC
COSN29255266 4431 COSMIC
COSN31520552 4442 COSMIC
COSN31602714 4474 COSMIC
COSN31568880 4482 COSMIC
COSN9560835 4541 COSMIC
COSN21739081 4551 COSMIC
COSN31584730 4599 COSMIC
COSN24304154 4608 COSMIC
COSN31583055 4633 COSMIC
COSN8586188 4656 COSMIC
COSN31596341 4721 COSMIC
COSN4702728 4766 COSMIC
COSN15662326 4780 COSMIC
COSN9560839 4785 COSMIC
COSN31483056 4847 COSMIC
COSN31578960 4900 COSMIC
COSN31591486 4936 COSMIC
COSN21127654 4948 COSMIC
COSN31515734 4959 COSMIC
COSN31592922 5005 COSMIC
COSN5834346 5128 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs757476760 7 dbSNP
rs375075998 10 dbSNP
rs1423103141 14 dbSNP
rs1165229962 16 dbSNP
rs745670137 17 dbSNP
rs201029184 18 dbSNP
rs558839529 20 dbSNP
rs71534272 20 dbSNP
rs780008663 20 dbSNP
rs746875633 28 dbSNP
rs372914898 30 dbSNP
rs576728767 31 dbSNP
rs149455238 32 dbSNP
rs182223310 33 dbSNP
rs772799857 35 dbSNP
rs369380641 37 dbSNP
rs1238406756 43 dbSNP
rs1301620504 45 dbSNP
rs768083147 47 dbSNP
rs1371672162 49 dbSNP
rs767807041 49 dbSNP
rs775868165 50 dbSNP
rs1408257063 58 dbSNP
rs968362974 61 dbSNP
rs978357717 69 dbSNP
rs1173372265 70 dbSNP
rs924380708 79 dbSNP
rs745348060 83 dbSNP
rs1427476407 94 dbSNP
rs1198359304 96 dbSNP
rs202049688 96 dbSNP
rs767730445 96 dbSNP
rs1264636204 112 dbSNP
rs1202409472 114 dbSNP
rs993038146 116 dbSNP
rs956061950 118 dbSNP
rs1166380710 124 dbSNP
rs992785824 133 dbSNP
rs745471727 142 dbSNP
rs917867064 147 dbSNP
rs949311427 151 dbSNP
rs1369178648 152 dbSNP
rs1234086283 154 dbSNP
rs949034289 158 dbSNP
rs1440733632 160 dbSNP
rs548361720 166 dbSNP
rs868534479 167 dbSNP
rs1471009022 168 dbSNP
rs143104448 172 dbSNP
rs1234769266 173 dbSNP
rs768883541 174 dbSNP
rs1409959648 180 dbSNP
rs755581652 180 dbSNP
rs941362091 182 dbSNP
rs1469517841 185 dbSNP
rs1464053737 186 dbSNP
rs1208923650 192 dbSNP
rs1037006204 194 dbSNP
rs1459622159 196 dbSNP
rs531116835 199 dbSNP
rs1466953413 203 dbSNP
rs1209030481 210 dbSNP
rs998253565 217 dbSNP
rs1309519541 223 dbSNP
rs550967301 225 dbSNP
rs1003918194 226 dbSNP
rs1320983950 227 dbSNP
rs1285332994 231 dbSNP
rs1434894081 233 dbSNP
rs774917088 236 dbSNP
rs1454615653 244 dbSNP
rs1040743552 251 dbSNP
rs1336300740 269 dbSNP
rs1458023372 269 dbSNP
rs900800660 279 dbSNP
rs1030204330 284 dbSNP
rs890277474 292 dbSNP
rs370162310 297 dbSNP
rs997120829 301 dbSNP
rs1185397902 306 dbSNP
rs1442227146 311 dbSNP
rs1242063663 313 dbSNP
rs1188644293 317 dbSNP
rs1007359276 321 dbSNP
rs768111886 328 dbSNP
rs1017941188 332 dbSNP
rs1258605251 337 dbSNP
rs570842662 339 dbSNP
rs1214040580 341 dbSNP
rs1156850217 343 dbSNP
rs1028544539 344 dbSNP
rs1000349319 346 dbSNP
rs1291186871 346 dbSNP
rs969318686 346 dbSNP
rs773748390 347 dbSNP
rs1032210060 351 dbSNP
rs1457859924 357 dbSNP
rs1161624109 358 dbSNP
rs1392609549 360 dbSNP
rs1440628256 363 dbSNP
rs1175915364 371 dbSNP
rs1287379064 374 dbSNP
rs1370202574 376 dbSNP
rs1350313064 379 dbSNP
rs1390104410 383 dbSNP
rs1422598790 386 dbSNP
rs1384546531 393 dbSNP
rs968581444 394 dbSNP
rs1168615672 396 dbSNP
rs1306953429 401 dbSNP
rs956116159 403 dbSNP
rs1327812611 410 dbSNP
rs539437467 413 dbSNP
rs992838203 414 dbSNP
rs1269594018 417 dbSNP
rs1031282535 424 dbSNP
rs1485737516 427 dbSNP
rs1332308389 437 dbSNP
rs761126834 445 dbSNP
rs187268980 465 dbSNP
rs1357865681 468 dbSNP
rs547100974 480 dbSNP
rs1229195329 483 dbSNP
rs1309392744 485 dbSNP
rs970006917 492 dbSNP
rs1293688443 502 dbSNP
rs1175366999 503 dbSNP
rs981127158 507 dbSNP
rs1368580013 513 dbSNP
rs1472943728 516 dbSNP
rs1184525874 523 dbSNP
rs916974708 524 dbSNP
rs766811374 529 dbSNP
rs1402895538 530 dbSNP
rs948904816 532 dbSNP
rs926543008 533 dbSNP
rs1244166055 535 dbSNP
rs1364840303 542 dbSNP
rs980272611 549 dbSNP
rs931178951 552 dbSNP
rs1415941948 566 dbSNP
rs1370897635 573 dbSNP
rs1404930005 577 dbSNP
rs910149838 580 dbSNP
rs941581175 584 dbSNP
rs1169301245 589 dbSNP
rs1037058833 599 dbSNP
rs1433339293 605 dbSNP
rs1431008668 614 dbSNP
rs1201997720 623 dbSNP
rs1489974100 629 dbSNP
rs1196945286 630 dbSNP
rs1268775910 630 dbSNP
rs1048216099 638 dbSNP
rs1481657362 638 dbSNP
rs1165758882 640 dbSNP
rs1203931135 640 dbSNP
rs1285462848 648 dbSNP
rs1351944863 651 dbSNP
rs1344693699 661 dbSNP
rs918588850 676 dbSNP
rs1288891790 680 dbSNP
rs777159091 694 dbSNP
rs759261685 703 dbSNP
rs1297048533 704 dbSNP
rs564904186 706 dbSNP
rs939757207 707 dbSNP
rs1040794560 709 dbSNP
rs900854258 713 dbSNP
rs10849029 724 dbSNP
rs1409899081 725 dbSNP
rs114807534 749 dbSNP
rs1421338454 752 dbSNP
rs1353033340 755 dbSNP
rs1007822384 764 dbSNP
rs904768822 767 dbSNP
rs117673615 770 dbSNP
rs1265208206 774 dbSNP
rs1202070792 778 dbSNP
rs1031807737 783 dbSNP
rs1261023932 784 dbSNP
rs190921478 798 dbSNP
rs537367441 799 dbSNP
rs1306255885 801 dbSNP
rs1202238013 804 dbSNP
rs1384439315 808 dbSNP
rs1024331557 819 dbSNP
rs1388940367 824 dbSNP
rs1273827050 827 dbSNP
rs1455702387 828 dbSNP
rs865918702 834 dbSNP
rs1362533729 838 dbSNP
rs1031336431 839 dbSNP
rs1483376447 843 dbSNP
rs1207229669 844 dbSNP
rs556959568 850 dbSNP
rs1245110411 864 dbSNP
rs576799368 866 dbSNP
rs1013884217 870 dbSNP
rs1472528342 873 dbSNP
rs1262718859 877 dbSNP
rs1489407674 878 dbSNP
rs980125028 880 dbSNP
rs1260064733 887 dbSNP
rs1034047414 891 dbSNP
rs1361509498 891 dbSNP
rs1312210421 898 dbSNP
rs1427076693 901 dbSNP
rs1024494773 903 dbSNP
rs1168419796 911 dbSNP
rs1451310281 920 dbSNP
rs758481533 928 dbSNP
rs952669906 935 dbSNP
rs980707203 942 dbSNP
rs1384252704 949 dbSNP
rs1383331050 958 dbSNP
rs1371698796 960 dbSNP
rs545476314 961 dbSNP
rs1158489056 962 dbSNP
rs764116163 963 dbSNP
rs1387644279 964 dbSNP
rs1161695339 976 dbSNP
rs751471970 989 dbSNP
rs962994685 990 dbSNP
rs908395826 993 dbSNP
rs972972351 994 dbSNP
rs1446676024 999 dbSNP
rs1284398509 1006 dbSNP
rs1445066266 1018 dbSNP
rs1222972428 1024 dbSNP
rs1490806835 1032 dbSNP
rs1217599644 1036 dbSNP
rs918807932 1037 dbSNP
rs1380979765 1050 dbSNP
rs757205891 1053 dbSNP
rs1212577706 1054 dbSNP
rs1224870819 1055 dbSNP
rs1051079628 1057 dbSNP
rs1405954194 1058 dbSNP
rs1367955640 1063 dbSNP
rs3217922 1067 dbSNP
rs373098535 1070 dbSNP
rs1169732238 1072 dbSNP
rs1342617023 1079 dbSNP
rs911307621 1084 dbSNP
rs1474516860 1085 dbSNP
rs942785561 1087 dbSNP
rs1038864543 1092 dbSNP
rs1481319449 1093 dbSNP
rs1278134264 1097 dbSNP
rs780910327 1098 dbSNP
rs745669333 1103 dbSNP
rs1049395747 1104 dbSNP
rs1193582648 1109 dbSNP
rs1210964192 1115 dbSNP
rs1338286141 1116 dbSNP
rs1239427473 1125 dbSNP
rs148214337 1135 dbSNP
rs1052971704 1137 dbSNP
rs891688921 1138 dbSNP
rs1271573849 1139 dbSNP
rs1355639455 1141 dbSNP
rs1330921298 1148 dbSNP
rs1408310600 1151 dbSNP
rs1399798581 1153 dbSNP
rs1014351679 1169 dbSNP
rs1391096452 1211 dbSNP
rs1023962044 1229 dbSNP
rs776793651 1243 dbSNP
rs970237431 1248 dbSNP
rs1172258644 1252 dbSNP
rs779747661 1252 dbSNP
rs1234549443 1257 dbSNP
rs551992768 1257 dbSNP
rs1178993225 1259 dbSNP
rs1436759368 1271 dbSNP
rs1413409824 1285 dbSNP
rs1263364026 1287 dbSNP
rs1053276319 1295 dbSNP
rs572609891 1300 dbSNP
rs1334312528 1302 dbSNP
rs1261600284 1304 dbSNP
rs541474169 1315 dbSNP
rs1017148445 1328 dbSNP
rs1024384016 1344 dbSNP
rs1440088299 1344 dbSNP
rs962878570 1344 dbSNP
rs1376325467 1345 dbSNP
rs140621197 1345 dbSNP
rs1491466972 1345 dbSNP
rs34524099 1345 dbSNP
rs56044137 1345 dbSNP
rs56048189 1345 dbSNP
rs75211979 1345 dbSNP
rs764554330 1345 dbSNP
rs879108849 1345 dbSNP
rs1001991494 1346 dbSNP
rs1319510158 1348 dbSNP
rs1184920533 1355 dbSNP
rs1027660527 1356 dbSNP
rs1491054068 1357 dbSNP
rs952120866 1357 dbSNP
rs1230401041 1358 dbSNP
rs200860740 1358 dbSNP
rs1286939073 1359 dbSNP
rs1272971060 1361 dbSNP
rs200982928 1362 dbSNP
rs1315748586 1363 dbSNP
rs748546940 1364 dbSNP
rs1219873860 1365 dbSNP
rs35155154 1366 dbSNP
rs34997979 1369 dbSNP
rs1380801128 1371 dbSNP
rs141278429 1376 dbSNP
rs1315202485 1377 dbSNP
rs1415169853 1377 dbSNP
rs1346821231 1382 dbSNP
rs530978395 1384 dbSNP
rs1418962939 1385 dbSNP
rs955621413 1386 dbSNP
rs987233527 1396 dbSNP
rs1404577735 1397 dbSNP
rs1442283067 1405 dbSNP
rs1466510311 1414 dbSNP
rs551292905 1415 dbSNP
rs1186804952 1416 dbSNP
rs1486394143 1421 dbSNP
rs1244129028 1422 dbSNP
rs1214924504 1425 dbSNP
rs1488219530 1429 dbSNP
rs961221965 1430 dbSNP
rs564604964 1432 dbSNP
rs1357432087 1444 dbSNP
rs1312277096 1451 dbSNP
rs796323227 1452 dbSNP
rs1192193212 1456 dbSNP
rs1246628662 1457 dbSNP
rs1364371851 1459 dbSNP
rs772219810 1464 dbSNP
rs878966229 1464 dbSNP
rs922377823 1466 dbSNP
rs1478612140 1480 dbSNP
rs1211283531 1481 dbSNP
rs1426616288 1482 dbSNP
rs1455209990 1483 dbSNP
rs1170537449 1487 dbSNP
rs1157931615 1489 dbSNP
rs1429865465 1491 dbSNP
rs932426619 1495 dbSNP
rs985574304 1497 dbSNP
rs1477720343 1499 dbSNP
rs1437003686 1501 dbSNP
rs915706106 1503 dbSNP
rs1487795998 1509 dbSNP
rs1264885156 1511 dbSNP
rs1205342769 1523 dbSNP
rs1309448076 1533 dbSNP
rs1293755515 1534 dbSNP
rs925659025 1538 dbSNP
rs533412412 1551 dbSNP
rs935635932 1555 dbSNP
rs1321408303 1557 dbSNP
rs1330312651 1558 dbSNP
rs1402951222 1573 dbSNP
rs911205513 1589 dbSNP
rs1053324368 1595 dbSNP
rs1437021732 1600 dbSNP
rs150151031 1607 dbSNP
rs950253143 1623 dbSNP
rs546669155 1624 dbSNP
rs1169578010 1639 dbSNP
rs1465419305 1641 dbSNP
rs1327101048 1646 dbSNP
rs1202063112 1647 dbSNP
rs1431898914 1649 dbSNP
rs942815958 1654 dbSNP
rs3217923 1655 dbSNP
rs1268964559 1663 dbSNP
rs1256386087 1666 dbSNP
rs1331569867 1671 dbSNP
rs1212074116 1674 dbSNP
rs1289531793 1675 dbSNP
rs1324540157 1676 dbSNP
rs1392600416 1676 dbSNP
rs34569142 1676 dbSNP
rs34609911 1676 dbSNP
rs535974661 1676 dbSNP
rs66494535 1676 dbSNP
rs77471844 1677 dbSNP
rs1370610303 1678 dbSNP
rs1201585684 1679 dbSNP
rs905989725 1681 dbSNP
rs1407876395 1687 dbSNP
rs1178987407 1688 dbSNP
rs1001647348 1691 dbSNP
rs1377538312 1691 dbSNP
rs199786641 1692 dbSNP
rs1180912845 1693 dbSNP
rs1301197079 1694 dbSNP
rs1458435870 1695 dbSNP
rs1161098346 1697 dbSNP
rs4466913 1702 dbSNP
rs1389696829 1704 dbSNP
rs1461901823 1705 dbSNP
rs1245230312 1708 dbSNP
rs1405760504 1719 dbSNP
rs549464068 1724 dbSNP
rs1348595946 1729 dbSNP
rs1409278001 1730 dbSNP
rs749583873 1731 dbSNP
rs887815042 1740 dbSNP
rs1307837767 1750 dbSNP
rs1246118041 1751 dbSNP
rs1334347483 1752 dbSNP
rs1042797777 1794 dbSNP
rs768182587 1798 dbSNP
rs1402031106 1817 dbSNP
rs1004866874 1820 dbSNP
rs1455750843 1828 dbSNP
rs1379022407 1841 dbSNP
rs1158078898 1842 dbSNP
rs1352418800 1850 dbSNP
rs935857546 1851 dbSNP
rs182684983 1853 dbSNP
rs891738472 1854 dbSNP
rs949980308 1857 dbSNP
rs1045848931 1867 dbSNP
rs905519903 1872 dbSNP
rs567544553 1873 dbSNP
rs1206697238 1874 dbSNP
rs1029499719 1885 dbSNP
rs1483049030 1890 dbSNP
rs1246043603 1891 dbSNP
rs1361053559 1902 dbSNP
rs868307883 1902 dbSNP
rs147082841 1904 dbSNP
rs1473303650 1907 dbSNP
rs1343282901 1908 dbSNP
rs1359148360 1908 dbSNP
rs1402273263 1908 dbSNP
rs953989031 1909 dbSNP
rs536822360 1911 dbSNP
rs985238683 1912 dbSNP
rs557266635 1913 dbSNP
rs1472983429 1919 dbSNP
rs1373889707 1920 dbSNP
rs201420580 1920 dbSNP
rs1491138138 1926 dbSNP
rs1491381658 1926 dbSNP
rs375128557 1926 dbSNP
rs1368491617 1927 dbSNP
rs1428959767 1928 dbSNP
rs1308594661 1934 dbSNP
rs1372435346 1935 dbSNP
rs1223224944 1936 dbSNP
rs1449937240 1936 dbSNP
rs551472296 1936 dbSNP
rs957099915 1936 dbSNP
rs1339608897 1938 dbSNP
rs1394416594 1942 dbSNP
rs988429256 1948 dbSNP
rs1312244058 1949 dbSNP
rs1341367243 1950 dbSNP
rs1247426790 1952 dbSNP
rs1295783469 1954 dbSNP
rs1341904235 1955 dbSNP
rs1338981798 1961 dbSNP
rs1278116857 1972 dbSNP
rs570644439 1973 dbSNP
rs539676160 1975 dbSNP
rs1404881668 1980 dbSNP
rs1277421874 1990 dbSNP
rs1173167989 1998 dbSNP
rs1463867466 2010 dbSNP
rs898224804 2022 dbSNP
rs1199902236 2023 dbSNP
rs1198268052 2026 dbSNP
rs1244939732 2029 dbSNP
rs529993175 2035 dbSNP
rs572480733 2062 dbSNP
rs955836632 2064 dbSNP
rs1189199808 2067 dbSNP
rs1196445511 2075 dbSNP
rs759965835 2078 dbSNP
rs74786417 2083 dbSNP
rs370634757 2088 dbSNP
rs1018723361 2090 dbSNP
rs1448669381 2091 dbSNP
rs1224545056 2094 dbSNP
rs1347719814 2100 dbSNP
rs964082308 2121 dbSNP
rs1273635213 2129 dbSNP
rs979380061 2144 dbSNP
rs1391994892 2148 dbSNP
rs139789164 2150 dbSNP
rs555029990 2151 dbSNP
rs1049171309 2152 dbSNP
rs887854769 2157 dbSNP
rs575824923 2158 dbSNP
rs1415996784 2164 dbSNP
rs35604856 2169 dbSNP
rs1036369572 2176 dbSNP
rs901804663 2188 dbSNP
rs1244076205 2190 dbSNP
rs185406911 2191 dbSNP
rs913062831 2206 dbSNP
rs190269104 2207 dbSNP
rs1029963493 2222 dbSNP
rs780931238 2228 dbSNP
rs1230415479 2236 dbSNP
rs1045658197 2250 dbSNP
rs1254840907 2257 dbSNP
rs905736152 2274 dbSNP
rs953931569 2275 dbSNP
rs533467026 2276 dbSNP
rs1238102450 2282 dbSNP
rs1205124599 2283 dbSNP
rs1376394121 2289 dbSNP
rs1337695584 2290 dbSNP
rs1449932424 2292 dbSNP
rs1357278903 2293 dbSNP
rs1333267416 2295 dbSNP
rs540875933 2296 dbSNP
rs566885273 2297 dbSNP
rs1038012810 2302 dbSNP
rs1438593744 2306 dbSNP
rs1385459542 2312 dbSNP
rs1032797518 2319 dbSNP
rs898275850 2321 dbSNP
rs1263748615 2331 dbSNP
rs1209888901 2348 dbSNP
rs1448044479 2349 dbSNP
rs957126411 2356 dbSNP
rs1431313559 2360 dbSNP
rs1175275913 2363 dbSNP
rs1378233167 2366 dbSNP
rs1353145232 2379 dbSNP
rs3217924 2383 dbSNP
rs1026270916 2391 dbSNP
rs1157188811 2403 dbSNP
rs971010386 2407 dbSNP
rs891284014 2408 dbSNP
rs1431242635 2410 dbSNP
rs981747960 2411 dbSNP
rs1008776048 2412 dbSNP
rs1018548803 2418 dbSNP
rs927520299 2421 dbSNP
rs964237339 2430 dbSNP
rs1166314331 2441 dbSNP
rs1458087560 2444 dbSNP
rs1412662633 2446 dbSNP
rs1181610606 2448 dbSNP
rs549525414 2449 dbSNP
rs1265954776 2453 dbSNP
rs569370726 2455 dbSNP
rs909346396 2463 dbSNP
rs3217925 2465 dbSNP
rs1386668004 2466 dbSNP
rs550510324 2468 dbSNP
rs761675609 2469 dbSNP
rs1223894718 2472 dbSNP
rs570576106 2475 dbSNP
rs1320098937 2477 dbSNP
rs1289479258 2479 dbSNP
rs1214929368 2483 dbSNP
rs917961560 2488 dbSNP
rs867050804 2499 dbSNP
rs1399262559 2506 dbSNP
rs3217926 2509 dbSNP
rs927244722 2513 dbSNP
rs1294736834 2516 dbSNP
rs1455971664 2528 dbSNP
rs79512920 2529 dbSNP
rs570394607 2540 dbSNP
rs1265846169 2541 dbSNP
rs1328123417 2543 dbSNP
rs919587161 2552 dbSNP
rs929744529 2554 dbSNP
rs1208982683 2555 dbSNP
rs1046817338 2558 dbSNP
rs554910629 2559 dbSNP
rs535063367 2560 dbSNP
rs1008410478 2563 dbSNP
rs1033262769 2575 dbSNP
rs1255868388 2575 dbSNP
rs757018796 2577 dbSNP
rs892948739 2584 dbSNP
rs182883448 2594 dbSNP
rs1009957078 2595 dbSNP
rs1481441273 2602 dbSNP
rs563177199 2605 dbSNP
rs1180186265 2614 dbSNP
rs3217927 2630 dbSNP
rs900119452 2633 dbSNP
rs1001070560 2634 dbSNP
rs1161599134 2635 dbSNP
rs1465468415 2640 dbSNP
rs1032339282 2643 dbSNP
rs956715100 2644 dbSNP
rs199619940 2647 dbSNP
rs375898612 2650 dbSNP
rs544257129 2654 dbSNP
rs1457764950 2659 dbSNP
rs1034639965 2668 dbSNP
rs3217928 2670 dbSNP
rs1393599061 2672 dbSNP
rs147247521 2675 dbSNP
rs1406232646 2676 dbSNP
rs3217929 2677 dbSNP
rs1309294542 2686 dbSNP
rs12580778 2700 dbSNP
rs1374158351 2706 dbSNP
rs940809438 2709 dbSNP
rs34007392 2711 dbSNP
rs879539791 2711 dbSNP
rs12581036 2712 dbSNP
rs12581037 2713 dbSNP
rs927093371 2722 dbSNP
rs543031573 2726 dbSNP
rs958648679 2733 dbSNP
rs1304976024 2743 dbSNP
rs746417494 2746 dbSNP
rs1359129954 2752 dbSNP
rs187218956 2759 dbSNP
rs192927564 2768 dbSNP
rs1378687646 2780 dbSNP
rs889084095 2783 dbSNP
rs1424615233 2790 dbSNP
rs1265952295 2798 dbSNP
rs750056018 2799 dbSNP
rs919805587 2808 dbSNP
rs1218136943 2817 dbSNP
rs1054351525 2820 dbSNP
rs1307905282 2841 dbSNP
rs1244993633 2852 dbSNP
rs1341918401 2859 dbSNP
rs1049610 2865 dbSNP
rs1202950698 2875 dbSNP
rs770240504 2886 dbSNP
rs1394696938 2899 dbSNP
rs1402097883 2915 dbSNP
rs28364775 2927 dbSNP
rs1179149855 2937 dbSNP
rs1010007973 2945 dbSNP
rs1358625796 2950 dbSNP
rs551821718 2951 dbSNP
rs1411953029 2952 dbSNP
rs1370449548 2955 dbSNP
rs529844807 2956 dbSNP
rs1423078518 2962 dbSNP
rs906952500 2967 dbSNP
rs758003631 2971 dbSNP
rs1423597147 2974 dbSNP
rs1284627676 2978 dbSNP
rs1209946311 2984 dbSNP
rs1049611 2985 dbSNP
rs1034430358 2986 dbSNP
rs1243058523 2992 dbSNP
rs1387487313 2994 dbSNP
rs1428311935 2996 dbSNP
rs1307997299 2997 dbSNP
rs1279234019 2998 dbSNP
rs533138268 3001 dbSNP
rs1039914069 3004 dbSNP
rs1402332396 3012 dbSNP
rs958373325 3023 dbSNP
rs763174057 3031 dbSNP
rs1409953807 3032 dbSNP
rs1016511600 3033 dbSNP
rs1000954408 3036 dbSNP
rs1424002306 3040 dbSNP
rs1376602926 3049 dbSNP
rs1053967454 3051 dbSNP
rs1395434152 3052 dbSNP
rs546519233 3060 dbSNP
rs1476778453 3074 dbSNP
rs892696852 3075 dbSNP
rs972222519 3080 dbSNP
rs1009582650 3096 dbSNP
rs374274472 3097 dbSNP
rs970859819 3098 dbSNP
rs986209425 3099 dbSNP
rs779365017 3100 dbSNP
rs531256194 3104 dbSNP
rs1273896893 3119 dbSNP
rs3217930 3121 dbSNP
rs1220878442 3123 dbSNP
rs1002696510 3126 dbSNP
rs368190451 3127 dbSNP
rs1034215583 3137 dbSNP
rs1270176372 3138 dbSNP
rs1437265007 3139 dbSNP
rs958532965 3142 dbSNP
rs1321684747 3145 dbSNP
rs1440384166 3152 dbSNP
rs1483407613 3154 dbSNP
rs1333083704 3155 dbSNP
rs1463916366 3160 dbSNP
rs3217931 3170 dbSNP
rs1173161549 3171 dbSNP
rs1478973008 3172 dbSNP
rs1375368468 3178 dbSNP
rs1197571122 3194 dbSNP
rs1235933877 3197 dbSNP
rs1483015696 3206 dbSNP
rs1239660615 3209 dbSNP
rs1200885876 3212 dbSNP
rs371955525 3213 dbSNP
rs1387427239 3215 dbSNP
rs756568160 3222 dbSNP
rs951362788 3224 dbSNP
rs982495296 3230 dbSNP
rs183927620 3232 dbSNP
rs1168482687 3235 dbSNP
rs777789548 3235 dbSNP
rs1220250741 3236 dbSNP
rs912213669 3242 dbSNP
rs1054324858 3244 dbSNP
rs1410034531 3245 dbSNP
rs914489394 3248 dbSNP
rs943837754 3250 dbSNP
rs1041537775 3252 dbSNP
rs1444308019 3254 dbSNP
rs975576967 3256 dbSNP
rs920975521 3257 dbSNP
rs1334576476 3259 dbSNP
rs936861081 3261 dbSNP
rs1400017415 3264 dbSNP
rs1337014669 3275 dbSNP
rs3217932 3284 dbSNP
rs1381764461 3287 dbSNP
rs1176466170 3293 dbSNP
rs188877509 3294 dbSNP
rs557817327 3295 dbSNP
rs1438698914 3307 dbSNP
rs1232616954 3319 dbSNP
rs1003053176 3323 dbSNP
rs1444606639 3324 dbSNP
rs1277183967 3335 dbSNP
rs575276264 3336 dbSNP
rs945600757 3338 dbSNP
rs1210241375 3346 dbSNP
rs774703314 3356 dbSNP
rs192655661 3359 dbSNP
rs778251028 3360 dbSNP
rs1002173979 3362 dbSNP
rs140753367 3364 dbSNP
rs1284526568 3365 dbSNP
rs1449998220 3374 dbSNP
rs1216271400 3377 dbSNP
rs1276511294 3388 dbSNP
rs899223319 3392 dbSNP
rs1211029003 3397 dbSNP
rs962296658 3397 dbSNP
rs1245252605 3406 dbSNP
rs1361821398 3409 dbSNP
rs1156318554 3412 dbSNP
rs554544990 3415 dbSNP
rs993710723 3416 dbSNP
rs1182784076 3417 dbSNP
rs1249174987 3431 dbSNP
rs1474012778 3442 dbSNP
rs749624387 3444 dbSNP
rs1030524272 3448 dbSNP
rs574393909 3449 dbSNP
rs543294054 3463 dbSNP
rs369495045 3467 dbSNP
rs1435461787 3470 dbSNP
rs1026802756 3471 dbSNP
rs1288188037 3474 dbSNP
rs951371759 3479 dbSNP
rs1422394730 3480 dbSNP
rs767635730 3485 dbSNP
rs1019493609 3488 dbSNP
rs183933121 3489 dbSNP
rs958320716 3492 dbSNP
rs545208657 3493 dbSNP
rs750331260 3495 dbSNP
rs975026967 3499 dbSNP
rs921026342 3504 dbSNP
rs936411159 3505 dbSNP
rs1455436227 3507 dbSNP
rs1354075115 3512 dbSNP
rs1292453476 3525 dbSNP
rs565360448 3537 dbSNP
rs1342325696 3538 dbSNP
rs760637316 3540 dbSNP
rs766150238 3543 dbSNP
rs149766775 3544 dbSNP
rs1432762514 3546 dbSNP
rs55944753 3561 dbSNP
rs1166560355 3565 dbSNP
rs1403253014 3567 dbSNP
rs1273032262 3569 dbSNP
rs945681802 3570 dbSNP
rs868809541 3576 dbSNP
rs945966521 3578 dbSNP
rs1446198295 3583 dbSNP
rs1366967927 3585 dbSNP
rs1049612 3588 dbSNP
rs1478409520 3594 dbSNP
rs1266020161 3597 dbSNP
rs906743992 3605 dbSNP
rs1184829897 3611 dbSNP
rs1485615816 3624 dbSNP
rs867710948 3625 dbSNP
rs1265227180 3626 dbSNP
rs1247504076 3635 dbSNP
rs145781080 3639 dbSNP
rs1425146029 3648 dbSNP
rs1055119004 3651 dbSNP
rs754868418 3652 dbSNP
rs1449124605 3658 dbSNP
rs994923117 3662 dbSNP
rs1319885800 3673 dbSNP
rs1276294821 3676 dbSNP
rs1213474968 3682 dbSNP
rs1367616795 3684 dbSNP
rs1294789617 3686 dbSNP
rs1433798405 3697 dbSNP
rs1393313446 3704 dbSNP
rs529153835 3705 dbSNP
rs1466511206 3707 dbSNP
rs1426391822 3712 dbSNP
rs1169038174 3713 dbSNP
rs886950376 3715 dbSNP
rs1004010476 3721 dbSNP
rs778414240 3732 dbSNP
rs549233367 3733 dbSNP
rs1006333094 3736 dbSNP
rs965295811 3742 dbSNP
rs996496946 3754 dbSNP
rs1027925919 3762 dbSNP
rs1249410565 3766 dbSNP
rs1203666417 3768 dbSNP
rs1471367432 3784 dbSNP
rs1312728953 3786 dbSNP
rs1349978514 3789 dbSNP
rs549666325 3791 dbSNP
rs1158005936 3795 dbSNP
rs1176553038 3796 dbSNP
rs897471685 3799 dbSNP
rs1217006203 3812 dbSNP
rs188655271 3813 dbSNP
rs1203520465 3814 dbSNP
rs1447976190 3825 dbSNP
rs3217933 3826 dbSNP
rs865984355 3835 dbSNP
rs1336643115 3840 dbSNP
rs1030576429 3843 dbSNP
rs1360280309 3846 dbSNP
rs989181679 3848 dbSNP
rs1178299178 3860 dbSNP
rs1452724020 3862 dbSNP
rs1222197633 3874 dbSNP
rs1179423710 3876 dbSNP
rs1441793765 3893 dbSNP
rs77970983 3916 dbSNP
rs1176442497 3917 dbSNP
rs551234920 3919 dbSNP
rs1483521523 3922 dbSNP
rs1208079797 3933 dbSNP
rs1346606507 3938 dbSNP
rs1007725975 3944 dbSNP
rs191621202 3945 dbSNP
rs35080571 3951 dbSNP
rs746036050 3952 dbSNP
rs1305257570 3956 dbSNP
rs1280380878 3970 dbSNP
rs533829345 3974 dbSNP
rs1208499548 3975 dbSNP
rs567563931 3984 dbSNP
rs746323798 3985 dbSNP
rs148525558 3992 dbSNP
rs1225373472 3993 dbSNP
rs1055169925 3999 dbSNP
rs977335768 4001 dbSNP
rs920588451 4017 dbSNP
rs938551720 4024 dbSNP
rs930599995 4026 dbSNP
rs991329426 4027 dbSNP
rs1048279900 4028 dbSNP
rs1218203188 4029 dbSNP
rs915690826 4039 dbSNP
rs886502886 4040 dbSNP
rs571658838 4055 dbSNP
rs1238772918 4088 dbSNP
rs1295512936 4090 dbSNP
rs769167886 4090 dbSNP
rs1161304927 4095 dbSNP
rs1004468365 4104 dbSNP
rs772140042 4105 dbSNP
rs1040871251 4110 dbSNP
rs1037427509 4121 dbSNP
rs897524995 4122 dbSNP
rs1412817815 4126 dbSNP
rs1401974097 4134 dbSNP
rs1425144536 4135 dbSNP
rs928939283 4150 dbSNP
rs1158281402 4155 dbSNP
rs1458610984 4162 dbSNP
rs1052486801 4172 dbSNP
rs901108394 4191 dbSNP
rs890707765 4196 dbSNP
rs996715809 4205 dbSNP
rs1424296322 4218 dbSNP
rs1027979633 4221 dbSNP
rs866583005 4222 dbSNP
rs1368729310 4225 dbSNP
rs1409340099 4228 dbSNP
rs1260437322 4238 dbSNP
rs1210001816 4239 dbSNP
rs1489269552 4240 dbSNP
rs1008193187 4249 dbSNP
rs1329788636 4269 dbSNP
rs1337818942 4273 dbSNP
rs1334737216 4276 dbSNP
rs1017772370 4281 dbSNP
rs1324696331 4289 dbSNP
rs1242905224 4302 dbSNP
rs767423802 4303 dbSNP
rs957708938 4313 dbSNP
rs1317742615 4315 dbSNP
rs1387519024 4319 dbSNP
rs533931011 4334 dbSNP
rs1323607929 4342 dbSNP
rs752448734 4352 dbSNP
rs115254226 4364 dbSNP
rs1424244138 4377 dbSNP
rs982715360 4379 dbSNP
rs184203728 4389 dbSNP
rs966704680 4390 dbSNP
rs982074532 4391 dbSNP
rs1273169907 4396 dbSNP
rs1434509797 4400 dbSNP
rs1036050874 4401 dbSNP
rs1212191810 4404 dbSNP
rs1468373871 4405 dbSNP
rs1259120204 4409 dbSNP
rs928153601 4411 dbSNP
rs576388635 4412 dbSNP
rs959647052 4415 dbSNP
rs1234107321 4423 dbSNP
rs1373441099 4424 dbSNP
rs769503405 4424 dbSNP
rs1250778602 4428 dbSNP
rs1439132981 4444 dbSNP
rs1184967180 4449 dbSNP
rs959992408 4451 dbSNP
rs545385264 4457 dbSNP
rs920807963 4466 dbSNP
rs71579230 4472 dbSNP
rs941830658 4474 dbSNP
rs973174190 4481 dbSNP
rs1172628624 4490 dbSNP
rs1047696020 4496 dbSNP
rs907982125 4534 dbSNP
rs181806646 4537 dbSNP
rs1468140614 4557 dbSNP
rs1192548848 4569 dbSNP
rs928991622 4574 dbSNP
rs749613994 4575 dbSNP
rs1041315131 4580 dbSNP
rs1051450031 4584 dbSNP
rs1333783218 4587 dbSNP
rs1272985916 4589 dbSNP
rs1383961692 4593 dbSNP
rs1454954778 4601 dbSNP
rs868027270 4603 dbSNP
rs901005610 4606 dbSNP
rs890080867 4611 dbSNP
rs943650900 4616 dbSNP
rs996601268 4617 dbSNP
rs1281038586 4618 dbSNP
rs1439812702 4622 dbSNP
rs1296037411 4625 dbSNP
rs1335078761 4628 dbSNP
rs1049632379 4632 dbSNP
rs572218126 4633 dbSNP
rs187282643 4634 dbSNP
rs1419887570 4642 dbSNP
rs1251315123 4654 dbSNP
rs1409763814 4656 dbSNP
rs1011009687 4663 dbSNP
rs1010539983 4670 dbSNP
rs1340894722 4670 dbSNP
rs1020603689 4671 dbSNP
rs1198320218 4678 dbSNP
rs1188784658 4679 dbSNP
rs1486952556 4691 dbSNP
rs902302535 4696 dbSNP
rs1262169831 4698 dbSNP
rs1461576301 4701 dbSNP
rs1286678183 4702 dbSNP
rs1042489723 4704 dbSNP
rs1349604311 4729 dbSNP
rs1391888634 4743 dbSNP
rs190523603 4746 dbSNP
rs1245980541 4762 dbSNP
rs1004002974 4766 dbSNP
rs769125074 4772 dbSNP
rs1311713349 4779 dbSNP
rs529021058 4784 dbSNP
rs950791682 4790 dbSNP
rs1346583015 4793 dbSNP
rs1315868243 4794 dbSNP
rs146593405 4801 dbSNP
rs1193854620 4802 dbSNP
rs1385221105 4804 dbSNP
rs959607522 4805 dbSNP
rs990963257 4817 dbSNP
rs1166139942 4821 dbSNP
rs1476454573 4841 dbSNP
rs1027922136 4844 dbSNP
rs1416397173 4852 dbSNP
rs1374816945 4853 dbSNP
rs1486270854 4856 dbSNP
rs865892766 4868 dbSNP
rs180860278 4869 dbSNP
rs1407204564 4873 dbSNP
rs1471152464 4875 dbSNP
rs1023286266 4879 dbSNP
rs1292658705 4882 dbSNP
rs1218705069 4889 dbSNP
rs531248736 4892 dbSNP
rs1363376969 4895 dbSNP
rs1267920527 4901 dbSNP
rs1379288573 4907 dbSNP
rs1326966289 4919 dbSNP
rs1164749223 4922 dbSNP
rs1392909453 4922 dbSNP
rs1463395581 4922 dbSNP
rs1364929135 4923 dbSNP
rs1421684037 4933 dbSNP
rs1383228018 4936 dbSNP
rs554316087 4940 dbSNP
rs1181372053 4945 dbSNP
rs907866577 4946 dbSNP
rs4765775 4952 dbSNP
rs1272323782 4953 dbSNP
rs1199140095 4955 dbSNP
rs1327651394 4957 dbSNP
rs768453034 4959 dbSNP
rs976199813 4962 dbSNP
rs1213528786 4964 dbSNP
rs1367848517 4970 dbSNP
rs1438261812 4970 dbSNP
rs67603280 4970 dbSNP
rs1369157335 4975 dbSNP
rs921980286 4976 dbSNP
rs973226569 4976 dbSNP
rs1262113431 4980 dbSNP
rs1323730253 4981 dbSNP
rs1168395629 4985 dbSNP
rs1395915803 4986 dbSNP
rs1409517446 4986 dbSNP
rs1195660336 4991 dbSNP
rs1249601323 4992 dbSNP
rs1452831009 4992 dbSNP
rs200404720 4992 dbSNP
rs61152953 4992 dbSNP
rs796548117 4992 dbSNP
rs1205180700 4995 dbSNP
rs932502413 4996 dbSNP
rs1347882316 5001 dbSNP
rs1281855478 5003 dbSNP
rs1485434760 5004 dbSNP
rs1279839360 5005 dbSNP
rs1346746797 5006 dbSNP
rs950451953 5009 dbSNP
rs987600465 5012 dbSNP
rs1431509489 5014 dbSNP
rs1049519505 5016 dbSNP
rs1297034284 5018 dbSNP
rs3217934 5037 dbSNP
rs1376086586 5038 dbSNP
rs141438670 5039 dbSNP
rs1433057904 5039 dbSNP
rs943014977 5043 dbSNP
rs773302971 5053 dbSNP
rs189733699 5062 dbSNP
rs3210008 5066 dbSNP
rs1430085067 5069 dbSNP
rs1248153157 5072 dbSNP
rs1481501341 5074 dbSNP
rs560483986 5076 dbSNP
rs1388301366 5079 dbSNP
rs1049651 5098 dbSNP
rs902186334 5105 dbSNP
rs1208162405 5108 dbSNP
rs1346679050 5125 dbSNP
rs1003584083 5126 dbSNP
rs1291111110 5128 dbSNP
rs567890322 5129 dbSNP
rs536822575 5131 dbSNP
rs182399319 5132 dbSNP
rs1305328532 5146 dbSNP
rs185544647 5150 dbSNP
rs1034785361 5151 dbSNP
rs1042541445 5154 dbSNP
rs1389289379 5160 dbSNP
rs1413074386 5162 dbSNP
rs760549484 5164 dbSNP
rs1282017429 5173 dbSNP
rs1455549223 5174 dbSNP
rs1361795947 5185 dbSNP
rs1012451122 5187 dbSNP
rs1158148183 5194 dbSNP
rs1475478302 5199 dbSNP
rs1345631265 5204 dbSNP
rs11549724 5224 dbSNP
rs1485097839 5229 dbSNP
rs570323336 5237 dbSNP
rs1261823502 5244 dbSNP
rs1206470291 5246 dbSNP
rs1484702582 5248 dbSNP
rs1208547767 5249 dbSNP
rs1259298846 5249 dbSNP
rs1056938377 5252 dbSNP
rs538924803 5258 dbSNP
rs1295724541 5284 dbSNP
rs1231998312 5292 dbSNP
rs895172925 5299 dbSNP
rs952311601 5307 dbSNP
rs1384093579 5308 dbSNP
rs1022924146 5312 dbSNP
rs776528809 5316 dbSNP
rs1288050534 5332 dbSNP
rs766233402 5342 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Article - Bandi N; Zbinden S; Gugger M; Arnold M; et al.
- Cancer research, 2009
MicroRNAs (miRNA) are negative regulators of gene expression at the posttranscriptional level, which are involved in tumorigenesis. Two miRNAs, miR-15a and miR-16, which are located at chromosome 13q14, have been implicated in cell cycle control and apoptosis, but little information is available about their role in solid tumors. To address this question, we established a protocol to quantify miRNAs from laser capture microdissected tissues. Here, we show that miR-15a/miR-16 are frequently deleted or down-regulated in squamous cell carcinomas and adenocarcinomas of the lung. In these tumors, expression of miR-15a/miR-16 inversely correlates with the expression of cyclin D1. In non-small cell lung cancer (NSCLC) cell lines, cyclins D1, D2, and E1 are directly regulated by physiologic concentrations of miR-15a/miR-16. Consistent with these results, overexpression of these miRNAs induces cell cycle arrest in G(1)-G(0). Interestingly, H2009 cells lacking Rb are resistant to miR-15a/miR-16-induced cell cycle arrest, whereas reintroduction of functional Rb resensitizes these cells to miRNA activity. In contrast, down-regulation of Rb in A549 cells by RNA interference confers resistance to these miRNAs. Thus, cell cycle arrest induced by these miRNAs depends on the expression of Rb, confirming that G(1) cyclins are major targets of miR-15a/miR-16 in NSCLC. Our results indicate that miR-15a/miR-16 are implicated in cell cycle control and likely contribute to the tumorigenesis of NSCLC.
LinkOut: [PMID: 19549910]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaauacACGACGAu 5'
                        ||||||| 
Target 5' --------------UGCUGCUa 3'
1 - 8
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Liu YL; Yang HP; Zhou XD; Gong L; Tang CL; Wang HJ
- Current cancer drug targets, 2011
Hypermethylation of the Wnt inhibitory factor-1 (WIF-1) promoter has been implicated in the overactivation of the Wnt pathway in human lung cancer. Curcuminoids exert anti-cancer effects and have been reported to act as hypomethylating agents. Previously, we have investigated and compared the demethylation effects of three curcuminoids and observed that bisdemethoxycurcumin exhibited the strongest demethylation potency. In this study, we used lung cancer cell lines with WIF-1 promoter hypermethylated as a model to study the demethylating effect of bisdemethoxycurcumin on WIF-1 restoration, Wnt signaling activity and cell death. Bisdemethoxycurcumin directly suppressed the activity of DNA methyltransferase-1 (DNMT1) but did not influence DNMT1 expression. In addition, it induced WIF-1 promoter demethylation and protein re-expression. WIF-1 restoration in lung cancer cells down-regulated nuclear beta-catenin and the canonical Wnt cascade. Furthermore, we also showed that down-regulation of Wnt signaling by WIF-1 was required for bisdemethoxycurcumin-induced apoptosis in certain lung cancer cell types. This report is the first to show that bisdemethoxycurcumin induces apoptosis by reactivating WIF-1 from a silenced state. Our results provide new insights into the anti-cancer actions of bisdemethoxycurcumin.
LinkOut: [PMID: 21933103]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000261254.3 | 3UTR | UGCUGCUAUUUUAUAAACAUUUUUAUAAUAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000261254.3 | 3UTR | UGCUGCUAUUUUAUAAACAUUUUUAUAAUAUAUUAUUUUACUGCUUAAAUUCCAAGUCCUGAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5