>MYB|NM_001130172|3'UTR
   1 GACATTTCCAGAAAAGCATTATGGTTTTCAGAACACTTCAAGTTGACTTGGGATATATCATTCCTCAACATGAAACTTTT
  81 CATGAATGGGAGAAGAACCTATTTTTGTTGTGGTACAACAGTTGAGAGCAGCACCAAGTGCATTTAGTTGAATGAAGTCT
 161 TCTTGGATTTCACCCAACTAAAAGGATTTTTAAAAATAAATAACAGTCTTACCTAAATTATTAGGTAATGAATTGTAGCC
 241 AGTTGTTAATATCTTAATGCAGATTTTTTTAAAAAAAACATAAAATGATTTATCTGTATTTTAAAGGATCCAACAGATCA
 321 GTATTTTTTCCTGTGATGGGTTTTTTGAAATTTGACACATTAAAAGGTACTCCAGTATTTCACTTTTCTCGATCACTAAA
 401 CATATGCATATATTTTTAAAAATCAGTAAAAGCATTACTCTAAGTGTAGACTTAATACCATGTGACATTTAATCCAGATT
 481 GTAAATGCTCATTTATGGTTAATGACATTGAAGGTACATTTATTGTACCAAACCATTTTATGAGTTTTCTGTTAGCTTGC
 561 TTTAAAAATTATTACTGTAAGAAATAGTTTTATAAAAAATTATATTTTTATTCAGTAATTTAATTTTGTAAATGCCAAAT
 641 GAAAAACGTTTTTTGCTGCTATGGTCTTAGCCTGTAGACATGCTGCTAGTATCAGAGGGGCAGTAGAGCTTGGACAGAAA
 721 GAAAAGAAACTTGGTGTTAGGTAATTGACTATGCACTAGTATTTCAGACTTTTTAATTTTATATATATATACATTTTTTT
 801 TCCTTCTGCAATACATTTGAAAACTTGTTTGGGAGACTCTGCATTTTTTATTGTGGTTTTTTTGTTATTGTTGGTTTATA
 881 CAAGCATGCGTTGCACTTCTTTTTTGGGAGATGTGTGTTGTTGATGTTCTATGTTTTGTTTTGAGTGTAGCCTGACTGTT
 961 TTATAATTTGGGAGTTCTGCATTTGATCCGCATCCCCTGTGGTTTCTAAGTGTATGGTCTCAGAACTGTTGCATGGATCC
1041 TGTGTTTGCAACTGGGGAGACAGAAACTGTGGTTGATAGCCAGTCACTGCCTTAAGAACATTTGATGCAAGATGGCCAGC
1121 ACTGAACTTTTGAGATATGACGGTGTACTTACTGCCTTGTAGCAAAATAAAGATGTGCCCTTATTTTACCTACAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gugUUUGGUAAUACACGACGAu 5' ||| |:|| | ||||||| Target 5' tgaAAAACGTTTTTTGCTGCTa 3'	640 - 661	167.00	-13.30
2	miRNA 3' guguUUGGUAAUAC---ACGACGAu 5' |:|| || | ||||||| Target 5' tcttAGCCTGTA-GACATGCTGCTa 3'	665 - 688	145.00	-12.34
3	miRNA 3' guGUUUGGU--AAUAC----ACGACGAu 5' ||||||| ||||| | |||:| Target 5' acCAAACCATTTTATGAGTTTTCTGTTa 3'	527 - 554	128.00	-14.10

Mutant ID	Mutant Position	Mutant Source
COSN14197211	3	COSMIC
COSN30455529	51	COSMIC
COSN30116111	59	COSMIC
COSN30155858	67	COSMIC
COSN31525023	82	COSMIC
COSN30149252	96	COSMIC
COSN31530083	106	COSMIC
COSN31597759	167	COSMIC
COSN26818630	271	COSMIC
COSN21961385	272	COSMIC
COSN20103388	279	COSMIC
COSN16131885	370	COSMIC
COSN26669616	392	COSMIC
COSN31541822	665	COSMIC
COSN7690475	727	COSMIC
COSN26506750	868	COSMIC
COSN26601736	890	COSMIC
COSN26676977	916	COSMIC
COSN31662526	950	COSMIC
COSN31662077	986	COSMIC
COSN19190598	1070	COSMIC
COSN26647396	1080	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1457644081	2	dbSNP
rs761806864	4	dbSNP
rs1387237273	12	dbSNP
rs1399422192	16	dbSNP
rs747809460	19	dbSNP
rs765136014	20	dbSNP
rs761848825	22	dbSNP
rs1042371	37	dbSNP
rs202144270	42	dbSNP
rs371994822	45	dbSNP
rs1404287153	48	dbSNP
rs751266789	48	dbSNP
rs1480356922	51	dbSNP
rs1466705848	52	dbSNP
rs754377040	53	dbSNP
rs142843096	61	dbSNP
rs1049788717	62	dbSNP
rs909854589	67	dbSNP
rs1421014027	71	dbSNP
rs1382089296	85	dbSNP
rs941953392	96	dbSNP
rs1443944466	99	dbSNP
rs1412444215	107	dbSNP
rs980357860	125	dbSNP
rs1201996884	137	dbSNP
rs552220856	138	dbSNP
rs1483355172	139	dbSNP
rs927535213	140	dbSNP
rs1348121000	141	dbSNP
rs938908809	144	dbSNP
rs1355317005	149	dbSNP
rs1309360702	153	dbSNP
rs1245815528	158	dbSNP
rs1057212671	161	dbSNP
rs751717701	162	dbSNP
rs1397020970	164	dbSNP
rs1199574922	174	dbSNP
rs897721533	176	dbSNP
rs1421757017	177	dbSNP
rs1361181615	183	dbSNP
rs1163032110	186	dbSNP
rs759673901	197	dbSNP
rs370151079	198	dbSNP
rs1383351327	201	dbSNP
rs1439043737	203	dbSNP
rs1057334807	212	dbSNP
rs895601393	216	dbSNP
rs1424238866	219	dbSNP
rs1260607905	222	dbSNP
rs1184521611	226	dbSNP
rs1013079189	227	dbSNP
rs1489076141	231	dbSNP
rs1286051824	232	dbSNP
rs1221136961	233	dbSNP
rs945800550	238	dbSNP
rs1267812620	250	dbSNP
rs1245978922	251	dbSNP
rs112250530	263	dbSNP
rs1402026833	264	dbSNP
rs200493203	264	dbSNP
rs1341395891	269	dbSNP
rs1302596024	270	dbSNP
rs536173968	270	dbSNP
rs1458354581	271	dbSNP
rs3216774	271	dbSNP
rs74299305	271	dbSNP
rs869233628	271	dbSNP
rs55938804	272	dbSNP
rs201841211	275	dbSNP
rs1031884623	276	dbSNP
rs397807155	279	dbSNP
rs544771312	279	dbSNP
rs56040798	280	dbSNP
rs113427245	282	dbSNP
rs1400075188	285	dbSNP
rs1249935768	292	dbSNP
rs536544816	295	dbSNP
rs1220889492	310	dbSNP
rs1318844547	318	dbSNP
rs1282948470	321	dbSNP
rs1403179441	322	dbSNP
rs976979845	323	dbSNP
rs1329691068	324	dbSNP
rs922756590	325	dbSNP
rs1395728910	326	dbSNP
rs954177763	332	dbSNP
rs147011819	341	dbSNP
rs1305336373	343	dbSNP
rs909939541	355	dbSNP
rs1476844176	360	dbSNP
rs941359120	368	dbSNP
rs960584925	374	dbSNP
rs972689695	385	dbSNP
rs1249098362	391	dbSNP
rs186588575	392	dbSNP
rs112293547	403	dbSNP
rs1458547552	407	dbSNP
rs538759439	411	dbSNP
rs929201056	412	dbSNP
rs912915967	413	dbSNP
rs1057004804	429	dbSNP
rs945686194	432	dbSNP
rs895622879	442	dbSNP
rs1457691963	460	dbSNP
rs1335077869	481	dbSNP
rs1448908637	483	dbSNP
rs1400681039	485	dbSNP
rs1335865258	491	dbSNP
rs1412359780	500	dbSNP
rs948528579	506	dbSNP
rs779724172	507	dbSNP
rs558712123	508	dbSNP
rs1403955946	510	dbSNP
rs1255239390	514	dbSNP
rs575282702	515	dbSNP
rs1180983669	518	dbSNP
rs942392789	533	dbSNP
rs1242870012	541	dbSNP
rs1039956672	542	dbSNP
rs1376119110	566	dbSNP
rs1476552069	574	dbSNP
rs543911268	579	dbSNP
rs1348543480	580	dbSNP
rs554544217	581	dbSNP
rs1311568881	589	dbSNP
rs1168541733	594	dbSNP
rs1377592427	595	dbSNP
rs900982185	603	dbSNP
rs756417588	609	dbSNP
rs746661993	611	dbSNP
rs1423072822	614	dbSNP
rs1341880318	626	dbSNP
rs1046963813	629	dbSNP
rs1463959766	648	dbSNP
rs1358010410	649	dbSNP
rs1159957209	661	dbSNP
rs1327885452	674	dbSNP
rs886478060	680	dbSNP
rs575032658	681	dbSNP
rs1394868821	686	dbSNP
rs79468771	688	dbSNP
rs1004839271	689	dbSNP
rs963440512	690	dbSNP
rs1192667372	696	dbSNP
rs1321418627	699	dbSNP
rs1001601280	700	dbSNP
rs1327795569	705	dbSNP
rs1288203438	721	dbSNP
rs1217488038	755	dbSNP
rs778139617	762	dbSNP
rs374620401	765	dbSNP
rs1034951802	773	dbSNP
rs1276964126	778	dbSNP
rs960219997	780	dbSNP
rs1226396978	782	dbSNP
rs999823879	784	dbSNP
rs1315562816	788	dbSNP
rs1217267997	789	dbSNP
rs138229891	790	dbSNP
rs560328112	792	dbSNP
rs1489127218	793	dbSNP
rs1299466210	794	dbSNP
rs993518495	794	dbSNP
rs913482399	809	dbSNP
rs1365497917	816	dbSNP
rs532542952	819	dbSNP
rs1209613421	820	dbSNP
rs1163204604	832	dbSNP
rs397718007	837	dbSNP
rs56268608	837	dbSNP
rs978431208	838	dbSNP
rs892084018	840	dbSNP
rs998824935	841	dbSNP
rs1476945469	846	dbSNP
rs377628025	850	dbSNP
rs550590800	853	dbSNP
rs1194462207	857	dbSNP
rs954367288	857	dbSNP
rs985622997	858	dbSNP
rs1219213110	868	dbSNP
rs1262519912	868	dbSNP
rs1290282206	873	dbSNP
rs1017033185	875	dbSNP
rs562879021	876	dbSNP
rs922457189	882	dbSNP
rs933834145	887	dbSNP
rs972763290	890	dbSNP
rs1161217533	896	dbSNP
rs1386895030	902	dbSNP
rs1351014737	905	dbSNP
rs1328576554	918	dbSNP
rs887031151	921	dbSNP
rs1426044533	924	dbSNP
rs1005392961	930	dbSNP
rs1037682559	934	dbSNP
rs1480241019	936	dbSNP
rs918590226	939	dbSNP
rs1193026146	951	dbSNP
rs1489406493	952	dbSNP
rs531826017	956	dbSNP
rs1416076570	959	dbSNP
rs1293448895	964	dbSNP
rs1002053524	973	dbSNP
rs1259763490	976	dbSNP
rs1218805534	990	dbSNP
rs190986138	991	dbSNP
rs757843333	998	dbSNP
rs1275642853	999	dbSNP
rs1220501496	1000	dbSNP
rs1368899428	1007	dbSNP
rs1279556251	1010	dbSNP
rs1445220601	1013	dbSNP
rs917146702	1015	dbSNP
rs1332492231	1020	dbSNP
rs948580635	1027	dbSNP
rs1178303207	1033	dbSNP
rs1433907254	1034	dbSNP
rs367902794	1041	dbSNP
rs1014425740	1042	dbSNP
rs1217540178	1052	dbSNP
rs1482814869	1067	dbSNP
rs1199080191	1069	dbSNP
rs1262722466	1074	dbSNP
rs1253938080	1084	dbSNP
rs1211613118	1087	dbSNP
rs778285146	1090	dbSNP
rs1284703284	1095	dbSNP
rs967635543	1096	dbSNP
rs1379805401	1101	dbSNP
rs112386587	1105	dbSNP
rs111741587	1130	dbSNP
rs891448132	1133	dbSNP
rs997831376	1138	dbSNP
rs753169543	1139	dbSNP
rs975603296	1142	dbSNP
rs546882985	1143	dbSNP
rs1344630326	1176	dbSNP
rs1156960578	1177	dbSNP
rs1417749852	1185	dbSNP
rs1365258788	1191	dbSNP

- Blood, 2009

The c-myb proto-oncogene encodes an obligate hematopoietic cell transcription factor important for lineage commitment, proliferation, and differentiation. Given its critical functions, c-Myb regulatory factors are of great interest but remain incompletely defined. Herein we show that c-Myb expression is subject to posttranscriptional regulation by microRNA (miRNA)-15a. Using a luciferase reporter assay, we found that miR-15a directly binds the 3'-UTR of c-myb mRNA. By transfecting K562 myeloid leukemia cells with a miR-15a mimic, functionality of binding was shown. The mimic decreased c-Myb expression, and blocked the cells in the G(1) phase of cell cycle. Exogenous expression of c-myb mRNA lacking the 3'-UTR partially rescued the miR-15a induced cell-cycle block. Of interest, the miR-15a promoter contained several potential c-Myb protein binding sites. Occupancy of one canonical c-Myb binding site was demonstrated by chromatin immunoprecipitation analysis and shown to be required for miR-15a expression in K562 cells. Finally, in studies using normal human CD34(+) cells, we showed that c-Myb and miR-15a expression were inversely correlated in cells undergoing erythroid differentiation, and that overexpression of miR-15a blocked both erythroid and myeloid colony formation in vitro. In aggregate, these findings suggest the presence of a c-Myb-miR-15a autoregulatory feedback loop of potential importance in human hematopoiesis.

- The Journal of pathology, 2008

We investigated expression profiles of microRNA (miRNA) in renal cell carcinoma [clear cell carcinomas (CCC) and chromophobe renal cell carcinomas (ChCC)] and in normal kidneys by using a miRNA microarray platform which covers a total of 470 human miRNAs (Sanger miRBase release 9.1). Unsupervised hierarchical cluster analysis revealed that CCC and ChCC were separable and that no subgroups were identified in CCCs. We found that 43 miRNAs were differentially expressed between CCC and normal kidney, of which 37 were significantly down-regulated in CCC and the other 6 were up-regulated. We also found that 57 miRNAs were differentially expressed between ChCC and normal kidney, of which 51 were significantly down-regulated in ChCC and the other 6 were up-regulated. Together, these observations indicate that expression of miRNAs tends to be down-regulated in both CCC and ChCC compared with normal kidney. We observed that miR-141 and miR-200c were the most significantly down-regulated miRNAs in CCCs. Indeed, in all cases of CCC analysed, both miR-141 and miR-200c were down-regulated in comparison with normal kidney. Microarray data and quantitative RT-PCR showed that these two miRNAs were expressed concordantly. TargetScan algorithm revealed that ZFHX1B mRNA is a hypothetical target of both miR-141 and -200c. We established by quantitative RT-PCR that, in CCCs in which miR-141 and miR-200c were down-regulated, ZFHX1B, a transcriptional repressor for CDH1/E-cadherin, tended to be up-regulated. Furthermore, we found that overexpression of miR-141 and miR-200c caused down-regulation of ZFHX1B and up-regulation of E-cadherin in two renal carcinoma cell lines, ACHN and 786-O. On the basis of these findings, we suggest that down-regulation of miR-141 and miR-200c in CCCs might be involved in suppression of CDH1/E-cadherin transcription via up-regulation of ZFHX1B.

- Proceedings of the National Academy of Sciences of the United States of America, 2011

Many human aneuploidy syndromes have unique phenotypic consequences, but in most instances it is unclear whether these phenotypes are attributable to alterations in the dosage of specific genes. In human trisomy 13, there is delayed switching and persistence of fetal hemoglobin (HbF) and elevation of embryonic hemoglobin in newborns. Using partial trisomy cases, we mapped this trait to chromosomal band 13q14; by examining the genes in this region, two microRNAs, miR-15a and -16-1, appear as top candidates for the elevated HbF levels. Indeed, increased expression of these microRNAs in primary human erythroid progenitor cells results in elevated fetal and embryonic hemoglobin gene expression. Moreover, we show that a direct target of these microRNAs, MYB, plays an important role in silencing the fetal and embryonic hemoglobin genes. Thus we demonstrate how the developmental regulation of a clinically important human trait can be better understood through the genetic and functional study of aneuploidy syndromes and suggest that miR-15a, -16-1, and MYB may be important therapeutic targets to increase HbF levels in patients with sickle cell disease and beta-thalassemia.

- Mediators of inflammation, 2015

AIMS: This study aimed to investigate miR-106a expression in peripheral blood mononuclear cells (PBMCs) of chronic hepatitis B (CHB) patients and to analyze the function of miR-106a. MATERIALS AND METHODS: miR-106a expression levels in PBMCs from 40 healthy controls and 56 CHB patients were analyzed by quantitative real-time polymerase chain reaction (qRT-PCR). The luciferase activity assays were used to determine whether miR-106a binds to 3'UTR of IL-8. miR-106a mimics and inhibitors were transfected into healthy PBMCs. IL-8 mRNA and protein levels were detected and determined by qRT-PCR and ELISA, respectively. RESULTS: The qRT-PCR results suggested that the PBMC miR-106a levels were decreased in CHB patients. IL-8 was augmented in CHB patients and was inversely correlated with miR-106a levels. The luciferase activity assays indicated that IL-8 is a target of miR-106a. Exogenous expression of miR-106a could significantly repress IL-8 expression at both mRNA and protein levels in PBMCs, whereas miR-106a inhibitor had the opposite effects. CONCLUSIONS: This study suggested that miR-106a is downregulated in PBMCs of CHB patients and that miR-106a may play an important role in CHB by targeting IL-8.

- American journal of translational research, 2017

PURPOSE: This study aimed to determine the function of miR-15a in HCC, and identify cMyb as a target of miR-15a. METHODS: RNA expression was evaluated by quantitative real-time PCR (qRT-PCR). The effects of miR-15a or cMyb on HCC cells were evaluated by transwell migration assay and western blot analysis. CMyb, the predicted target, has been frequently verified by luciferase assay. RESULTS: MiR-15a was markedly downregulated in sphere culture HCC cells by qRT-PCR. CMyb was predicted to be a potential target of miR-15a using bioinformatics analysis. This prediction has been frequently verified by luciferase assay and western blot. A positive correlation between cMyb and the migration ability of HCC cells was demonstrated by transwell assays. MiR-15a mimic suppressed cMyb expression to weaken HCC cell migration ability. On the other hand, miR-15a inhibitor upregulated cMyb and induced HCC cell migration. CONCLUSION: MiR-15a could suppress HCC progression through the repression of cMyb, making miR-15a a potential therapeutic target.