pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-15a |
Genomic Coordinates | chr13: 50049119 - 50049201 |
Synonyms | MIRN15A, hsa-mir-15a, miRNA15A, MIR15A |
Description | Homo sapiens miR-15a stem-loop |
Comment | Reference . |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | hsa-miR-15a-5p |
Sequence | 14| UAGCAGCACAUAAUGGUUUGUG |35 |
Evidence | Experimental |
Experiments | Cloned |
SNPs in miRNA | |
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling | Circulating MicroRNA Expression Profiling |
---|
Gene Information | |
---|---|
Gene Symbol | MYB |
Synonyms | Cmyb, c-myb, c-myb_CDS, efg |
Description | MYB proto-oncogene, transcription factor |
Transcript | NM_001130172 |
Other Transcripts | NM_001130173 , NM_001161656 , NM_001161657 , NM_001161658 , NM_001161659 , NM_001161660 , NM_005375 |
Expression | |
Putative miRNA Targets on MYB | |
3'UTR of MYB (miRNA target sites are highlighted) |
>MYB|NM_001130172|3'UTR 1 GACATTTCCAGAAAAGCATTATGGTTTTCAGAACACTTCAAGTTGACTTGGGATATATCATTCCTCAACATGAAACTTTT 81 CATGAATGGGAGAAGAACCTATTTTTGTTGTGGTACAACAGTTGAGAGCAGCACCAAGTGCATTTAGTTGAATGAAGTCT 161 TCTTGGATTTCACCCAACTAAAAGGATTTTTAAAAATAAATAACAGTCTTACCTAAATTATTAGGTAATGAATTGTAGCC 241 AGTTGTTAATATCTTAATGCAGATTTTTTTAAAAAAAACATAAAATGATTTATCTGTATTTTAAAGGATCCAACAGATCA 321 GTATTTTTTCCTGTGATGGGTTTTTTGAAATTTGACACATTAAAAGGTACTCCAGTATTTCACTTTTCTCGATCACTAAA 401 CATATGCATATATTTTTAAAAATCAGTAAAAGCATTACTCTAAGTGTAGACTTAATACCATGTGACATTTAATCCAGATT 481 GTAAATGCTCATTTATGGTTAATGACATTGAAGGTACATTTATTGTACCAAACCATTTTATGAGTTTTCTGTTAGCTTGC 561 TTTAAAAATTATTACTGTAAGAAATAGTTTTATAAAAAATTATATTTTTATTCAGTAATTTAATTTTGTAAATGCCAAAT 641 GAAAAACGTTTTTTGCTGCTATGGTCTTAGCCTGTAGACATGCTGCTAGTATCAGAGGGGCAGTAGAGCTTGGACAGAAA 721 GAAAAGAAACTTGGTGTTAGGTAATTGACTATGCACTAGTATTTCAGACTTTTTAATTTTATATATATATACATTTTTTT 801 TCCTTCTGCAATACATTTGAAAACTTGTTTGGGAGACTCTGCATTTTTTATTGTGGTTTTTTTGTTATTGTTGGTTTATA 881 CAAGCATGCGTTGCACTTCTTTTTTGGGAGATGTGTGTTGTTGATGTTCTATGTTTTGTTTTGAGTGTAGCCTGACTGTT 961 TTATAATTTGGGAGTTCTGCATTTGATCCGCATCCCCTGTGGTTTCTAAGTGTATGGTCTCAGAACTGTTGCATGGATCC 1041 TGTGTTTGCAACTGGGGAGACAGAAACTGTGGTTGATAGCCAGTCACTGCCTTAAGAACATTTGATGCAAGATGGCCAGC 1121 ACTGAACTTTTGAGATATGACGGTGTACTTACTGCCTTGTAGCAAAATAAAGATGTGCCCTTATTTTACCTACAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
DRVs in gene 3'UTRs |
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | 293T , K562 |
Disease | GTTCTAGAAGGTAAAATAAGGGCACATCT; |
Location of target site | 3'UTR |
Tools used in this research | TargetScanS |
Original Description (Extracted from the article) |
...
"miR-15a decreases human c-Myb expression in K562 human myeloid leukemia cells.//Interestingly
... - Zhao H; Kalota A; Jin S; Gewirtz AM, 2009, Blood. |
Article |
- Zhao H; Kalota A; Jin S; Gewirtz AM - Blood, 2009
The c-myb proto-oncogene encodes an obligate hematopoietic cell transcription factor important for lineage commitment, proliferation, and differentiation. Given its critical functions, c-Myb regulatory factors are of great interest but remain incompletely defined. Herein we show that c-Myb expression is subject to posttranscriptional regulation by microRNA (miRNA)-15a. Using a luciferase reporter assay, we found that miR-15a directly binds the 3'-UTR of c-myb mRNA. By transfecting K562 myeloid leukemia cells with a miR-15a mimic, functionality of binding was shown. The mimic decreased c-Myb expression, and blocked the cells in the G(1) phase of cell cycle. Exogenous expression of c-myb mRNA lacking the 3'-UTR partially rescued the miR-15a induced cell-cycle block. Of interest, the miR-15a promoter contained several potential c-Myb protein binding sites. Occupancy of one canonical c-Myb binding site was demonstrated by chromatin immunoprecipitation analysis and shown to be required for miR-15a expression in K562 cells. Finally, in studies using normal human CD34(+) cells, we showed that c-Myb and miR-15a expression were inversely correlated in cells undergoing erythroid differentiation, and that overexpression of miR-15a blocked both erythroid and myeloid colony formation in vitro. In aggregate, these findings suggest the presence of a c-Myb-miR-15a autoregulatory feedback loop of potential importance in human hematopoiesis.
LinkOut: [PMID: 18818396]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Article |
- Nakada C; Matsuura K; Tsukamoto Y; Tanigawa et al. - The Journal of pathology, 2008
We investigated expression profiles of microRNA (miRNA) in renal cell carcinoma [clear cell carcinomas (CCC) and chromophobe renal cell carcinomas (ChCC)] and in normal kidneys by using a miRNA microarray platform which covers a total of 470 human miRNAs (Sanger miRBase release 9.1). Unsupervised hierarchical cluster analysis revealed that CCC and ChCC were separable and that no subgroups were identified in CCCs. We found that 43 miRNAs were differentially expressed between CCC and normal kidney, of which 37 were significantly down-regulated in CCC and the other 6 were up-regulated. We also found that 57 miRNAs were differentially expressed between ChCC and normal kidney, of which 51 were significantly down-regulated in ChCC and the other 6 were up-regulated. Together, these observations indicate that expression of miRNAs tends to be down-regulated in both CCC and ChCC compared with normal kidney. We observed that miR-141 and miR-200c were the most significantly down-regulated miRNAs in CCCs. Indeed, in all cases of CCC analysed, both miR-141 and miR-200c were down-regulated in comparison with normal kidney. Microarray data and quantitative RT-PCR showed that these two miRNAs were expressed concordantly. TargetScan algorithm revealed that ZFHX1B mRNA is a hypothetical target of both miR-141 and -200c. We established by quantitative RT-PCR that, in CCCs in which miR-141 and miR-200c were down-regulated, ZFHX1B, a transcriptional repressor for CDH1/E-cadherin, tended to be up-regulated. Furthermore, we found that overexpression of miR-141 and miR-200c caused down-regulation of ZFHX1B and up-regulation of E-cadherin in two renal carcinoma cell lines, ACHN and 786-O. On the basis of these findings, we suggest that down-regulation of miR-141 and miR-200c in CCCs might be involved in suppression of CDH1/E-cadherin transcription via up-regulation of ZFHX1B.
LinkOut: [PMID: 18925646]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | 293T |
Disease | 4602.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan |
Original Description (Extracted from the article) |
...
"MYB is necessary for the normal differentiation kinetics of adult erythroid cells and reduction in the level of this gene results in altered erythroid differentiation kinetics and the increased presence of cells from other lineages. Consistent with the 茂卢聛 ndings with moderate MYB knockdown by miR-15a/16-1
... - Sankaran VG; Menne TF; Scepanovic D; et al., 2011, Proceedings of the National Academy of Sciences of the United States of America. |
Article |
- Sankaran VG; Menne TF; Scepanovic D; et al. - Proceedings of the National Academy of Sciences of the United States of America, 2011
Many human aneuploidy syndromes have unique phenotypic consequences, but in most instances it is unclear whether these phenotypes are attributable to alterations in the dosage of specific genes. In human trisomy 13, there is delayed switching and persistence of fetal hemoglobin (HbF) and elevation of embryonic hemoglobin in newborns. Using partial trisomy cases, we mapped this trait to chromosomal band 13q14; by examining the genes in this region, two microRNAs, miR-15a and -16-1, appear as top candidates for the elevated HbF levels. Indeed, increased expression of these microRNAs in primary human erythroid progenitor cells results in elevated fetal and embryonic hemoglobin gene expression. Moreover, we show that a direct target of these microRNAs, MYB, plays an important role in silencing the fetal and embryonic hemoglobin genes. Thus we demonstrate how the developmental regulation of a clinically important human trait can be better understood through the genetic and functional study of aneuploidy syndromes and suggest that miR-15a, -16-1, and MYB may be important therapeutic targets to increase HbF levels in patients with sickle cell disease and beta-thalassemia.
LinkOut: [PMID: 21205891]
|
Experimental Support 4 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | 293T |
Location of target site | 3'UTR |
Tools used in this research | previous_study |
Original Description (Extracted from the article) |
...
cell-maturation defect present with miR-15/16 de茂卢聛ciency. The transcription factor Myb is a direct target of miR-15/16
... - Hong Z; Hong H; Liu J; Zheng X; Huang M; Li et al., 2015, Mediators of inflammation. |
Article |
- Hong Z; Hong H; Liu J; Zheng X; Huang M; Li et al. - Mediators of inflammation, 2015
AIMS: This study aimed to investigate miR-106a expression in peripheral blood mononuclear cells (PBMCs) of chronic hepatitis B (CHB) patients and to analyze the function of miR-106a. MATERIALS AND METHODS: miR-106a expression levels in PBMCs from 40 healthy controls and 56 CHB patients were analyzed by quantitative real-time polymerase chain reaction (qRT-PCR). The luciferase activity assays were used to determine whether miR-106a binds to 3'UTR of IL-8. miR-106a mimics and inhibitors were transfected into healthy PBMCs. IL-8 mRNA and protein levels were detected and determined by qRT-PCR and ELISA, respectively. RESULTS: The qRT-PCR results suggested that the PBMC miR-106a levels were decreased in CHB patients. IL-8 was augmented in CHB patients and was inversely correlated with miR-106a levels. The luciferase activity assays indicated that IL-8 is a target of miR-106a. Exogenous expression of miR-106a could significantly repress IL-8 expression at both mRNA and protein levels in PBMCs, whereas miR-106a inhibitor had the opposite effects. CONCLUSIONS: This study suggested that miR-106a is downregulated in PBMCs of CHB patients and that miR-106a may play an important role in CHB by targeting IL-8.
LinkOut: [PMID: 26265888]
|
Experimental Support 5 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293T , Huh7 , MHCC97H |
Location of target site | 3'UTR |
Tools used in this research | miRBase Target Database , TargetScan |
Original Description (Extracted from the article) |
...
"First
... - Liu B; Sun T; Wu G; Shang-Guan H; Jiang ZJ; et al., 2017, American journal of translational research. |
Article |
- Liu B; Sun T; Wu G; Shang-Guan H; Jiang ZJ; et al. - American journal of translational research, 2017
PURPOSE: This study aimed to determine the function of miR-15a in HCC, and identify cMyb as a target of miR-15a. METHODS: RNA expression was evaluated by quantitative real-time PCR (qRT-PCR). The effects of miR-15a or cMyb on HCC cells were evaluated by transwell migration assay and western blot analysis. CMyb, the predicted target, has been frequently verified by luciferase assay. RESULTS: MiR-15a was markedly downregulated in sphere culture HCC cells by qRT-PCR. CMyb was predicted to be a potential target of miR-15a using bioinformatics analysis. This prediction has been frequently verified by luciferase assay and western blot. A positive correlation between cMyb and the migration ability of HCC cells was demonstrated by transwell assays. MiR-15a mimic suppressed cMyb expression to weaken HCC cell migration ability. On the other hand, miR-15a inhibitor upregulated cMyb and induced HCC cell migration. CONCLUSION: MiR-15a could suppress HCC progression through the repression of cMyb, making miR-15a a potential therapeutic target.
LinkOut: [PMID: 28337280]
|
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT000280 | BMI1 | BMI1 proto-oncogene, polycomb ring finger | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 3 | |||
MIRT000282 | WNT3A | Wnt family member 3A | ![]() |
![]() |
![]() |
3 | 2 | |||||
MIRT000283 | MYB | MYB proto-oncogene, transcription factor | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 3 | |||
MIRT000284 | CDC25A | cell division cycle 25A | ![]() |
![]() |
![]() |
![]() |
4 | 4 | ||||
MIRT000285 | CCND2 | cyclin D2 | ![]() |
![]() |
![]() |
![]() |
4 | 7 | ||||
MIRT000804 | RAB9B | RAB9B, member RAS oncogene family | ![]() |
1 | 1 | |||||||
MIRT000806 | ACTR1A | ARP1 actin related protein 1 homolog A | ![]() |
1 | 1 | |||||||
MIRT000808 | TPI1 | triosephosphate isomerase 1 | ![]() |
1 | 1 | |||||||
MIRT000810 | PDCD4 | programmed cell death 4 | ![]() |
![]() |
![]() |
3 | 2 | |||||
MIRT000812 | RAB21 | RAB21, member RAS oncogene family | ![]() |
![]() |
2 | 1 | ||||||
MIRT000815 | BCL2 | BCL2, apoptosis regulator | ![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
6 | 13 | ||
MIRT000817 | WT1 | Wilms tumor 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000819 | ASXL2 | additional sex combs like 2, transcriptional regulator | ![]() |
![]() |
2 | 1 | ||||||
MIRT000823 | TMEM251 | transmembrane protein 251 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000825 | CARD8 | caspase recruitment domain family member 8 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000827 | CDC14B | cell division cycle 14B | ![]() |
![]() |
2 | 1 | ||||||
MIRT000829 | CENPJ | centromere protein J | ![]() |
![]() |
2 | 1 | ||||||
MIRT000831 | CEP63 | centrosomal protein 63 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000833 | CREBL2 | cAMP responsive element binding protein like 2 | ![]() |
![]() |
![]() |
![]() |
4 | 5 | ||||
MIRT000835 | ECHDC1 | ethylmalonyl-CoA decarboxylase 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000847 | GOLGA5 | golgin A5 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000849 | GOLPH3L | golgi phosphoprotein 3 like | ![]() |
![]() |
2 | 1 | ||||||
MIRT000851 | GTF2H1 | general transcription factor IIH subunit 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000853 | H3F3B | H3 histone family member 3B | ![]() |
![]() |
2 | 1 | ||||||
MIRT000855 | HACE1 | HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000857 | HDHD2 | haloacid dehalogenase like hydrolase domain containing 2 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000859 | HERC6 | HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000863 | HRSP12 | reactive intermediate imine deaminase A homolog | ![]() |
![]() |
2 | 1 | ||||||
MIRT000865 | HSDL2 | hydroxysteroid dehydrogenase like 2 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000866 | HSPA1A | heat shock protein family A (Hsp70) member 1A | ![]() |
![]() |
2 | 1 | ||||||
MIRT000868 | JUN | Jun proto-oncogene, AP-1 transcription factor subunit | ![]() |
![]() |
2 | 1 | ||||||
MIRT000878 | MCL1 | MCL1, BCL2 family apoptosis regulator | ![]() |
![]() |
2 | 1 | ||||||
MIRT000880 | MSH2 | mutS homolog 2 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000884 | OMA1 | OMA1 zinc metallopeptidase | ![]() |
![]() |
2 | 1 | ||||||
MIRT000886 | OSGEPL1 | O-sialoglycoprotein endopeptidase like 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000888 | PDCD6IP | programmed cell death 6 interacting protein | ![]() |
![]() |
2 | 1 | ||||||
MIRT000890 | PHKB | phosphorylase kinase regulatory subunit beta | ![]() |
![]() |
2 | 1 | ||||||
MIRT000892 | PMS1 | PMS1 homolog 1, mismatch repair system component | ![]() |
![]() |
2 | 1 | ||||||
MIRT000894 | PNN | pinin, desmosome associated protein | ![]() |
![]() |
2 | 1 | ||||||
MIRT000896 | PRIM1 | DNA primase subunit 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000898 | RAD51C | RAD51 paralog C | ![]() |
![]() |
2 | 1 | ||||||
MIRT000900 | RHOT1 | ras homolog family member T1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000902 | RNASEL | ribonuclease L | ![]() |
![]() |
2 | 1 | ||||||
MIRT000906 | SLC35A1 | solute carrier family 35 member A1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000908 | SLC35B3 | solute carrier family 35 member B3 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000910 | TIA1 | TIA1 cytotoxic granule associated RNA binding protein | ![]() |
![]() |
2 | 1 | ||||||
MIRT000914 | UGDH | UDP-glucose 6-dehydrogenase | ![]() |
![]() |
2 | 1 | ||||||
MIRT000916 | UGP2 | UDP-glucose pyrophosphorylase 2 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000922 | ZNF559 | zinc finger protein 559 | ![]() |
![]() |
2 | 1 | ||||||
MIRT001227 | CCND1 | cyclin D1 | ![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
6 | 8 | ||
MIRT001228 | CCNE1 | cyclin E1 | ![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
7 | 10 | |
MIRT001802 | BACE1 | beta-secretase 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT002946 | DMTF1 | cyclin D binding myb like transcription factor 1 | ![]() |
![]() |
![]() |
![]() |
4 | 4 | ||||
MIRT003330 | RPS6 | ribosomal protein S6 | 0 | 1 | ||||||||
MIRT003333 | BRCA1 | BRCA1, DNA repair associated | ![]() |
![]() |
2 | 2 | ||||||
MIRT003334 | AKT3 | AKT serine/threonine kinase 3 | ![]() |
![]() |
![]() |
3 | 6 | |||||
MIRT003872 | WIPF1 | WAS/WASL interacting protein family member 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT003873 | VPS45 | vacuolar protein sorting 45 homolog | ![]() |
![]() |
2 | 1 | ||||||
MIRT003874 | HSP90B1 | heat shock protein 90 beta family member 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT003875 | SKAP2 | src kinase associated phosphoprotein 2 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003876 | NT5DC1 | 5'-nucleotidase domain containing 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT003877 | FAM69A | family with sequence similarity 69 member A | ![]() |
![]() |
2 | 1 | ||||||
MIRT003878 | C2orf74 | chromosome 2 open reading frame 74 | ![]() |
1 | 1 | |||||||
MIRT003879 | FAM122C | family with sequence similarity 122C | ![]() |
![]() |
2 | 1 | ||||||
MIRT003880 | PWWP2A | PWWP domain containing 2A | ![]() |
![]() |
2 | 1 | ||||||
MIRT003881 | C17orf80 | chromosome 17 open reading frame 80 | ![]() |
![]() |
2 | 1 | ||||||
MIRT003882 | CCDC111 | primase and DNA directed polymerase | ![]() |
![]() |
2 | 1 | ||||||
MIRT003883 | C2orf43 | lipid droplet associated hydrolase | ![]() |
![]() |
2 | 1 | ||||||
MIRT003884 | C4orf27 | histone PARylation factor 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT003885 | NIPAL2 | NIPA like domain containing 2 | ![]() |
![]() |
2 | 1 | ||||||
MIRT003886 | TRMT13 | tRNA methyltransferase 13 homolog | ![]() |
![]() |
2 | 1 | ||||||
MIRT003887 | ANAPC16 | anaphase promoting complex subunit 16 | ![]() |
![]() |
2 | 1 | ||||||
MIRT003888 | CADM1 | cell adhesion molecule 1 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003891 | TMEM184B | transmembrane protein 184B | ![]() |
![]() |
2 | 1 | ||||||
MIRT003899 | APP | amyloid beta precursor protein | ![]() |
![]() |
![]() |
![]() |
4 | 3 | ||||
MIRT004046 | UCP2 | uncoupling protein 2 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT004275 | VEGFA | vascular endothelial growth factor A | ![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
7 | 17 | |
MIRT004680 | TSPYL2 | TSPY like 2 | ![]() |
![]() |
2 | 1 | ||||||
MIRT004829 | NFKB1 | nuclear factor kappa B subunit 1 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT005552 | CHUK | conserved helix-loop-helix ubiquitous kinase | ![]() |
![]() |
![]() |
![]() |
4 | 1 | ||||
MIRT005763 | TP53 | tumor protein p53 | ![]() |
1 | 1 | |||||||
MIRT006027 | FGF7 | fibroblast growth factor 7 | ![]() |
![]() |
2 | 1 | ||||||
MIRT006176 | CLCN3 | chloride voltage-gated channel 3 | ![]() |
![]() |
![]() |
![]() |
4 | 1 | ||||
MIRT006177 | CRKL | CRK like proto-oncogene, adaptor protein | ![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
6 | 3 | ||
MIRT006181 | MN1 | MN1 proto-oncogene, transcriptional regulator | ![]() |
![]() |
![]() |
![]() |
4 | 1 | ||||
MIRT006658 | Ccnd1 | cyclin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT006801 | HMGA1 | high mobility group AT-hook 1 | ![]() |
![]() |
![]() |
![]() |
4 | 2 | ||||
MIRT006805 | HMGA2 | high mobility group AT-hook 2 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT006913 | IFNG | interferon gamma | ![]() |
![]() |
2 | 1 | ||||||
MIRT006998 | PURA | purine rich element binding protein A | ![]() |
![]() |
2 | 2 | ||||||
MIRT007090 | RECK | reversion inducing cysteine rich protein with kazal motifs | ![]() |
![]() |
![]() |
![]() |
4 | 3 | ||||
MIRT032077 | DLK1 | delta like non-canonical Notch ligand 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT051311 | PLA2G2D | phospholipase A2 group IID | ![]() |
1 | 1 | |||||||
MIRT051312 | ACVR1B | activin A receptor type 1B | ![]() |
1 | 1 | |||||||
MIRT051313 | IKBKG | inhibitor of nuclear factor kappa B kinase subunit gamma | ![]() |
1 | 1 | |||||||
MIRT051314 | GCLM | glutamate-cysteine ligase modifier subunit | ![]() |
1 | 1 | |||||||
MIRT051315 | PCF11 | PCF11 cleavage and polyadenylation factor subunit | ![]() |
1 | 1 | |||||||
MIRT051316 | HIST1H2BK | histone cluster 1 H2B family member k | ![]() |
1 | 1 | |||||||
MIRT051317 | ODC1 | ornithine decarboxylase 1 | ![]() |
1 | 1 | |||||||
MIRT051318 | CALD1 | caldesmon 1 | ![]() |
1 | 1 | |||||||
MIRT051319 | RPP30 | ribonuclease P/MRP subunit p30 | ![]() |
1 | 1 | |||||||
MIRT051320 | ASNSD1 | asparagine synthetase domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT051321 | CCNYL1 | cyclin Y like 1 | ![]() |
1 | 1 | |||||||
MIRT051322 | RGPD5 | RANBP2-like and GRIP domain containing 5 | ![]() |
1 | 1 | |||||||
MIRT051323 | PREB | prolactin regulatory element binding | ![]() |
1 | 1 | |||||||
MIRT051324 | PDHX | pyruvate dehydrogenase complex component X | ![]() |
1 | 1 | |||||||
MIRT051325 | SNX6 | sorting nexin 6 | ![]() |
1 | 1 | |||||||
MIRT051326 | CNN3 | calponin 3 | ![]() |
1 | 1 | |||||||
MIRT051327 | KIF1A | kinesin family member 1A | ![]() |
1 | 1 | |||||||
MIRT051328 | NAB1 | NGFI-A binding protein 1 | ![]() |
1 | 1 | |||||||
MIRT051329 | CCT6B | chaperonin containing TCP1 subunit 6B | ![]() |
1 | 1 | |||||||
MIRT051330 | CHD4 | chromodomain helicase DNA binding protein 4 | ![]() |
1 | 1 | |||||||
MIRT051331 | CLCC1 | chloride channel CLIC like 1 | ![]() |
1 | 1 | |||||||
MIRT051332 | GDI2 | GDP dissociation inhibitor 2 | ![]() |
1 | 1 | |||||||
MIRT051333 | BRWD1 | bromodomain and WD repeat domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT051334 | MAPK6 | mitogen-activated protein kinase 6 | ![]() |
1 | 1 | |||||||
MIRT051335 | PSMC4 | proteasome 26S subunit, ATPase 4 | ![]() |
1 | 1 | |||||||
MIRT051336 | ATF2 | activating transcription factor 2 | ![]() |
1 | 1 | |||||||
MIRT051337 | ATP6AP1 | ATPase H+ transporting accessory protein 1 | ![]() |
1 | 1 | |||||||
MIRT051338 | FBXO3 | F-box protein 3 | ![]() |
1 | 1 | |||||||
MIRT051339 | PRDX3 | peroxiredoxin 3 | ![]() |
1 | 1 | |||||||
MIRT051340 | CABIN1 | calcineurin binding protein 1 | ![]() |
1 | 1 | |||||||
MIRT051341 | FASN | fatty acid synthase | ![]() |
![]() |
2 | 5 | ||||||
MIRT051342 | SEC63 | SEC63 homolog, protein translocation regulator | ![]() |
1 | 1 | |||||||
MIRT051343 | PTAR1 | protein prenyltransferase alpha subunit repeat containing 1 | ![]() |
1 | 1 | |||||||
MIRT051344 | DSTYK | dual serine/threonine and tyrosine protein kinase | ![]() |
1 | 1 | |||||||
MIRT051345 | FOXO1 | forkhead box O1 | ![]() |
![]() |
![]() |
![]() |
4 | 2 | ||||
MIRT051346 | TMEM214 | transmembrane protein 214 | ![]() |
1 | 1 | |||||||
MIRT051347 | TRIM28 | tripartite motif containing 28 | ![]() |
1 | 1 | |||||||
MIRT051348 | NOP2 | NOP2 nucleolar protein | ![]() |
1 | 1 | |||||||
MIRT051349 | MYBL1 | MYB proto-oncogene like 1 | ![]() |
1 | 1 | |||||||
MIRT051350 | TTC1 | tetratricopeptide repeat domain 1 | ![]() |
1 | 1 | |||||||
MIRT051351 | BTRC | beta-transducin repeat containing E3 ubiquitin protein ligase | ![]() |
1 | 2 | |||||||
MIRT052930 | REPIN1 | replication initiator 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT053079 | KLF4 | Kruppel like factor 4 | ![]() |
![]() |
2 | 1 | ||||||
MIRT054283 | YAP1 | Yes associated protein 1 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT054424 | CARM1 | coactivator associated arginine methyltransferase 1 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT054895 | SOX5 | SRY-box 5 | ![]() |
![]() |
2 | 1 | ||||||
MIRT055421 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | ![]() |
![]() |
2 | 11 | ||||||
MIRT055811 | PLEKHA1 | pleckstrin homology domain containing A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT057514 | CEP55 | centrosomal protein 55 | ![]() |
![]() |
2 | 8 | ||||||
MIRT057729 | ZDHHC16 | zinc finger DHHC-type containing 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT057906 | STXBP3 | syntaxin binding protein 3 | ![]() |
1 | 1 | |||||||
MIRT061005 | C1ORF21 | chromosome 1 open reading frame 21 | ![]() |
![]() |
2 | 6 | ||||||
MIRT061244 | AMOTL1 | angiomotin like 1 | ![]() |
![]() |
2 | 12 | ||||||
MIRT061529 | BTG2 | BTG anti-proliferation factor 2 | ![]() |
1 | 1 | |||||||
MIRT063394 | ETNK1 | ethanolamine kinase 1 | ![]() |
1 | 1 | |||||||
MIRT065711 | TARBP2 | TARBP2, RISC loading complex RNA binding subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT066291 | MTFR1L | mitochondrial fission regulator 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT066312 | USP15 | ubiquitin specific peptidase 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT068655 | AKAP11 | A-kinase anchoring protein 11 | ![]() |
1 | 1 | |||||||
MIRT071206 | FCF1 | FCF1, rRNA-processing protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT072822 | ARIH1 | ariadne RBR E3 ubiquitin protein ligase 1 | ![]() |
![]() |
2 | 5 | ||||||
MIRT074530 | PAGR1 | PAXIP1 associated glutamate rich protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT075249 | SNTB2 | syntrophin beta 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT075273 | VPS4A | vacuolar protein sorting 4 homolog A | ![]() |
![]() |
2 | 8 | ||||||
MIRT075891 | C16ORF72 | chromosome 16 open reading frame 72 | ![]() |
![]() |
2 | 7 | ||||||
MIRT076791 | GOSR1 | golgi SNAP receptor complex member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT077781 | MINK1 | misshapen like kinase 1 | ![]() |
1 | 1 | |||||||
MIRT078282 | RPS6KB1 | ribosomal protein S6 kinase B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT079655 | NAPG | NSF attachment protein gamma | ![]() |
![]() |
2 | 12 | ||||||
MIRT080011 | GALNT1 | polypeptide N-acetylgalactosaminyltransferase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT082985 | PNPLA6 | patatin like phospholipase domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT083265 | ZCCHC3 | zinc finger CCHC-type containing 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT084462 | SOWAHC | sosondowah ankyrin repeat domain family member C | ![]() |
![]() |
2 | 4 | ||||||
MIRT085215 | CCNT2 | cyclin T2 | ![]() |
1 | 1 | |||||||
MIRT086005 | UBR3 | ubiquitin protein ligase E3 component n-recognin 3 (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT087424 | ZNRF3 | zinc and ring finger 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT087554 | YWHAH | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta | ![]() |
![]() |
2 | 2 | ||||||
MIRT088102 | SEPT2 | septin 2 | ![]() |
1 | 1 | |||||||
MIRT089105 | B3GNT2 | UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT089206 | ACTR2 | ARP2 actin related protein 2 homolog | ![]() |
![]() |
2 | 3 | ||||||
MIRT090446 | CDV3 | CDV3 homolog | ![]() |
1 | 1 | |||||||
MIRT090688 | U2SURP | U2 snRNP associated SURP domain containing | ![]() |
1 | 1 | |||||||
MIRT091667 | RARB | retinoic acid receptor beta | ![]() |
![]() |
2 | 6 | ||||||
MIRT092190 | ITPR1 | inositol 1,4,5-trisphosphate receptor type 1 | ![]() |
1 | 1 | |||||||
MIRT092209 | BHLHE40 | basic helix-loop-helix family member e40 | ![]() |
1 | 1 | |||||||
MIRT093682 | PI4K2B | phosphatidylinositol 4-kinase type 2 beta | ![]() |
![]() |
2 | 6 | ||||||
MIRT096234 | CANX | calnexin | ![]() |
![]() |
2 | 2 | ||||||
MIRT098827 | PCMT1 | protein-L-isoaspartate (D-aspartate) O-methyltransferase | ![]() |
1 | 1 | |||||||
MIRT099631 | E2F3 | E2F transcription factor 3 | ![]() |
1 | 1 | |||||||
MIRT100207 | PPP1R11 | protein phosphatase 1 regulatory inhibitor subunit 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT100364 | HSPA1B | heat shock protein family A (Hsp70) member 1B | ![]() |
![]() |
![]() |
3 | 8 | |||||
MIRT100566 | PIM1 | Pim-1 proto-oncogene, serine/threonine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT100896 | CD2AP | CD2 associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT102434 | CALU | calumenin | ![]() |
![]() |
2 | 3 | ||||||
MIRT102632 | UBN2 | ubinuclein 2 | ![]() |
![]() |
2 | 11 | ||||||
MIRT102971 | EN2 | engrailed homeobox 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT103092 | MAFK | MAF bZIP transcription factor K | ![]() |
![]() |
2 | 5 | ||||||
MIRT103856 | FOXK1 | forkhead box K1 | ![]() |
![]() |
2 | 3 | ||||||
MIRT104015 | USP42 | ubiquitin specific peptidase 42 | ![]() |
![]() |
2 | 6 | ||||||
MIRT106292 | ZFHX4 | zinc finger homeobox 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT106733 | RAD23B | RAD23 homolog B, nucleotide excision repair protein | ![]() |
![]() |
2 | 3 | ||||||
MIRT107218 | ZBTB34 | zinc finger and BTB domain containing 34 | ![]() |
![]() |
2 | 2 | ||||||
MIRT108983 | SLC9A6 | solute carrier family 9 member A6 | ![]() |
1 | 1 | |||||||
MIRT109240 | ZNF275 | zinc finger protein 275 | ![]() |
![]() |
2 | 2 | ||||||
MIRT110051 | OGT | O-linked N-acetylglucosamine (GlcNAc) transferase | ![]() |
![]() |
2 | 7 | ||||||
MIRT112969 | LUZP1 | leucine zipper protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT114923 | CHAC1 | ChaC glutathione specific gamma-glutamylcyclotransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT117655 | SCAMP4 | secretory carrier membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT120680 | PAK2 | p21 (RAC1) activated kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT127725 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | ![]() |
![]() |
2 | 3 | ||||||
MIRT128798 | UBE4A | ubiquitination factor E4A | ![]() |
1 | 1 | |||||||
MIRT129055 | ARCN1 | archain 1 | ![]() |
1 | 1 | |||||||
MIRT130380 | PTPRJ | protein tyrosine phosphatase, receptor type J | ![]() |
1 | 1 | |||||||
MIRT131097 | TMEM138 | transmembrane protein 138 | ![]() |
1 | 1 | |||||||
MIRT132734 | RASSF5 | Ras association domain family member 5 | ![]() |
1 | 1 | |||||||
MIRT132831 | MAPKAPK2 | mitogen-activated protein kinase-activated protein kinase 2 | ![]() |
1 | 1 | |||||||
MIRT133334 | BCL7A | BCL tumor suppressor 7A | ![]() |
1 | 1 | |||||||
MIRT133769 | SKI | SKI proto-oncogene | ![]() |
![]() |
2 | 3 | ||||||
MIRT137517 | RCOR1 | REST corepressor 1 | ![]() |
1 | 1 | |||||||
MIRT140146 | SPRED1 | sprouty related EVH1 domain containing 1 | ![]() |
![]() |
2 | 3 | ||||||
MIRT140820 | SMAD3 | SMAD family member 3 | ![]() |
1 | 1 | |||||||
MIRT141243 | SCAMP5 | secretory carrier membrane protein 5 | ![]() |
1 | 1 | |||||||
MIRT141279 | UBE2Q2 | ubiquitin conjugating enzyme E2 Q2 | ![]() |
1 | 1 | |||||||
MIRT142237 | DCTN5 | dynactin subunit 5 | ![]() |
![]() |
2 | 9 | ||||||
MIRT144019 | PSKH1 | protein serine kinase H1 | ![]() |
1 | 1 | |||||||
MIRT145377 | ANKRD13B | ankyrin repeat domain 13B | ![]() |
1 | 1 | |||||||
MIRT146014 | EZH1 | enhancer of zeste 1 polycomb repressive complex 2 subunit | ![]() |
1 | 1 | |||||||
MIRT146351 | PNPO | pyridoxamine 5'-phosphate oxidase | ![]() |
1 | 1 | |||||||
MIRT146496 | SNX11 | sorting nexin 11 | ![]() |
1 | 1 | |||||||
MIRT148302 | RNF138 | ring finger protein 138 | ![]() |
1 | 1 | |||||||
MIRT150354 | IER2 | immediate early response 2 | ![]() |
1 | 1 | |||||||
MIRT152274 | TNFSF9 | TNF superfamily member 9 | ![]() |
![]() |
2 | 3 | ||||||
MIRT152503 | ENTPD6 | ectonucleoside triphosphate diphosphohydrolase 6 (putative) | ![]() |
1 | 1 | |||||||
MIRT152736 | KIF3B | kinesin family member 3B | ![]() |
1 | 1 | |||||||
MIRT152922 | NOL4L | nucleolar protein 4 like | ![]() |
![]() |
2 | 3 | ||||||
MIRT154043 | RASSF2 | Ras association domain family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT154392 | CDS2 | CDP-diacylglycerol synthase 2 | ![]() |
1 | 1 | |||||||
MIRT156452 | ATP5G3 | ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) | ![]() |
![]() |
2 | 2 | ||||||
MIRT158519 | TNRC6B | trinucleotide repeat containing 6B | ![]() |
![]() |
2 | 5 | ||||||
MIRT158990 | EPT1 | selenoprotein I | ![]() |
1 | 1 | |||||||
MIRT159580 | PEX13 | peroxisomal biogenesis factor 13 | ![]() |
1 | 1 | |||||||
MIRT160169 | TET3 | tet methylcytosine dioxygenase 3 | ![]() |
1 | 1 | |||||||
MIRT163253 | PRKCD | protein kinase C delta | ![]() |
1 | 1 | |||||||
MIRT164260 | CPEB2 | cytoplasmic polyadenylation element binding protein 2 | ![]() |
1 | 1 | |||||||
MIRT164952 | TADA2B | transcriptional adaptor 2B | ![]() |
1 | 1 | |||||||
MIRT165172 | GRAMD3 | GRAM domain containing 2B | ![]() |
![]() |
2 | 3 | ||||||
MIRT165883 | CREBRF | CREB3 regulatory factor | ![]() |
![]() |
2 | 3 | ||||||
MIRT168680 | CDKN1A | cyclin dependent kinase inhibitor 1A | ![]() |
1 | 1 | |||||||
MIRT169058 | IRF4 | interferon regulatory factor 4 | ![]() |
1 | 1 | |||||||
MIRT170136 | KLHDC10 | kelch domain containing 10 | ![]() |
1 | 1 | |||||||
MIRT170733 | UBE3C | ubiquitin protein ligase E3C | ![]() |
1 | 1 | |||||||
MIRT171597 | SUN1 | Sad1 and UNC84 domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT172813 | HMBOX1 | homeobox containing 1 | ![]() |
1 | 1 | |||||||
MIRT174781 | RNF38 | ring finger protein 38 | ![]() |
1 | 1 | |||||||
MIRT175232 | PSAT1 | phosphoserine aminotransferase 1 | ![]() |
![]() |
2 | 7 | ||||||
MIRT175524 | ZBTB33 | zinc finger and BTB domain containing 33 | ![]() |
1 | 1 | |||||||
MIRT179008 | PAFAH1B2 | platelet activating factor acetylhydrolase 1b catalytic subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT180909 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT186371 | PNRC2 | proline rich nuclear receptor coactivator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT189760 | CDADC1 | cytidine and dCMP deaminase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT189961 | AGO4 | argonaute 4, RISC catalytic component | ![]() |
![]() |
2 | 2 | ||||||
MIRT190184 | GPR180 | G protein-coupled receptor 180 | ![]() |
![]() |
2 | 6 | ||||||
MIRT191454 | PPM1A | protein phosphatase, Mg2+/Mn2+ dependent 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT191625 | SLC39A9 | solute carrier family 39 member 9 | ![]() |
![]() |
2 | 6 | ||||||
MIRT194237 | FAM103A1 | family with sequence similarity 103 member A1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT194903 | RBBP6 | RB binding protein 6, ubiquitin ligase | ![]() |
![]() |
2 | 8 | ||||||
MIRT196275 | PAFAH1B1 | platelet activating factor acetylhydrolase 1b regulatory subunit 1 | ![]() |
1 | 1 | |||||||
MIRT196450 | TAOK1 | TAO kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT201456 | SNRPB2 | small nuclear ribonucleoprotein polypeptide B2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT204592 | HSPE1-MOB4 | HSPE1-MOB4 readthrough | ![]() |
![]() |
2 | 8 | ||||||
MIRT204623 | MOB4 | MOB family member 4, phocein | ![]() |
![]() |
2 | 8 | ||||||
MIRT204741 | BZW1 | basic leucine zipper and W2 domains 1 | ![]() |
![]() |
2 | 12 | ||||||
MIRT206020 | NUP50 | nucleoporin 50 | ![]() |
![]() |
2 | 7 | ||||||
MIRT211199 | FGF2 | fibroblast growth factor 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT211314 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | ![]() |
![]() |
2 | 4 | ||||||
MIRT212604 | RBPJ | recombination signal binding protein for immunoglobulin kappa J region | ![]() |
![]() |
2 | 8 | ||||||
MIRT217743 | TBPL1 | TATA-box binding protein like 1 | ![]() |
![]() |
2 | 3 | ||||||
MIRT223681 | FZD6 | frizzled class receptor 6 | ![]() |
![]() |
2 | 6 | ||||||
MIRT224965 | BAG4 | BCL2 associated athanogene 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT229343 | ZNF449 | zinc finger protein 449 | ![]() |
![]() |
2 | 2 | ||||||
MIRT229860 | YIPF6 | Yip1 domain family member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT230120 | DDX3Y | DEAD-box helicase 3, Y-linked | ![]() |
1 | 1 | |||||||
MIRT234342 | MSL1 | male specific lethal 1 homolog | ![]() |
![]() |
2 | 8 | ||||||
MIRT245003 | ENTPD7 | ectonucleoside triphosphate diphosphohydrolase 7 | ![]() |
1 | 1 | |||||||
MIRT246938 | PRRC2C | proline rich coiled-coil 2C | ![]() |
1 | 1 | |||||||
MIRT247095 | WEE1 | WEE1 G2 checkpoint kinase | ![]() |
![]() |
2 | 4 | ||||||
MIRT247236 | ELK4 | ELK4, ETS transcription factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT247368 | GABARAPL1 | GABA type A receptor associated protein like 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT248550 | PDIK1L | PDLIM1 interacting kinase 1 like | ![]() |
1 | 1 | |||||||
MIRT248765 | ATXN7L3B | ataxin 7 like 3B | ![]() |
![]() |
2 | 4 | ||||||
MIRT249449 | ZNF691 | zinc finger protein 691 | ![]() |
![]() |
2 | 4 | ||||||
MIRT251487 | DYNLL2 | dynein light chain LC8-type 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT255333 | SRPRB | SRP receptor beta subunit | ![]() |
![]() |
2 | 5 | ||||||
MIRT256305 | CDC42SE2 | CDC42 small effector 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT258410 | WIPI2 | WD repeat domain, phosphoinositide interacting 2 | ![]() |
![]() |
2 | 3 | ||||||
MIRT265056 | TBRG1 | transforming growth factor beta regulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT265076 | CHEK1 | checkpoint kinase 1 | ![]() |
![]() |
2 | 3 | ||||||
MIRT267254 | TMEM109 | transmembrane protein 109 | ![]() |
1 | 1 | |||||||
MIRT267527 | C1ORF226 | chromosome 1 open reading frame 226 | ![]() |
![]() |
2 | 2 | ||||||
MIRT270454 | SIRT4 | sirtuin 4 | ![]() |
1 | 1 | |||||||
MIRT270552 | SETD1B | SET domain containing 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT273665 | HOXC8 | homeobox C8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT274741 | RAB3IP | RAB3A interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT277504 | PPP2R5C | protein phosphatase 2 regulatory subunit B'gamma | ![]() |
![]() |
2 | 4 | ||||||
MIRT282532 | SLCO3A1 | solute carrier organic anion transporter family member 3A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT286968 | MLLT6 | MLLT6, PHD finger containing | ![]() |
1 | 1 | |||||||
MIRT289625 | CBX2 | chromobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT294283 | ZFP28 | ZFP28 zinc finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT295810 | CHMP4B | charged multivesicular body protein 4B | ![]() |
![]() |
2 | 2 | ||||||
MIRT297778 | GABPA | GA binding protein transcription factor alpha subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT300100 | STRADB | STE20-related kinase adaptor beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT300992 | MTMR3 | myotubularin related protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT302611 | CRIM1 | cysteine rich transmembrane BMP regulator 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT302825 | SOCS5 | suppressor of cytokine signaling 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT307141 | CTDSPL | CTD small phosphatase like | ![]() |
![]() |
2 | 4 | ||||||
MIRT313675 | ITGA2 | integrin subunit alpha 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT314051 | PIK3R1 | phosphoinositide-3-kinase regulatory subunit 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT317722 | PPIL1 | peptidylprolyl isomerase like 1 | ![]() |
![]() |
2 | 7 | ||||||
MIRT319331 | CAPZA2 | capping actin protein of muscle Z-line alpha subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT320626 | ZNRF2 | zinc and ring finger 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT324839 | IFT74 | intraflagellar transport 74 | ![]() |
1 | 1 | |||||||
MIRT326301 | OCRL | OCRL, inositol polyphosphate-5-phosphatase | ![]() |
![]() |
2 | 2 | ||||||
MIRT327962 | CHIC1 | cysteine rich hydrophobic domain 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT437998 | KLF6 | Kruppel like factor 6 | ![]() |
![]() |
2 | 1 | ||||||
MIRT438163 | PHLPP1 | PH domain and leucine rich repeat protein phosphatase 1 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT438610 | RET | ret proto-oncogene | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT443809 | SIDT2 | SID1 transmembrane family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446508 | ASCC1 | activating signal cointegrator 1 complex subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447778 | DMRT2 | doublesex and mab-3 related transcription factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448440 | TLL1 | tolloid like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449190 | LUC7L3 | LUC7 like 3 pre-mRNA splicing factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT451839 | ALDH3B1 | aldehyde dehydrogenase 3 family member B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453288 | EFTUD2 | elongation factor Tu GTP binding domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453754 | CSNK1E | casein kinase 1 epsilon | ![]() |
![]() |
2 | 2 | ||||||
MIRT454970 | TPM2 | tropomyosin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456867 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 10 | ||||||
MIRT460224 | FGFR4 | fibroblast growth factor receptor 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460438 | DOCK11 | dedicator of cytokinesis 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461564 | ACTR3B | ARP3 actin related protein 3 homolog B | ![]() |
![]() |
2 | 2 | ||||||
MIRT463167 | ZNF367 | zinc finger protein 367 | ![]() |
![]() |
2 | 10 | ||||||
MIRT464668 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT464751 | UBE2Q1 | ubiquitin conjugating enzyme E2 Q1 | ![]() |
![]() |
2 | 3 | ||||||
MIRT465165 | TSC22D2 | TSC22 domain family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465570 | TOB2 | transducer of ERBB2, 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465926 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | ![]() |
![]() |
2 | 8 | ||||||
MIRT466008 | TMEM189 | transmembrane protein 189 | ![]() |
![]() |
2 | 8 | ||||||
MIRT466298 | TM4SF1 | transmembrane 4 L six family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466436 | TFAP2A | transcription factor AP-2 alpha | ![]() |
![]() |
2 | 8 | ||||||
MIRT466917 | STK38 | serine/threonine kinase 38 | ![]() |
![]() |
2 | 10 | ||||||
MIRT467002 | SSRP1 | structure specific recognition protein 1 | ![]() |
![]() |
2 | 5 | ||||||
MIRT468052 | SIK1 | salt inducible kinase 1 | ![]() |
![]() |
2 | 3 | ||||||
MIRT468151 | SH3BP4 | SH3 domain binding protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468676 | SEC24A | SEC24 homolog A, COPII coat complex component | ![]() |
![]() |
2 | 4 | ||||||
MIRT469090 | RNF168 | ring finger protein 168 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469415 | REL | REL proto-oncogene, NF-kB subunit | ![]() |
![]() |
2 | 6 | ||||||
MIRT471038 | PISD | phosphatidylserine decarboxylase | ![]() |
![]() |
2 | 10 | ||||||
MIRT471495 | PDE4D | phosphodiesterase 4D | ![]() |
![]() |
2 | 4 | ||||||
MIRT471956 | NR6A1 | nuclear receptor subfamily 6 group A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472263 | NFIC | nuclear factor I C | ![]() |
![]() |
2 | 2 | ||||||
MIRT472665 | NAA25 | N(alpha)-acetyltransferase 25, NatB auxiliary subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT474318 | LAMC1 | laminin subunit gamma 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474828 | KIAA0226 | RUN and cysteine rich domain containing beclin 1 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT475068 | IVNS1ABP | influenza virus NS1A binding protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT475123 | IPPK | inositol-pentakisphosphate 2-kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT475539 | HOXA3 | homeobox A3 | ![]() |
![]() |
2 | 8 | ||||||
MIRT475720 | HEYL | hes related family bHLH transcription factor with YRPW motif-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT475843 | HDGF | heparin binding growth factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT476259 | GNB1 | G protein subunit beta 1 | ![]() |
![]() |
2 | 7 | ||||||
MIRT476276 | GNAL | G protein subunit alpha L | ![]() |
![]() |
2 | 6 | ||||||
MIRT476698 | FURIN | furin, paired basic amino acid cleaving enzyme | ![]() |
![]() |
2 | 2 | ||||||
MIRT477565 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | ![]() |
![]() |
2 | 8 | ||||||
MIRT477849 | DYRK3 | dual specificity tyrosine phosphorylation regulated kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478911 | CPSF7 | cleavage and polyadenylation specific factor 7 | ![]() |
![]() |
2 | 6 | ||||||
MIRT479457 | CDK6 | cyclin dependent kinase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479988 | CARD10 | caspase recruitment domain family member 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT481181 | AVL9 | AVL9 cell migration associated | ![]() |
![]() |
2 | 6 | ||||||
MIRT482370 | AGO2 | argonaute 2, RISC catalytic component | ![]() |
![]() |
2 | 2 | ||||||
MIRT482556 | ABL2 | ABL proto-oncogene 2, non-receptor tyrosine kinase | ![]() |
![]() |
2 | 10 | ||||||
MIRT482581 | ABHD2 | abhydrolase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484778 | ABCC6 | ATP binding cassette subfamily C member 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT485215 | PRKAR2A | protein kinase cAMP-dependent type II regulatory subunit alpha | ![]() |
![]() |
2 | 8 | ||||||
MIRT487394 | C10orf54 | V-set immunoregulatory receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT492715 | PHYHIP | phytanoyl-CoA 2-hydroxylase interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT494354 | CASKIN1 | CASK interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495146 | ZNRF1 | zinc and ring finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496019 | CD180 | CD180 molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT497776 | KIAA0895 | KIAA0895 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498984 | ORC4 | origin recognition complex subunit 4 | ![]() |
![]() |
2 | 8 | ||||||
MIRT499456 | ODF2L | outer dense fiber of sperm tails 2 like | ![]() |
![]() |
2 | 8 | ||||||
MIRT499619 | DNAJA1 | DnaJ heat shock protein family (Hsp40) member A1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT500097 | L2HGDH | L-2-hydroxyglutarate dehydrogenase | ![]() |
![]() |
2 | 8 | ||||||
MIRT500321 | ZNF622 | zinc finger protein 622 | ![]() |
![]() |
2 | 9 | ||||||
MIRT500425 | ZMAT3 | zinc finger matrin-type 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT500580 | USP53 | ubiquitin specific peptidase 53 | ![]() |
![]() |
2 | 2 | ||||||
MIRT500860 | SYPL1 | synaptophysin like 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT500936 | SRPR | SRP receptor alpha subunit | ![]() |
![]() |
2 | 7 | ||||||
MIRT500953 | SREK1 | splicing regulatory glutamic acid and lysine rich protein 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT501089 | SMAD7 | SMAD family member 7 | ![]() |
![]() |
2 | 8 | ||||||
MIRT501506 | PRICKLE2 | prickle planar cell polarity protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT502038 | LRIG2 | leucine rich repeats and immunoglobulin like domains 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT502151 | KIF5B | kinesin family member 5B | ![]() |
![]() |
2 | 9 | ||||||
MIRT502496 | FAM122B | family with sequence similarity 122B | ![]() |
![]() |
2 | 8 | ||||||
MIRT502570 | E2F7 | E2F transcription factor 7 | ![]() |
![]() |
2 | 11 | ||||||
MIRT502643 | DDX3X | DEAD-box helicase 3, X-linked | ![]() |
![]() |
2 | 8 | ||||||
MIRT502922 | CDCA4 | cell division cycle associated 4 | ![]() |
![]() |
![]() |
![]() |
4 | 9 | ||||
MIRT502950 | CDC37L1 | cell division cycle 37 like 1 | ![]() |
![]() |
2 | 9 | ||||||
MIRT503140 | ATG9A | autophagy related 9A | ![]() |
![]() |
2 | 7 | ||||||
MIRT504338 | ASGR2 | asialoglycoprotein receptor 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT504540 | ZNF620 | zinc finger protein 620 | ![]() |
![]() |
2 | 6 | ||||||
MIRT504855 | HAUS3 | HAUS augmin like complex subunit 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT505116 | YTHDC1 | YTH domain containing 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT505349 | TMEM245 | transmembrane protein 245 | ![]() |
![]() |
2 | 6 | ||||||
MIRT505398 | TMEM100 | transmembrane protein 100 | ![]() |
![]() |
2 | 2 | ||||||
MIRT505505 | SRSF1 | serine and arginine rich splicing factor 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT505549 | SNX16 | sorting nexin 16 | ![]() |
![]() |
2 | 6 | ||||||
MIRT505686 | SESTD1 | SEC14 and spectrin domain containing 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT505911 | RIMS3 | regulating synaptic membrane exocytosis 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT505930 | RCAN3 | RCAN family member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506112 | PPIG | peptidylprolyl isomerase G | ![]() |
![]() |
2 | 6 | ||||||
MIRT506138 | PLRG1 | pleiotropic regulator 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506166 | PLAG1 | PLAG1 zinc finger | ![]() |
![]() |
2 | 9 | ||||||
MIRT506194 | PHKA1 | phosphorylase kinase regulatory subunit alpha 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT506487 | MYO5A | myosin VA | ![]() |
![]() |
2 | 7 | ||||||
MIRT506854 | KIF23 | kinesin family member 23 | ![]() |
![]() |
2 | 7 | ||||||
MIRT507002 | HNRNPDL | heterogeneous nuclear ribonucleoprotein D like | ![]() |
![]() |
2 | 6 | ||||||
MIRT507820 | CDK1 | cyclin dependent kinase 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT507853 | CCNE2 | cyclin E2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT507877 | CBX6 | chromobox 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT508041 | AXIN2 | axin 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT508644 | CASK | calcium/calmodulin dependent serine protein kinase | ![]() |
![]() |
2 | 5 | ||||||
MIRT509368 | DMPK | DM1 protein kinase | ![]() |
![]() |
2 | 11 | ||||||
MIRT509693 | ATAD5 | ATPase family, AAA domain containing 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT510047 | AKR1B10 | aldo-keto reductase family 1 member B10 | ![]() |
![]() |
2 | 4 | ||||||
MIRT511847 | GPATCH8 | G-patch domain containing 8 | ![]() |
![]() |
2 | 5 | ||||||
MIRT512288 | ARHGDIA | Rho GDP dissociation inhibitor alpha | ![]() |
![]() |
2 | 7 | ||||||
MIRT512646 | CPEB3 | cytoplasmic polyadenylation element binding protein 3 | ![]() |
![]() |
2 | 5 | ||||||
MIRT513854 | JARID2 | jumonji and AT-rich interaction domain containing 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT514020 | CAMSAP1 | calmodulin regulated spectrin associated protein 1 | ![]() |
![]() |
2 | 5 | ||||||
MIRT514042 | ATG14 | autophagy related 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518095 | TRIM35 | tripartite motif containing 35 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518533 | FLCN | folliculin | ![]() |
![]() |
2 | 6 | ||||||
MIRT518998 | NNT | nicotinamide nucleotide transhydrogenase | ![]() |
![]() |
2 | 4 | ||||||
MIRT521055 | SLC2A3 | solute carrier family 2 member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT521207 | SBNO1 | strawberry notch homolog 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT521818 | POM121C | POM121 transmembrane nucleoporin C | ![]() |
![]() |
2 | 2 | ||||||
MIRT522098 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | ![]() |
![]() |
2 | 5 | ||||||
MIRT522778 | LAMP2 | lysosomal associated membrane protein 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT537815 | EFNB2 | ephrin B2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT539902 | RPL14 | ribosomal protein L14 | ![]() |
![]() |
2 | 4 | ||||||
MIRT540847 | GNAT1 | G protein subunit alpha transducin 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT541217 | HOXA10 | homeobox A10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541432 | CBX4 | chromobox 4 | ![]() |
![]() |
2 | 3 | ||||||
MIRT542810 | PHC3 | polyhomeotic homolog 3 | ![]() |
![]() |
2 | 3 | ||||||
MIRT542837 | PDCD1 | programmed cell death 1 | ![]() |
![]() |
2 | 7 | ||||||
MIRT543062 | BAZ2A | bromodomain adjacent to zinc finger domain 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT543310 | ZNF585B | zinc finger protein 585B | ![]() |
![]() |
2 | 2 | ||||||
MIRT543411 | ANAPC13 | anaphase promoting complex subunit 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543529 | PRSS21 | protease, serine 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543801 | RALGAPB | Ral GTPase activating protein non-catalytic beta subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT543839 | GSG1 | germ cell associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544575 | POLDIP3 | DNA polymerase delta interacting protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544593 | AP5Z1 | adaptor related protein complex 5 zeta 1 subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT544916 | CLSPN | claspin | ![]() |
![]() |
2 | 2 | ||||||
MIRT544969 | UGT2B4 | UDP glucuronosyltransferase family 2 member B4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545190 | MAP4K2 | mitogen-activated protein kinase kinase kinase kinase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT545351 | CCDC83 | coiled-coil domain containing 83 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545686 | DECR1 | 2,4-dienoyl-CoA reductase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545961 | ZBTB10 | zinc finger and BTB domain containing 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545973 | YWHAQ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta | ![]() |
![]() |
2 | 2 | ||||||
MIRT546118 | USP48 | ubiquitin specific peptidase 48 | ![]() |
![]() |
2 | 4 | ||||||
MIRT546611 | SALL1 | spalt like transcription factor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT546619 | RUNX1T1 | RUNX1 translocation partner 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546640 | RTN4 | reticulon 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT547069 | PNISR | PNN interacting serine and arginine rich protein | ![]() |
![]() |
2 | 3 | ||||||
MIRT547131 | PHLPP2 | PH domain and leucine rich repeat protein phosphatase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT547233 | PAG1 | phosphoprotein membrane anchor with glycosphingolipid microdomains 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT547305 | NUCKS1 | nuclear casein kinase and cyclin dependent kinase substrate 1 | ![]() |
![]() |
2 | 3 | ||||||
MIRT547406 | MKX | mohawk homeobox | ![]() |
![]() |
2 | 2 | ||||||
MIRT547463 | MBD4 | methyl-CpG binding domain 4, DNA glycosylase | ![]() |
![]() |
2 | 2 | ||||||
MIRT547546 | LRRFIP2 | LRR binding FLII interacting protein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT547661 | KPNA3 | karyopherin subunit alpha 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT547702 | KPNA1 | karyopherin subunit alpha 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT547968 | HIGD1A | HIG1 hypoxia inducible domain family member 1A | ![]() |
![]() |
2 | 4 | ||||||
MIRT548001 | HCFC2 | host cell factor C2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548018 | GRB2 | growth factor receptor bound protein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548219 | FKBP1A | FK506 binding protein 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT548275 | FBXL20 | F-box and leucine rich repeat protein 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548727 | CRK | CRK proto-oncogene, adaptor protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT548809 | CLIP4 | CAP-Gly domain containing linker protein family member 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548946 | CDK17 | cyclin dependent kinase 17 | ![]() |
![]() |
2 | 3 | ||||||
MIRT549076 | CACUL1 | CDK2 associated cullin domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT549123 | C11orf24 | chromosome 11 open reading frame 24 | ![]() |
![]() |
2 | 4 | ||||||
MIRT549278 | ASH1L | ASH1 like histone lysine methyltransferase | ![]() |
![]() |
2 | 3 | ||||||
MIRT549389 | AMOT | angiomotin | ![]() |
![]() |
2 | 2 | ||||||
MIRT550405 | SLC29A1 | solute carrier family 29 member 1 (Augustine blood group) | ![]() |
![]() |
2 | 4 | ||||||
MIRT550470 | OSCAR | osteoclast associated, immunoglobulin-like receptor | ![]() |
![]() |
2 | 4 | ||||||
MIRT550619 | MTHFR | methylenetetrahydrofolate reductase | ![]() |
![]() |
2 | 2 | ||||||
MIRT550827 | FAM229B | family with sequence similarity 229 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT551383 | EPM2AIP1 | EPM2A interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT551621 | ZNF267 | zinc finger protein 267 | ![]() |
![]() |
2 | 2 | ||||||
MIRT551740 | SSU72 | SSU72 homolog, RNA polymerase II CTD phosphatase | ![]() |
![]() |
2 | 2 | ||||||
MIRT552039 | DNAJC10 | DnaJ heat shock protein family (Hsp40) member C10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT552348 | ZNF704 | zinc finger protein 704 | ![]() |
![]() |
2 | 2 | ||||||
MIRT552744 | YRDC | yrdC N6-threonylcarbamoyltransferase domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT553442 | TPM3 | tropomyosin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT553565 | TMEM161B | transmembrane protein 161B | ![]() |
![]() |
2 | 2 | ||||||
MIRT553620 | TM7SF3 | transmembrane 7 superfamily member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT553777 | TAF13 | TATA-box binding protein associated factor 13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT553812 | SZRD1 | SUZ RNA binding domain containing 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT554702 | RNF149 | ring finger protein 149 | ![]() |
![]() |
2 | 2 | ||||||
MIRT554965 | RACGAP1 | Rac GTPase activating protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT555035 | RAB23 | RAB23, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT555143 | PTPRD | protein tyrosine phosphatase, receptor type D | ![]() |
![]() |
2 | 2 | ||||||
MIRT555229 | PRKAA1 | protein kinase AMP-activated catalytic subunit alpha 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT555278 | PRDM4 | PR/SET domain 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT555431 | PPAP2B | phospholipid phosphatase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT556385 | LURAP1L | leucine rich adaptor protein 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT556861 | KANK1 | KN motif and ankyrin repeat domains 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT557284 | HIST2H2BE | histone cluster 2 H2B family member e | ![]() |
![]() |
2 | 2 | ||||||
MIRT557484 | GPR27 | G protein-coupled receptor 27 | ![]() |
![]() |
2 | 4 | ||||||
MIRT558041 | EXT1 | exostosin glycosyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558511 | CYP26B1 | cytochrome P450 family 26 subfamily B member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT558664 | CNKSR3 | CNKSR family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559006 | CA8 | carbonic anhydrase 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559155 | BTN3A3 | butyrophilin subfamily 3 member A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559536 | ARHGAP12 | Rho GTPase activating protein 12 | ![]() |
![]() |
2 | 5 | ||||||
MIRT560855 | OSBPL3 | oxysterol binding protein like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561153 | KRT33B | keratin 33B | ![]() |
![]() |
2 | 2 | ||||||
MIRT561404 | TUBB2A | tubulin beta 2A class IIa | ![]() |
![]() |
2 | 2 | ||||||
MIRT561878 | MSANTD4 | Myb/SANT DNA binding domain containing 4 with coiled-coils | ![]() |
![]() |
2 | 2 | ||||||
MIRT562031 | LANCL1 | LanC like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562204 | HNRNPA2B1 | heterogeneous nuclear ribonucleoprotein A2/B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562881 | KIAA1456 | KIAA1456 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563090 | SLC25A12 | solute carrier family 25 member 12 | ![]() |
![]() |
2 | 3 | ||||||
MIRT563507 | DLGAP3 | DLG associated protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563705 | THRAP3 | thyroid hormone receptor associated protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563849 | SMDT1 | single-pass membrane protein with aspartate rich tail 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563900 | RAPH1 | Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564336 | CCNT1 | cyclin T1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564482 | ZNF391 | zinc finger protein 391 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564556 | CCDC80 | coiled-coil domain containing 80 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564838 | ZBTB16 | zinc finger and BTB domain containing 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564954 | XKR7 | XK related 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564987 | WNK3 | WNK lysine deficient protein kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565041 | VAV2 | vav guanine nucleotide exchange factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565400 | TGFBR3 | transforming growth factor beta receptor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566122 | RASEF | RAS and EF-hand domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT566654 | NCKAP1 | NCK associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566834 | MAP3K7 | mitogen-activated protein kinase kinase kinase 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT567017 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT567450 | GNG12 | G protein subunit gamma 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT567482 | FZD9 | frizzled class receptor 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568025 | CMTM4 | CKLF like MARVEL transmembrane domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568143 | CCDC88C | coiled-coil domain containing 88C | ![]() |
![]() |
2 | 2 | ||||||
MIRT568477 | ARMC12 | armadillo repeat containing 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568575 | AHNAK2 | AHNAK nucleoprotein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568621 | ACVR2A | activin A receptor type 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT570464 | TLK1 | tousled like kinase 1 | ![]() |
![]() |
2 | 3 | ||||||
MIRT571123 | UBE2H | ubiquitin conjugating enzyme E2 H | ![]() |
![]() |
2 | 2 | ||||||
MIRT571287 | TTLL5 | tubulin tyrosine ligase like 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571431 | RIF1 | replication timing regulatory factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571662 | SERBP1 | SERPINE1 mRNA binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571824 | PHF19 | PHD finger protein 19 | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 2 | |||
MIRT571926 | LSM11 | LSM11, U7 small nuclear RNA associated | ![]() |
![]() |
2 | 3 | ||||||
MIRT574062 | PROSC | pyridoxal phosphate binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT574207 | CLEC2D | C-type lectin domain family 2 member D | ![]() |
![]() |
2 | 2 | ||||||
MIRT574542 | PDIA6 | protein disulfide isomerase family A member 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT574595 | N4BP1 | NEDD4 binding protein 1 | ![]() |
![]() |
2 | 3 | ||||||
MIRT575886 | Cask | calcium/calmodulin-dependent serine protein kinase (MAGUK family) | ![]() |
![]() |
2 | 4 | ||||||
MIRT575928 | Dmpk | dystrophia myotonica-protein kinase | ![]() |
![]() |
2 | 7 | ||||||
MIRT576100 | Pdcd1 | programmed cell death 1 | ![]() |
![]() |
2 | 5 | ||||||
MIRT576593 | Npepps | aminopeptidase puromycin sensitive | ![]() |
![]() |
2 | 2 | ||||||
MIRT614697 | TRAK1 | trafficking kinesin protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT616471 | ADRA2B | adrenoceptor alpha 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT618900 | ANKMY1 | ankyrin repeat and MYND domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621501 | GPRC5A | G protein-coupled receptor class C group 5 member A | ![]() |
![]() |
2 | 4 | ||||||
MIRT640542 | C3orf36 | chromosome 3 open reading frame 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645514 | BSPRY | B-box and SPRY domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT646599 | ANKRD36 | ankyrin repeat domain 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648788 | KLHL40 | kelch like family member 40 | ![]() |
![]() |
2 | 2 | ||||||
MIRT655815 | NOTCH2 | notch 2 | ![]() |
![]() |
2 | 3 | ||||||
MIRT658796 | EIF2B2 | eukaryotic translation initiation factor 2B subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT659260 | CUL3 | cullin 3 | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 2 | |||
MIRT680986 | DCAF17 | DDB1 and CUL4 associated factor 17 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682280 | RS1 | retinoschisin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682518 | GLP2R | glucagon like peptide 2 receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT691713 | FLOT2 | flotillin 2 | ![]() |
![]() |
2 | 3 | ||||||
MIRT693934 | HNRNPA1L2 | heterogeneous nuclear ribonucleoprotein A1-like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701510 | NEGR1 | neuronal growth regulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT702096 | MCFD2 | multiple coagulation factor deficiency 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT702879 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713423 | SLC35E2B | solute carrier family 35 member E2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT714442 | ARHGAP32 | Rho GTPase activating protein 32 | ![]() |
![]() |
2 | 2 | ||||||
MIRT716436 | RAB15 | RAB15, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT717465 | ADORA3 | adenosine A3 receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT720153 | PPIP5K2 | diphosphoinositol pentakisphosphate kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT725130 | SYNRG | synergin gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT726007 | ZNF91 | zinc finger protein 91 | ![]() |
1 | 1 | |||||||
MIRT726084 | ZBTB5 | zinc finger and BTB domain containing 5 | ![]() |
1 | 1 | |||||||
MIRT726128 | VPS33B | VPS33B, late endosome and lysosome associated | ![]() |
1 | 1 | |||||||
MIRT726132 | CHMP3 | charged multivesicular body protein 3 | ![]() |
1 | 1 | |||||||
MIRT726143 | VCL | vinculin | ![]() |
1 | 1 | |||||||
MIRT726158 | USP3 | ubiquitin specific peptidase 3 | ![]() |
1 | 1 | |||||||
MIRT726166 | USP31 | ubiquitin specific peptidase 31 | ![]() |
1 | 1 | |||||||
MIRT726221 | TUBB | tubulin beta class I | ![]() |
1 | 1 | |||||||
MIRT726238 | TRAM1 | translocation associated membrane protein 1 | ![]() |
1 | 1 | |||||||
MIRT726280 | TMEM69 | transmembrane protein 69 | ![]() |
1 | 1 | |||||||
MIRT726287 | TMEM55B | phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 | ![]() |
1 | 1 | |||||||
MIRT726307 | TMEM135 | transmembrane protein 135 | ![]() |
1 | 1 | |||||||
MIRT726317 | TLE4 | transducin like enhancer of split 4 | ![]() |
1 | 1 | |||||||
MIRT726322 | TKTL1 | transketolase like 1 | ![]() |
1 | 1 | |||||||
MIRT726325 | TIMM13 | translocase of inner mitochondrial membrane 13 | ![]() |
1 | 1 | |||||||
MIRT726339 | TFB1M | transcription factor B1, mitochondrial | ![]() |
1 | 1 | |||||||
MIRT726348 | TCF3 | transcription factor 3 | ![]() |
1 | 1 | |||||||
MIRT726356 | TBL1XR1 | transducin beta like 1 X-linked receptor 1 | ![]() |
1 | 1 | |||||||
MIRT726360 | TBCCD1 | TBCC domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT726367 | TBC1D20 | TBC1 domain family member 20 | ![]() |
1 | 1 | |||||||
MIRT726372 | TBC1D14 | TBC1 domain family member 14 | ![]() |
1 | 1 | |||||||
MIRT726384 | TASP1 | taspase 1 | ![]() |
1 | 1 | |||||||
MIRT726410 | SUPT16H | SPT16 homolog, facilitates chromatin remodeling subunit | ![]() |
1 | 1 | |||||||
MIRT726422 | STX17 | syntaxin 17 | ![]() |
1 | 1 | |||||||
MIRT726455 | SRPK1 | SRSF protein kinase 1 | ![]() |
1 | 1 | |||||||
MIRT726462 | SPTLC1 | serine palmitoyltransferase long chain base subunit 1 | ![]() |
1 | 1 | |||||||
MIRT726482 | SMURF1 | SMAD specific E3 ubiquitin protein ligase 1 | ![]() |
1 | 1 | |||||||
MIRT726507 | SLC9A1 | solute carrier family 9 member A1 | ![]() |
1 | 1 | |||||||
MIRT726511 | SLC7A5 | solute carrier family 7 member 5 | ![]() |
1 | 1 | |||||||
MIRT726545 | SLC25A29 | solute carrier family 25 member 29 | ![]() |
1 | 1 | |||||||
MIRT726548 | SLC25A22 | solute carrier family 25 member 22 | ![]() |
1 | 1 | |||||||
MIRT726677 | RPS6KA3 | ribosomal protein S6 kinase A3 | ![]() |
1 | 1 | |||||||
MIRT726680 | RPS5 | ribosomal protein S5 | ![]() |
1 | 1 | |||||||
MIRT726685 | RPL36 | ribosomal protein L36 | ![]() |
1 | 1 | |||||||
MIRT726712 | RNPS1 | RNA binding protein with serine rich domain 1 | ![]() |
1 | 1 | |||||||
MIRT726715 | RNMT | RNA guanine-7 methyltransferase | ![]() |
1 | 1 | |||||||
MIRT726720 | RNH1 | ribonuclease/angiogenin inhibitor 1 | ![]() |
1 | 1 | |||||||
MIRT726756 | RFWD2 | ring finger and WD repeat domain 2 | ![]() |
1 | 1 | |||||||
MIRT726764 | REXO1 | RNA exonuclease 1 homolog | ![]() |
1 | 1 | |||||||
MIRT726773 | RELT | RELT, TNF receptor | ![]() |
1 | 1 | |||||||
MIRT726789 | RAP2C | RAP2C, member of RAS oncogene family | ![]() |
1 | 1 | |||||||
MIRT726812 | RAB40B | RAB40B, member RAS oncogene family | ![]() |
1 | 1 | |||||||
MIRT726826 | RAB11FIP2 | RAB11 family interacting protein 2 | ![]() |
1 | 1 | |||||||
MIRT726853 | PSMB5 | proteasome subunit beta 5 | ![]() |
1 | 1 | |||||||
MIRT726874 | PPP6C | protein phosphatase 6 catalytic subunit | ![]() |
1 | 1 | |||||||
MIRT726902 | POU2AF1 | POU class 2 associating factor 1 | ![]() |
1 | 1 | |||||||
MIRT726910 | POLE4 | DNA polymerase epsilon 4, accessory subunit | ![]() |
1 | 1 | |||||||
MIRT726967 | PGD | phosphogluconate dehydrogenase | ![]() |
1 | 1 | |||||||
MIRT726974 | PEX12 | peroxisomal biogenesis factor 12 | ![]() |
1 | 1 | |||||||
MIRT727021 | PANK1 | pantothenate kinase 1 | ![]() |
1 | 1 | |||||||
MIRT727028 | TM9SF2 | transmembrane 9 superfamily member 2 | ![]() |
1 | 1 | |||||||
MIRT727038 | OTUB1 | OTU deubiquitinase, ubiquitin aldehyde binding 1 | ![]() |
1 | 1 | |||||||
MIRT727068 | NR2C2 | nuclear receptor subfamily 2 group C member 2 | ![]() |
1 | 1 | |||||||
MIRT727096 | NCOR2 | nuclear receptor corepressor 2 | ![]() |
1 | 1 | |||||||
MIRT727137 | MTMR4 | myotubularin related protein 4 | ![]() |
1 | 1 | |||||||
MIRT727154 | MRPL40 | mitochondrial ribosomal protein L40 | ![]() |
1 | 1 | |||||||
MIRT727176 | MLXIP | MLX interacting protein | ![]() |
1 | 1 | |||||||
MIRT727198 | MIB1 | mindbomb E3 ubiquitin protein ligase 1 | ![]() |
1 | 1 | |||||||
MIRT727223 | MED11 | mediator complex subunit 11 | ![]() |
1 | 1 | |||||||
MIRT727228 | MCM3AP-AS1 | MCM3AP antisense RNA 1 | ![]() |
1 | 1 | |||||||
MIRT727262 | LYRM5 | electron transfer flavoprotein regulatory factor 1 | ![]() |
1 | 1 | |||||||
MIRT727268 | LRRC57 | leucine rich repeat containing 57 | ![]() |
1 | 1 | |||||||
MIRT727271 | LRPPRC | leucine rich pentatricopeptide repeat containing | ![]() |
1 | 1 | |||||||
MIRT727297 | LITAF | lipopolysaccharide induced TNF factor | ![]() |
1 | 1 | |||||||
MIRT727349 | KLC2 | kinesin light chain 2 | ![]() |
1 | 1 | |||||||
MIRT727377 | TECPR2 | tectonin beta-propeller repeat containing 2 | ![]() |
1 | 1 | |||||||
MIRT727385 | KATNAL1 | katanin catalytic subunit A1 like 1 | ![]() |
1 | 1 | |||||||
MIRT727426 | IRAK1BP1 | interleukin 1 receptor associated kinase 1 binding protein 1 | ![]() |
1 | 1 | |||||||
MIRT727483 | HYOU1 | hypoxia up-regulated 1 | ![]() |
1 | 1 | |||||||
MIRT727523 | GSK3B | glycogen synthase kinase 3 beta | ![]() |
1 | 1 | |||||||
MIRT727585 | GGA3 | golgi associated, gamma adaptin ear containing, ARF binding protein 3 | ![]() |
1 | 1 | |||||||
MIRT727605 | GANAB | glucosidase II alpha subunit | ![]() |
1 | 1 | |||||||
MIRT727619 | GABARAP | GABA type A receptor-associated protein | ![]() |
1 | 1 | |||||||
MIRT727647 | FRYL | FRY like transcription coactivator | ![]() |
1 | 1 | |||||||
MIRT727701 | FAM73A | mitoguardin 1 | ![]() |
1 | 1 | |||||||
MIRT727719 | AMER1 | APC membrane recruitment protein 1 | ![]() |
1 | 1 | |||||||
MIRT727814 | EDC3 | enhancer of mRNA decapping 3 | ![]() |
1 | 1 | |||||||
MIRT727856 | DSCR3 | DSCR3 arrestin fold containing | ![]() |
1 | 1 | |||||||
MIRT727860 | DPP8 | dipeptidyl peptidase 8 | ![]() |
1 | 1 | |||||||
MIRT727866 | DNAJC9 | DnaJ heat shock protein family (Hsp40) member C9 | ![]() |
1 | 1 | |||||||
MIRT727876 | DICER1 | dicer 1, ribonuclease III | ![]() |
1 | 1 | |||||||
MIRT727910 | CYLD | CYLD lysine 63 deubiquitinase | ![]() |
1 | 1 | |||||||
MIRT727913 | CYB561A3 | cytochrome b561 family member A3 | ![]() |
1 | 1 | |||||||
MIRT727917 | CUL2 | cullin 2 | ![]() |
1 | 1 | |||||||
MIRT727924 | CSDE1 | cold shock domain containing E1 | ![]() |
1 | 1 | |||||||
MIRT727936 | CREG1 | cellular repressor of E1A stimulated genes 1 | ![]() |
1 | 1 | |||||||
MIRT727953 | CPNE1 | copine 1 | ![]() |
1 | 1 | |||||||
MIRT727999 | RHOV | ras homolog family member V | ![]() |
1 | 1 | |||||||
MIRT728006 | CDKN2AIPNL | CDKN2A interacting protein N-terminal like | ![]() |
1 | 1 | |||||||
MIRT728019 | CDC27 | cell division cycle 27 | ![]() |
1 | 1 | |||||||
MIRT728047 | CBFA2T3 | CBFA2/RUNX1 translocation partner 3 | ![]() |
1 | 1 | |||||||
MIRT728092 | C6orf106 | chromosome 6 open reading frame 106 | ![]() |
1 | 1 | |||||||
MIRT728101 | C2orf42 | chromosome 2 open reading frame 42 | ![]() |
1 | 1 | |||||||
MIRT728127 | LRIF1 | ligand dependent nuclear receptor interacting factor 1 | ![]() |
1 | 1 | |||||||
MIRT728133 | C15orf39 | chromosome 15 open reading frame 39 | ![]() |
1 | 1 | |||||||
MIRT728194 | BSG | basigin (Ok blood group) | ![]() |
1 | 1 | |||||||
MIRT728237 | B4GALT1 | beta-1,4-galactosyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT728265 | ATP13A3 | ATPase 13A3 | ![]() |
1 | 1 | |||||||
MIRT728290 | ASXL1 | additional sex combs like 1, transcriptional regulator | ![]() |
1 | 1 | |||||||
MIRT728330 | AP3M1 | adaptor related protein complex 3 mu 1 subunit | ![]() |
1 | 1 | |||||||
MIRT728384 | AFF4 | AF4/FMR2 family member 4 | ![]() |
1 | 1 | |||||||
MIRT728400 | ACOX1 | acyl-CoA oxidase 1 | ![]() |
1 | 1 | |||||||
MIRT731341 | CXCL10 | C-X-C motif chemokine ligand 10 | ![]() |
1 | 1 | |||||||
MIRT735131 | GSDMB | gasdermin B | ![]() |
![]() |
2 | 0 | ||||||
MIRT736201 | DRD1 | dopamine receptor D1 | ![]() |
![]() |
![]() |
3 | 0 |